1.What is the function of a gene?








2.What do the letters you wrote on the graph paper stand for?








3.Which of the two strings of letters you used in this activity represent the gene?

Answers

Answer 1

Answer:

1. the function of a gene is what makes up the human (proteins,characteristics,traits), you can say genes are little chunks of the DNA and lots of chunks is what makes up what is called chromosomes break that up u get chromatins.

2. the letters you wrote on the graph paper stand for what i like to call "DNA script" written form of DNA

exp: ATATTATAGCCGTATACGGC

3. hmmm... i dont get this one but if you were talking about it like this:

A : adenine

G: guanine these two are nucleotides with two rings

~batmans wife dun dun dun....


Related Questions

Why is the oxygen atom of one water molecule attracted to the hydrogen
atom of another water molecule?

Answers

Bc they attract eachother to make h20
The slight positive charges on the hydrogen atoms in a water molecule attract the slight negative charges on the oxygen atoms of other water molecules. This tiny force of attraction is called a hydrogen bond. This bond is very weak.

The circulatory system transports substances such as glucose and oxygen around the body.
(a) Name two other substances that the circulatory system transports around the body.

Answers

Answer: blood

Hormones

Amino acids

Electrolytes

Explanation:

The two other components which are transported by a circulatory system are blood and Hormones and Amino acids.

What is circulatory system?

Blood arteries in the circulatory system move blood away from and toward the heart. Blood leaves the heart through arteries and returns through veins.

Cells receive oxygen, nutrients, and hormones from the circulatory system, which also removes wastes like carbon dioxide. To keep things moving in the right direction, these roads only go in one direction.

The blood picks up oxygen and releases carbon dioxide at the lungs. The pulmonary veins are then used to transport the blood back to the heart.

Therefore, The two other components which are transported by a circulatory system are blood and Hormones and Amino acids.

To learn more about circulatory system, refer to the link:

https://brainly.com/question/10103458

#SPJ2

Which bost describes meiosis?
It produces cells that are identical to the original cell.
It is responsible for the replacement of damaged skin cells.
It is responsible for growth of the organism.
It produces male and female sex cells.

Answers

It produces male and female sex cells

Answer:

It produces male and female sex cells

Explanation:

Which of the following is the BEST definition for drug-resistant pathogens? Select one: a. Pathogens for which scientists have not yet developed antibiotics. b. Pathogens that have evolved a resistance to existing antibiotics. c. Pathogens that can not be affected by antibiotics.

Answers

Hi !

CORRECT ANSWER = B

DRUG-RESISTANT PATHOGENS ►

B- Pathogens that have evolved a resistance to existing antibiotics

-

☺☺☺

b. Pathogens that have evolved a resistance to existing antibiotics.

What are Pathogens?

A pathogen is an organism causing the disease to its host, with the severity of the disease symptoms referred to as virulence. Pathogens are taxonomically broadly diverse and comprise viruses and bacteria in addition to unicellular and multicellular eukaryotes.

Different types of pathogens are-

Bacteria, viruses, and fungi

Learn more about Pathogens here

https://brainly.com/question/1008643

#SPJ2

10. Secondary succession occurs in an area where the community has been
destroyed and the soil has been
A compressed
B destroyed
C preserved
Dremoved

Answers

10. Secondary succession occurs in an area where the community has been
destroyed and the soil has been C preserved

Secondary succession occurs in an area where the community has been destroyed and the soil has been preserved. Thus, the correct option is C.

What is Succession?

Succession may be defined as the gradual and continuous replacement of one community by another community over time.

Secondary succession initiates from a site where life existed before. It includes some activities like a forest fire. The rate of secondary succession is faster than that of primary succession.

Therefore, Secondary succession occurs in an area where the community has been destroyed and the soil has been preserved. Thus, the correct option is C.

To learn more about Succession, refer to the link:

https://brainly.com/question/1824935

#SPJ2

What are the three general properties of stem cells? Check all that apply.

They are capable of dividing and renewing for long periods of time

They are unspecialized cells.

They remain unspecialized cells.

They can give rise to specialized cells.

Answers

They are capable of dividing and renewing for Long periods of time They are unspecialized and they can give rise to speacialized cell types

Answer:

They are capable of dividing and renewing for long periods of time.

They are unspecialized cells.

They can give rise to specialized cells.

Explanation:

PLS HELP
Can you put these cats in the right order (from Largest to Smallest) according to their actual real-life size?

Answers:
A: DCAB
B: BADC
C: CBAD
D: ADCB

Answers

Answer:

A: DCAB

Explanation:

There are lot of different types of domestic cats nowadays, with the variations coming mostly from mutations and selective breeding. Some cats are very small, some pretty large, some have long fur, some don't have fur (or rather seem like they don't) etc. The Siberian cat weighs 8-17 pounds, British shorthair 7-12 pounds, Turkish van 7-20 pounds, ragdoll 8-20 pounds, with the females being smaller than the males.

A Scientist is comparing the outer layer of an onion cell to the outer layer of a human skin cell what is unique about the outer layer of the onion cell compared to the skin cell

Answers

Answer:

the cells of onion are lined and cubical unlike human cells

Answer:

It contains cellulose.

Explanation:

It is mentioning about the cell wall, is only found in plant cells, and what makes it unique is that it is made of cellulose.

About how much moisture can air hold at 20°?

Answers

Answer:

At 20 degrees Celsius air can hold about 20g/m cubed.

Explanation:

Looking at the graph you see that when air temp is 20 water vapor is about 20 because that is the point on the graph.

The answer is 18 or 19 g/m3.

which species will most likely survive if earth temperature increase?

Species A: Thick fur with long hair, small ears

Species B: Fur with short hair, large ears protruding out


A. Species A because fur would provide insulation
B. Species B because fur would provide insulation
C. Species A because small flapping ears would provide cooling
D. Species B because large flapping ears would provide cooling

Answers

Species B, with its fur with short hair and large ears, is more likely to survive if Earth's temperature increases because large ears facilitate cooling by dissipating body heat into the air, which is crucial in warmer climates (option D).

Species A is characterized by thick fur with long hair and small ears, while Species B has fur with short hair and large ears protruding out. It's important to understand how animals adapt to their environment, particularly through features that allow them to conserve or dissipate heat.

Animals with features such as thick fur and blubber are often found in colder climates because these features provide insulation and help to retain body heat. For example, polar bears and arctic foxes use their thick fur and tails to keep warm in subfreezing environments. Conversely, animals like the jackrabbit with long, tall ears dissipate heat through their ears to help cool off in warmer climates.

When Earth's temperature increases, animals with adaptations that help them dissipate heat are more likely to thrive. Therefore, the correct answer is D. Species B because large flapping ears would provide cooling. Species B's larger ears allow for more heat to be dissipated, which is an advantageous trait in a warmer climate, while thick fur would be detrimental in such conditions.

Species B, with short hair and large ears, would be more likely to survive in warmer climates as large ears help in heat dissipation. Thick fur and small ears, as in Species A, are more adapted to cold climates and conserve heat.

Adaptations to Increased Earth Temperature

Considering the adaptations required for surviving in an environment with increased temperatures, Species B, with fur with short hair and large ears protruding out, is more likely to survive. This is because large ears facilitate the dissipation of body heat, which is crucial in warmer climates. Species like the jackrabbit use their long ears containing dilating blood vessels to release body heat into the air. Conversely, species with thick fur and small ears, like Species A, have adaptations suitable for conserving heat in colder environments.

Furthermore, Allen's rule highlights the trend that animals in warm climates tend to have longer limbs and ears for better heat dissipation. Species B aligns with this rule, having features like large ears that would provide cooling, making it better suited for survival if Earth's temperature increases.

The total amount of water a tank can hold is 145 gallons. Raul wants to find out how many 14-gallon buckets of water can be
used to fill the tank Which expressions could be used to represent this scenario? Check all that apply

Answers

Answer:

11

Explanation:

the answer is 11 because 14 times 10 is 140, and theres 14 gallons in a bucket, so there's still 5 gallons remaining. the 11th one is used for the remaining 5 gallons.

Answer:

A and C

Explanation:

Organisms mad of only single cell are called
A . Multicellular
B. Eukaryotic
C. Unicellular
D. Heterotrophs

Answers

C. unicellular
(Like UNIcycle only has one wheel)

Answer:

C. Unicellular

Explanation:

Organisms mad of only single cell are called Unicellular.

Uni means 1.

Just like a Unicycle has 1 wheel.

Consider this animal cell.

Answers

can you take a picture of it

Answer: pictures??

Explanation:

Echolocation is an adaptation bats use to _______. a. hunt insects in flight b. locate flowering plants c. find warm places for hibernation d. all of the above Please select the best answer from the choices provided A B C D

Answers

Answer:

d. all of the above

Explanation:

The bats are the only mammals that have managed to perfect flight. They have managed to develop wings, but have started to have a nocturnal life, so in order to be more effective, they have developed their senses like the smell and hearing better, and also developed something new, echolocation. Because the eyesight was not really needed, the bats became almost blind, having very bad eyesight. The echolocation replaced their eyesight though, and it has proven as a very effective adaptation. It is an adaptation that manages to locate objects, food source, be it insects or flowering plants, as well as caves for shelter from predators and cold weather.

What causes metamorphic rocks to form from existing rocks?

Answers

The rocks formed by the modification of other preexisting rocks in the interior of the Earth through a process called metamorphism. Through heat, pressure and / or chemically active fluids, the transformation of rocks undergoing structural and mineralogical adjustments takes place. The agents of metamorphism make possible that igneous rocks, sedimentary rocks or other metamorphic rocks, when subjected to pressures ranging from less than 1,000 to up to 16,000 bar, at temperatures ranging from 200 to 1,000 ° C, and / or an active fluid, cause changes in the composition of the same, providing new substances to them. The rock that is generated will depend on the composition and texture of the original rock, the time it was subjected to the effects of the so-called metamorphic process, as well as the agents of the same metamorphism. The precursor of a metamorphic rock is called protolite.

Answer:

can't give uu a answer but i can give u a explanation

Explanation:

Metamorphic rocks form when rocks are subjected to high heat, high pressure, hot mineral-rich fluids or, more commonly, some combination of these factors. Conditions like these are found deep within the Earth or where tectonic plates meet.

how do yeast cells benefit from fermentation

Answers

Answer:

When yeast cells are used in making bread rise, they get energy from the sugar mixed within the bread dough. When oxygen is present, these single celled fungi perform cellular respiration. When there is no oxygen they perform fermentation. By performing fermentation they produce carbon dioxide gas (which causes the bread to rise) and energy storing molecules called ATP. By fermentation they produce more and more ATP. More and more energy.

Explanation:

This type of mutation occurs when one or more base pairs are added to the gene sequence. PLEASEEEEE HELPPPPP MEEEE!!!!

Answers

Answer:

Insertion

Explanation:

Mutation is a phenomenon in which the nucleotide sequence of a gene in DNA is changed into a new sequence due to insertion, deletion or  exchange of a gene segment.

Insertion is a type of  mutation in which one or more than pne base sequence in added into the DNA of an organism. This insertion may or may not be dangerous depending on the place of insertion and how it is causing adverse effects on the protein product of the gene.

Here is an example of insertion mutation:

Base sequence: AUG GCC TGC

Product:           met     ala      gln

Insertion:

Base sequence: AUG GCC   C TG     C

Product:              met     ala      Leu

So we can see that the product protein is changed because of insertion.

Hope it helps!

Answer:

insertion

Explanation:

i got it right

What does this graph tell you about the relationship between temperature and the amount of water vapor that air can hold?

Answers

Answer:

As the temperature increases so does the amount of moisture that the air can hold.

Explanation:

The graph shows that at 0 degrees C air can hold about 5 g/m cubed while at 20 it can hold 19 g/m cubed meaning that the amount of moisture increases as temperature increases.

Answer:

heat and cold going up

Explanation:

What was the purpose of miller and urey's experiment?

a. to find out of prokaryotes evolved from eukaryotes
b. to determine whether prokaryotes have cell membranes
c. to measure the number biological molecules on earth
d. to see if simple molecules can combine spontaneously

Answers

Answer:

d. to see if simple molecules can combine spontaneously

TRUST ME!

Explanation:

I just did it and got it correct your choice but you should trust me.

Answer:

D. To see if simple molecules can combine spontaneously on early Earth.

Explanation:

A.P.E.X.


What is gene flow?
O
A. A method of artificial selection
O
B. A random change in allele frequencies
O
C. When the population drops suddenly, then grows
D. The transfer of genes from one gene pool to another

Answers

It is the transfer of genes from one gene pool to another.

Answer is D to the question

1. describe 2 benefits and 2 drawbacks there might be for animal cells ( including humans) to make their own food through photosynthesis.

Answers

Hi

Firstly we will go through the benefits, if animal cells were able to prepare their own food through photosynthesis:

1: No dependency on plants:

We and other animals would not be dependent on plants for any sort of food source and plants would be able to grow and flourish better increasing the overall scenic beauty of our planet which somehow is getting devastated because of human food needs.

2: No requirement of waiting for food in malls to getting the body recharged:

If we were able to prepare own food, we would never be getting tired due to lack of energy, we would always be creating our food side by side during daily activities without the need of spending lots of time and money on food courts.

Drawbacks:

1: No food business:

If we were able to make own food in body, there would be no food businesses in world like restaurants and the world would be a much boring place

2: No diversity of food choices;

If we were able to make own food in body, there would be no food diversity in the world. Each one of us would be using same food for energy. there would be much boring life.

Hope it helps!

The benefits of photosynthesis in an animal cell is we do not have to make food externally, No dependency on plant and animal for food.

The drawback of photosynthesis in the animal cell is photosynthesis produces a comparatively lower amount of energy, and photosynthesis makes cellulose which is difficult to digest by animal cells.

What is photosynthesis?

Photosynthesis is a process by which plants make their own food with the help of sunlight, water, and chlorophyll.

Benefits:

If the human cell can make their own food, then there would be no dependency on plants and animals for food.

We do not have to prepare food, this will save a lot of time for humans.

Drawbacks:

The energy produced by photosynthesis is very low, which can not regulate the functions of the animal body.

There are too many functions in the animal body, if cells are indulged in the food-making process, then the process would become very slow.

Thus, these are the benefits and drawbacks of photosynthesis in an animal cell.

Learn more about photosynthesis, here:

https://brainly.com/question/1388366

what does it mean that a hypothesis must be falsifiable in order to be valid ​

Answers

Answer:

It means that a hypothesis must be able to be rejected by the experiment proposed.

Explanation:

In science, a hypothesis can either be supported or refuted after conducting an experiment. No hypothesis will be valid unless there is a possiblility for it to be refuted by the experiment.

Answer:

It means that a hypothesis could only be considered true or false, not from its verifiability, but from its falsifiability

Explanation:

The scientific observation is always oriented previously by a hypothesis to be proven, that is, the science that is based on the inductive method selects the phenomena that will be investigated for the proof of something that is already supposed. For this reason, the verifiability criterion will not always be valid.

Hypotheses that offer no possibility of being refuted through experience should be considered as myths, not as science. To say that a scientific hypothesis must be falsifiable empirically means to say that a scientific theory must offer the possibility of refutation - and, if refuted, should not be considered.

17. What's mass?
A. A measure of an element's attraction for electrons
B. The force that gravity exerts upon an object
C. The sum of the number of protons and neutrons in an atom
D. A measure of the amount of matter an object contains

Answers

Answer:

The force that gravity exerts upon an object.

The answer is D
A measure of the amount of matter an object contains is mass

The chemicals released in a synapse when a signal passes through are _________. The chemicals released in a synapse when a signal passes through are _________.

Answers

Answer:

Neurotransmitters

Explanation:

Examples of neurotransmitter are acetylcholine, epinephrine, dopamine, GABA, serotonin, and etcetera. They are released from synaptic vesicles in the presynaptic membrane. They then diffuse through the synaptic cleft or neuromuscular junctions and bind to their receptors on the postsynaptic membrane and invoke an impulse.  

Which of the following is an example of an adaptation?

A dog sits when it hears a a command because it’s owner rewards it with food

B. The coloring of a monarch butterfly alerts predators to the fact that the butterfly is poisonous.

C. Birds that live near a highway learn not to fly away every time a car passes

D. Pigeons make their nests near an outdoor restaurant, where food is always available.

Answers

Answer:

B

Explanation:

The butterfly formed those adaptions so predators are less likely to eat it

What is the precipitate in the following reaction?
BaCl2(aq) + Na2SO4(aq) → BaSO4(s) + 2NaCl(aq)
O A. Na2SO4
O B. Baso
O
c. BaCl2
O D. Naci

Answers

Answer:

Precipitates of BaSO4 will be formed.

Explanation:

Most of the sulphates are soluble but barium sulphate is not soluble, it forms precipitates in the mixture. This reaction is of much industrial importance for production of barium sulphate and is used in paints too.

PLEASE HELP ASAPPP !

box one choices:
•a compound
•a mixture
•an element

box two choices
•alike
•bonded chemically
•mixed together

Answers

Answer:

Box one: A compound

Box two: bonded chemically

Explanation:

it's a molecule, which is a collection of atoms bonded together chemically through their electrons.

hope that helps!

Describe the difference between the messenger RNA transcript produce by rna polymerase in the nucleus and the mRNA transcript that binds to the ribosomal subunits in the endolplasimic reticulum.

Answers

Answer:

The mRNA transcript that is produced in the nucleus is in immature form, it had to get matured, and then its capping and tailing is done. 5' cap is added and a poly A tail is added at 3' end of this mRNA. This helps it to get matured. moreover for its maturation the non-coding regions (introns) are removed and exons are packed up again to form a mature mRNA.

This mature mRNA then proceeds to its way to the ribosomes for translation of proteins.

The pre-mRNA transcript is synthesized in the nucleus and undergoes processing including splicing, capping, and polyadenylation to become mature mRNA. This mature mRNA then exits the nucleus and binds to ribosomal subunits in the endoplasmic reticulum for protein synthesis.

The difference between the messenger RNA (mRNA) transcript produced by RNA polymerase in the nucleus and the mRNA transcript that binds to ribosomal subunits in the endoplasmic reticulum involves several key processing steps. The initial RNA transcript synthesized by RNA polymerase II is known as pre-mRNA.

This pre-mRNA undergoes several processing events before becoming a mature mRNA that can be translated into protein. The processing includes splicing to remove introns (non-coding regions), addition of a 5' cap, and polyadenylation, adding a poly(A) tail at the 3' end. These modifications are crucial for mRNA stability, nuclear export, and translation efficiency. Once processed, the mature mRNA exits the nucleus and can associate with ribosomes on the endoplasmic reticulum, forming the protein synthesis complex.

Pleaseeeeeeeeeeee help ......

Answers

Answer:

The population will start dying off.

Explanation:

As the individuals compete for a fixed amount of resources, the juveniles and diseased and weaker individuals will lose the competition

The process will start happening around Year 3, but it will become a life-and-death battle for survival in Year 5.

The poputation will stabilize at 14 600 individuals.

This food web represents a community in a rain forest.
boa constrictor
beetle
coati
poison dart frog
sloth
strangler fig -
fungus
fruit bat
If people took most of the boa constrictors from this community, which
changes would be likely to occur? Select the three correct answers.

Answers

Answer:

coatis would increase

sloths would increase

fruit bats would increase

Explanation:

The boa constrictor in this food chain is the top predator, thus it is on the top of the food chain. It preys on several of the animals on this list, such as the coati, sloth, and fruit bats, so it is regulating their numbers. If the boa constrictor is removed from the ecosystem, the ecosystem will lose its predator, so the animals on which the boa constrictor preyed upon will have no threat, thus will experience rapid increase in their numbers. The coatis, sloths, and fruit bats, all will be predator free in this scenario, so they will all experience increase in their population, which in turn will have big effect on all other species in the ecosystem.

Other Questions
What are three examples of form of music? A novelty golf ball of mass m is launched with an initial velocity v0 = (25i + 13j) m/s and then follows a parabolic trajectory. At the top of the balls trajectory, it explodes into two fragments A and B. Fragment A has mass mA = 1/3 m and is stationary immediately after the explosion, while Fragment B has mass mB = 2/3 m and has non-zero velocity vB immediately after splitting from Fragment A. In answering the following questions, ignore air resistance and assume the terrain over which the ball and fragments fly is level.(a) How many seconds after the launch does the ball attain its maximum height? (b) What is the velocity v of the ball immediately prior to the explosion? (c) What is the velocity of Fragment B immediately before it hits the ground? Which of the following were NOT accomplishments of the Incas?creation of a large road networkdevelopment of a written languageexpansion through conquestdevelopment of a calendar I dont know the answer to the question in the picture above. Is it A, B, C, or D An object of mass m travels along the parabola yequalsx squared with a constant speed of 5 units/sec. What is the force on the object due to its acceleration at left parenthesis 2 Superscript 1 divided by 2 Baseline comma 2 right parenthesis? (Remember Newton's law, Fequalsma.) How does transpiration pull work? Are relationships important? Why or why not? Calculate the force of gravity on the 1.2-kg mass if it were 1.9107 m above earth's surface (that is, if it were four earth radii from earth's center). the eye of a hurricane has theA. Most intense rainfall B. Highest wind speedsC. Highest air pressureD. Warmest temperatures Suppose you know that a companys stock currently sells for $56 per share and the required return on the stock is 10 percent. You also know that the total return on the stock is evenly divided between a capital gains yield and a dividend yield. If its the companys policy to always maintain a constant growth rate in its dividends, what is the current dividend per share? A company has an operating income of $100 million, depreciation of $15 million, an asset sale of $50 million, a capital expenditure of $10 million, and an increase in net working capital of $10 million. Calculate this companys free cash flow for the year. Americanization was:a.the spread of American culture in South Vietnam to display the benefits of capitalism.b.Nixons term for the transformation of young people into real Americans when they refrained from protesting against the war.c.the State Department program offering fast-tracked political asylum for South Vietnamese military officials and their families.d.the Viet Congs policy of immediate execution of defectors recaptured from the South Vietnamese army.e.Nixons Vietnam strategy to have American troops gradually withdraw and South Vietnamese troops assume more of the fighting. Determine Whether the following function is even, odd, or neither f(x) = x^4 + 7x^2 - 30 whats the difference between past time focus and present time focus African kingdoms that provided slave labor to the americans How is the reproductive system different from otherbody systems? Clutter on the stairs has no affect on the risk of tripping and falling. (4 points) Question 6 options: 1) True 2) False Create a mapping diagram of the relation. Define the domain and range. Tell whether the relation is a function. For both. A consumer would pay an extra if they used the rent to own program to buy the computer, rather than using cash. For all of the items, using is the cheapest option over the life of the contract. The most expensive overall option is to use to purchase the item. when you add 14+19+28+37, how many set of ten must be carried from the units column to the tens column