3. What property describes the number
sentence?
6 +0= 6

Answers

Answer 1

Answer:

The Identity Property

Step-by-step explanation:

Identity Property means the number's Identity stays the same; usually either itself times 1, or plus zero

6 + 0 = 6 is an example of the Identity Property

Answer 2

Answer: Hello there! Just a helping hand here, its an additive identity property. Hope this helps! -Skyler

Step-by-step explanation:

The additive identity property states that the sum of any number and zero is the original number.


Related Questions

Reduce the fractions 32/68,22/28, and
21/49

Answers

32/68- divide by 4 . 32/4=8, 68/4=17

22/28- divide by 2. 22/2=11, 28/2=14

21/49- divide by 7. 21/7=3, 49/7=7

Answers:

32/68=8/17

22/28-11/14

21/49=3/7

Step-by-step explanation:

[tex]\dfrac{32}{68}=\dfrac{32:2}{68:2}=\dfrac{16:2}{34:2}=\dfrac{8}{17}\\\\\\\dfrac{22}{28}=\dfrac{22:2}{28:2}=\dfrac{11}{14}\\\\\\\dfrac{21}{49}=\dfrac{21:7}{49:7}=\dfrac{3}{7}[/tex]

Natalie read 3 4 of a book that is 120 pages long. How many pages does she have left to read?

Answers

Answer:30

Step-by-step explanation:

120 divided by 4

Answer:

30 pages

Step-by-step explanation:

if natalie has read 3/4 pages  of a book it means that she only remains with 1/4 pages of the book for her to complete reading the book.

therefore if the book is made of 120 pages ,what is the 1/4 of the total 120 pages.

       =  1/4  * 120pages

        = 30 PAGES


1. Two angles are supplements. The larger is 10 more than 4 times the smaller. Find both angles,

2. Two angles are supplements. They're equal in measure. Find both angles.

3. The supplement of an angle is three times the complement of the angle. Find the angle.

4. The supplement of an angle is 12 less than twice the angle. Find both angles.

Answers

Step-by-step explanation:

Supplementary angles equal 180°

1. Let the two angles be x and y

then y = 4x + 10

x + y = 180

x + (4x + 10) = 180

5x + 10 = 180

5x = 180 - 10

5x = 170

x = 170 / 5

x = 34

x = 34y = 146

2. if the two angles are equal then divide 180 by 2 to get 90

3. 180 - x = 3(90 - x)

180 - x = 270 - 3x

2x = 90

x = 45

4. 180 - x = 2x - 12

180 - 12 = 2x + x

168 = 3x

x = 56

9. Solve for x,
9x - 25
5x + 7
N​

Answers

Answer:

x = 8

Step-by-step explanation:

Simplifying

9x + -25 = 5x + 7

Reorder the terms:

-25 + 9x = 5x + 7

Reorder the terms:

-25 + 9x = 7 + 5x

Solving

-25 + 9x = 7 + 5x

Solving for variable 'x'.

Move all terms containing x to the left, all other terms to the right.

Add '-5x' to each side of the equation.

-25 + 9x + -5x = 7 + 5x + -5x

Combine like terms: 9x + -5x = 4x

-25 + 4x = 7 + 5x + -5x

Combine like terms: 5x + -5x = 0

-25 + 4x = 7 + 0

-25 + 4x = 7

Add '25' to each side of the equation.

-25 + 25 + 4x = 7 + 25

Combine like terms: -25 + 25 = 0

0 + 4x = 7 + 25

4x = 7 + 25

Combine like terms: 7 + 25 = 32

4x = 32

Divide each side by '4'.

x = 8

Simplifying

x = 8

1) What is the value for the digit 8 in the given number?
38.165.0479​

Answers

Answer:

The value of the 8 in the number 38.165.0479 is 8 ones

I am joyus to assist anytime i can :)

15 divided by a number r

Answers

Answer:

6

Step-by-step explanation:

15/r r/15 if you’re looking for an expression

what is the value of 3 times 10 to the negative 5th power

Answers

(3*10)^-5 is 30^-5 which is 1/30^5 which is 1/24,300,000...

325.876 in expanded from using decimals

Answers

300+20+5+0.8+0.07+0.006

Happy to help! Please mark me as the brainliest!

Derive the equation of the parabola with a focus at (−2, 4) and a directrix of y = 6. Put the equation in standard form.

f(x) = one fourthx2 − x + 4
f(x) = −one fourthx2 − x + 4
f(x) = one fourthx2 − x + 5
f(x) = −one fourthx2 − x + 5

Answers

Answer:

B

Step-by-step explanation:

From any point (x, y) on the parabola the focus and directrix are equidistant.

Using the distance formula

[tex]\sqrt{(x+2)^2+(y-4)^2}[/tex] = | y - 6 |

Squaring both sides

(x + 2)² + (y - 4)² = (y - 6)² ←  distributing

x² + 4x + 4 + y² - 8y + 16 = y² - 12y + 36 ( subtract y² - 12y + 36 from both sides )

x² + 4x + 4 + 4y - 20 = 0 ( subtract x² + 4x + 4 from both sides )

4y - 20 = - x² - 4x - 4 ( add 20 to both sides )

4y = - x² - 4x + 16 ( divide through by 4 )

y = - [tex]\frac{1}{4}[/tex] x² - x + 4, that is

f(x) = - [tex]\frac{1}{4}[/tex] x² - x + 4 → B

Answer:

Option B

Step-by-step explanation:

Given that a parabola has a focus at (−2, 4) and a directrix of y = 6.

We have to find the equation of the parabola in std form

We know that a parabola is a conic section in which all points are equidistant from the focus and vertex.

Let (x,y) be any point on the parabola

Distance of (x,y) from the focus =[tex]\sqrt{(x+2)^2+(y-4)^2}[/tex] ...i

Distance of (x,y) from directrix = difference in y coordinate = [tex]|y[-6|[/tex]...ii

Since i = ii, square and equate both

[tex](x+2)^2+(y-4)^2=(y-6)^2\\x^2+4x+4 -8y+16 = -12y+36\\4y=-x^2-4x+16\\y = \frac{-1}{4} d^2-x+4[/tex]

Hence option B is right.

The total cost of renting a car is determined by the number of days a car is rented, at $75 per day, and the number of miles it is driven, at $0.50 per mile. The company uses the expression 75x +0.50y to evaluate the total cost of renting a car. What does the variable x represent? *

Answers

X=number of days rented and in this case you can’t rent for a negative amount of days, so X>1 or X=0

Answer:

Given: The total cost of renting a car is determined by the number of days a car is rented, at $75 per day, and the number of miles it is driven, at $0.50 per mile. The company uses the expression [tex]75x +0.50y[/tex] to evaluate the total cost of renting a car.

To check: We need to check what does the variable x represent.

Here, the company uses the expression [tex]75x +0.50y[/tex] to evaluate the total cost of renting a car.

Here 75 represents the rent per day, and 0.50 represents the cost per mile.

As, x is multiplied by 75. So, the variable x represents the number of day one has taken the car.


Which equation could be solved using the graph above?

X^2+x-2=0
X^2+2x+1=0
X^2-1=0
X^2-2x+1=0

Answers

The equation that could be used to solve the graph above is x² - 1 = 0.

What is a quadratic equaton?

A quadratic equation is an algebraic expression in the form of variables and constants.

A quadratic equation has two roots as its degree is two.

The graph of a quadratic equation y = x² is a parabola that opens upwards.

By observing the graph we conclude that when x = 0, y = - 1 and when

x = ± 1, y = 0.

Now going through the options we conclude that x² - 1 = 0 is the equation that satisfies this criterion.

learn more about quadratic equations here :

https://brainly.com/question/17177510

#SPJ2

Final answer:

The equation that can be solved using the graph is x^2 - 2x + 1 = 0.

Explanation:

The equation that could be solved using the graph above is x2 - 2x + 1 = 0. This is because the graph intersects the x-axis at the point where y=0, and this represents the solutions to the equation.

If we solve the equation x2 - 2x + 1 = 0 using factoring or the quadratic formula, we would find that the solutions are x=1 and x=1. These are the same x-values where the graph intersects the x-axis on the graph provided.

The other equations, x2 + x - 2 = 0, x2 + 2x + 1 = 0, and x2 - 1 = 0, do not have solutions that match the x-values where the graph intersects the x-axis.

Learn more about graph and equation intersection here:

https://brainly.com/question/38002784

#SPJ11

Which of the following is most likely the next step in the series?
оооо

Answers

the second choice is the answer

Answer:

Answer would be B.

Step-by-step explanation:

I need to know the answers of 10, 12, and 14

Answers

Answer:

10: 2

12: 0

14: 24

A carpenter goes through 2 2 ⁄6 boxes of nails finishing 3 1 ⁄4 rooves. How much would he use finishing 2 rooves?

Answers

Answer:

1 17/39 boxes.

Step-by-step explanation:

3 1/4 rooves requires 2 2/6 boxes

So  2 rooves require 2 * 2 2/6  / 3 1/4 boxes.

= 2 * 14/6 /  13/4

= 28/6 * 4/13

= 56/39

= 1 17/39 boxes.

Final answer:

The question involves calculation of usage rate per roof by dividing the total boxes used by the number of rooves completed and then applying that rate to determine number of boxes needed for 2 rooves.

Explanation:

The question asks how many boxes of nails a carpenter would use for 2 rooves if he goes through 2 2/6 boxes to complete 3 1/4 rooves. To find out the number of boxes needed for 2 rooves, we need to calculate the rate of nail box usage per roof and then apply that rate to 2 rooves.

First, we simplify 2 2/6 to a mixed number: 2 1/3.
Then we divide the number of boxes by the number of rooves to get the usage rate per roof:
2 1/3 boxes ÷ 3 1/4 rooves = usage rate per roof.
Once we get the usage rate, we multiply it by 2 to find the boxes needed for 2 rooves.
This process involves converting mixed numbers to improper fractions, performing division, and then multiplication.

Learn more about Box of Nails here:

https://brainly.com/question/2253908

#SPJ2

6. Which property is illustrated by the equation
ma + mb = m(a + b)?
what’s the answer

Answers

Step-by-step explanation:

It's the DISTRIBUTIVE PROPERTY:

m(a + b) = ma + mb

[tex]m\cdot(a+b)=m\cdot a+m\cdot b=ma+mb[/tex]

Other properties:

Commutative Property:

of addition: a + b = b + a

of multiplication: a · b = b · a

Associative Property:

of addition: (a + b) + c = a + (b + c)

of multiplication: (a · b) · c = a · (b · c)

Expanded form of 680,705

Answers

[tex]\huge\boxed{600,000 + 80,000 + 700 + 5}[/tex]

To find expanded form, we need to split up the digits. When you do that, you take one digit and cut off everything to the left of it, then make everything to the right zeros.

[tex]600,000 + 80,000 + 0 + 700 + 0 + 5[/tex]

We don't need to keep the zeros.

[tex]\boxed{600,000 + 80,000 + 700 + 5}[/tex]

We can check this by adding the numbers back up to get [tex]680,705[/tex].

[tex]680,000 + 700 + 5[/tex]

[tex]680,700 + 5[/tex]

[tex]680,705[/tex]

Solve for m.

m - 5= √49
A.m=2
B.m=7
C.m=12
D.m=35

Answers

Answer:

C

Step-by-step explanation:

The square root of 49 equals 7

This equation can be rewritten as m-5=7

m-5=7

1) add 5 to both sides:

m=12

Nothing else can be done so m=12 is your final answer (c)

The estimated answer to a multiplication problem is 800,000. Which of the following expressions could result in this answer? Explain how you know.
8,146 x 12
81,467 x 121
8,146 x 121
81,477 x 1,217

Answers

Answer:

8,146 x 121

Step-by-step explanation:

This is a problem in which you need to measure your understading of "orders of magnitude."

If the estimated answer is [tex]800000[/tex] that means that we are looking at a multiplication in the "order of" [tex]8*10^5[/tex]

You need to look at the "orders of magnitude" of the things you're multiplying. In the first case, we have [tex]8146*12[/tex] that would be "of the order of" [tex]8*10^3[/tex] times [tex]10^1[/tex]. So the whole multiplication would "of the order of" [tex]8*10^4[/tex] or near [tex]80000[/tex]

The correct answer, 8,146 x 121, is because it's "of the order of" [tex]8*10^3[/tex] times [tex]10^2[/tex] and the gives us the [tex]8*10^5[/tex] we need.

Answer:

Step-by-step explanation:

88

HELP! Consider the function represented by the graph. On a coordinate plane, a straight line with a negative slope begins on the y-axis at (0, 9) and exits the plane at (8, 1). What is the domain of this function?

Answers

Answer:

{ x | x ≥ 0 }

Step-by-step explanation:

Given,

There is a straight line started from (0, 9) and passes through (8, 1),

∵ In the coordinate plan, the values of x are arranged in increasing order to the right side of the y-axis,

Thus, the line is defined for all real values of x greater than 0,

Hence, Domain of the line = All real numbers greater than equal to 0,

i.e. { x | x ≥ 0 }

Thus, FIRST OPTION is correct.

Answer:

Its A

Step-by-step explanation:

Solve for "X".
x2 = 121
X = ? or x = ?​

Answers

X= 11 or x=-11. I believe you meant to say x^2=121?

write 0.00052 in scientific notation.​

Answers

5.2 x 10 to the negative 3 power

The number 0.00052 in standard form can be written as 5.2 × 10⁻⁴ in scientific notation.

Given that:

The number 0.00052 is given in the standard form.

This has to be converted into the scientific notation.

Scientific notation is the notation of writing smaller numbers or larger numbers as the product of an integer from 1 to 10 and the power of 10 is raised to positive or negative power.

Here, the number is very small.

So, the power of 10 is negative.

Here, the integer is 5.2.

The decimal point has to be shifted 4 places to the left.

So, the power of 10 is -4.

Hence, the number can be written as 5.2 × 10⁻⁴.

Learn more about Scientific Notations here :

https://brainly.com/question/16936662

#SPJ6

How to solve this question

Answers

7(x + 3 ) = 6 - (-7x - 15)

Apply the distributive rule to remove parentheses.

7x + 21 = 6 + 7x + 15

Right away, you should be able to see that 7x will be cancelled rendering this equation to have no solution.

Answer: NO SOLUTION

First distribute
7x + 21 = 6 + 7x + 15

Cancel equal terms
7x + 21 = 21 + 7x
-7x -7x

Then you’ll get
21=21


So the statement is true

3 lines are shown. A line with points T, R, W intersects with a line with points S, R, V at point R. Another line extends from point R to point U in between angle V R W. Which pair of angles are vertical angles? AngleWRU and AngleSRT AngleWRS and AngleVRT AngleVRU and AngleTRS AngleVRT and AngleSRT

Answers

Answer:

The vertical angles are ∠ WRS and ∠ VRT ⇒ 2nd answer

Step-by-step explanation:

* Lets explain the meaning of the vertical angles

- Vertical angles are the angles opposite to each other when two lines

  are intersected

- The vertical angle are equal in measures

- Look to attached figure which represents the lines

∵ Line TW intersects line SV at R

∠ WRV and ∠ SRT are vertical angle

∠ WRS and ∠ VRT are vertical angle

∵ RU is between the rays of angle VRW

∴ RU intersects the lines TW and SV at R

∴ No vertical angles between RU and the other two lines because

  it intersects them its endpoint R

* Now lets look to the answer to chose the right one

- ∠ WRU and ∠ SRT are not vertical angles

- ∠ WRS and ∠ VRT are vertical angles

- ∠ VRU and ∠ TRS are not vertical angles

- ∠ VRT and ∠ SRT are not vertical angles

The pair of angles that are vertical angles is: ∠WRS and ∠VRT.

What are Vertical Angles?

When two straight lines intersect each other at a point, the opposite angles that are vertical to each other are called vertical angles.

∠WRS and ∠VRT are vertically opposite each other.

Therefore, the pair of angles that are vertical angles is: ∠WRS and ∠VRT.

Learn more about vertical angles on:

https://brainly.com/question/14362353

80% of ____games is 32 games​

Answers

Answer:

If its multiplying then 40 if adding then 31.2

Step-by-step explanation:

Put 80 over 100

simplify to get 4/5x  = 32

Multiply both sides by 5/4 (because you flip)

the fives cancel out and the fours

then you have x=5/4 x 32

four goes into 32 making it x=5 x 8

5x8=40  

:)

Answer:

The answer is 40.

Step-by-step explanation:

80% + 20% = 100%

80% ÷ 20% = 4

32 ÷ 4 = 8

32 + 8 = 40

100% = 40

Simplify:(-3x)(-2x5)

Answers

Answer: 30x

Multiply  

2

by  

5

.

3

x

10

Multiply  

10

by  

3

.

30

x

Answer:

6[tex]x^{6}[/tex]

Step-by-step explanation:

Using the rule of exponents

[tex]a^{m}[/tex] × [tex]a^{n}[/tex] ⇔ [tex]a^{(m+n)}[/tex]

Given

(-3x)(-2[tex]x^{5}[/tex])

= - 3 × [tex]x^{1}[/tex] × - 2 ×[tex]x^{5}[/tex]

= (- 3 × - 2) × [tex]x^{(1+5)}[/tex]

= 6[tex]x^{6}[/tex]

PLEASE HELP! ILL MARK BRAINLIEST!
Describe how to transform the graph of f into the graph of g. f(x) = x^4 and g(x) = -(-x)4

Reflect the graph of f across the x-axis and then reflect across the y-axis.

Shift the graph of f down 1 unit.

Reflect the graph of f across the x-axis.

Reflect the graph of f across the y-axis.

Answers

Answer:

Reflect the graph f(x) across the x axis to obtain the graph g(x).

its c

Step-by-step explanation:

following the accepted steps you would first reflect the graph across the y axis due to the negative sign within the function, then you would reflect the result across the x axis due to the negative sign outside of the function. 

In practice however you only need to reflect across the x axis as -(-x)^2 simplifies to -x^2

URGENT These are just 3 easy fill in the blank math problems. Integers




1. When adding *blank* signs in addition you should add and keep the sign


2. When subtracting integers you can change the minus to a plus and take the *blank* of the next number. Then follow addition integer rules.


3. When adding *blank* signs in addition you should subtract and keep the sign of the larger number

Answers

Answer:

Bedhshshhssjbsbwbsbw

Step-by-step explanation:

Fhdhshhehehehehehehshehs

Type your answer and then click or tap Done.
Simplify -(x-2y) - y.

Answers

Answer:

Step-by-step explanation:

x(x-2y)-(y-x)2  

Final result :

 -y2

Step by step solution :

Step  1  :

Equation at the end of step  1  :

 x • (x - 2y) -  (y - x)2

Step  2  :

2.1     Evaluate :  (y-x)2   =    y2-2xy+x2  

Final result :

 -y2

Answer: I think the answer is -x + y.

Step-by-step explanation:I think this is the answer because you first start off by distributing all the variables inside the parenthesis by the negative sign which would give you -x+2y-y. After that, you would have to subtract 2y-y because they share the same variable and you must have a SIMPLIFIED ANSWER. So with that said, your overall answer should be -x+y. Hope I'm right in giving you the correct answer!!!!

What does distributive property look like

Answers

Answer:

The distributive property lets you multiply a sum by multiplying each addend separately and then add the products. ... Consider the first example, the distributive property lets you "distribute" the 5 to both the 'x' and the '2'.

Step-by-step explanation:

Answer: 4(x-3)=20

4x-4(3)=20

4x-12=20

4x-12+12=20+12

4x=32

4x/4 = 32/4

x=8

Step-by-step explanation:

To “distribute” means to divide something or give a share or part of something.

Which of the following properties can be used to show that the expression 4^5/3 is equivalent to ^3√4^5

Answers

Answer: First option.

Step-by-step explanation:

For this exercise it is importnatn to to remember the properties that are shown below:

1) [tex]a^\frac{1}{n}=\sqrt[n]{a}[/tex]

2) [tex](a^m)^n=a^{(mn)}[/tex]

Therefore, given the following expression provided in the exercise:

[tex]\sqrt[3]{4^5}[/tex]

You can apply the properties mentioned before, in order to find an equivalent expression.

Therefore, you get:

[tex]\sqrt[3]{4^5}=(4^5)^{\frac{1}{3}}=4^{\frac{5*1}{3}}=4^{\frac{5}{3}}[/tex]

Then the answer is the first option.

Answer:

[tex]\sqrt[3]{4^5}=(4^5)^{\frac{1}{3}}=4^{\frac{5}{3}}[/tex]

Option 1 and Option 3 is correct

Step-by-step explanation:

Given: [tex] 4^{\frac{5}{3}}=\sqrt[3]{4^5}[/tex]

This is exponent to radical change property.

The fraction exponent write as radical.

[tex]a^{\frac{m}{n}}=\sqrt[n]{a^m}[/tex]

Option 1:  Radical to exponent

[tex]\sqrt[3]{4^5}=(4^5)^{\frac{1}{3}}=4^{\frac{5}{3}}[/tex]

True

Option 2: Addition of exponent if base is same.

[tex]4^{\frac{8}{3}}\cdot 4^{\frac{7}{3}}=4^{{\frac{8}{3}+\frac{7}{3}}=4^5[/tex]

False

Option 3: Multiply exponent to exponent, TrueOption 4: Division property of exponent, False
Other Questions
What is the most important use of repetition in poetry? What is the root word for spherical? A. sphere B. here or C. her? 4y+2x=180 solve for x and y Distinguish between sister chromatids and non-sister chromatids. The speed of light in a vacuum is 2.998 x 108 m/s. What is its speed in kilometers per hour (km/h)? K speed = What is its speed in miles per minute (mi/min)? speed = mi/min How many core electrons does magnesium (Mg) have? Human-centered technology often recommends _______aoto computer designers and manufacturers, telling them how to make systems and the devices that support them more user-friendly. What impact would low blood pressure have on kidneys? What symptoms might you expect with a decrease in kidney functions? Molteni Motors Inc. recently reported $3.25 million of net income. Its EBIT was $6.25 million, and its tax rate was 35%. What was its interest expense? (Hint: Write out the headings for an income statement and then fill in the known values. Then divide $3.25 million net income by 1 T = 0.65 to find the pre-tax income. The difference between EBIT and taxable income must be the interest expense.) Enter your answer in dollars. For example, an answer of $1.2 million should be entered as 1,200,000. Round your answer to the nearest dollar. What are the three main types of money?A) credit, commodity, representativeB) fiat, commodity, creditC) representative, credit, fiatD) commodity, representative, fiat How much exercise should teens do daily Fiona shares an office with her exminushusband. Her share of the rent and utilities is $625 per month. She is considering moving to a home office which she will not have to share with anyone. The home office will not cost her anything as far as extra rent or utilities. Recently, you ran into Fiona at the gym and she tells you that she has moved into her home office. Fiona is as rational as any other person. As an economics major, you rightly conclude that ______ Can someone help me with this problem? It has to be in PEMDAS order. 16+(4*2/2)-4 I think it's 18 but I'm not sure The bases of one of the strands of DNA in a region where DNA replication begins are shown here. What is the sequence of the primer that is synthesized complementary to the bases in bold? (Indicate the 5' and 3' ends of the sequence.) 5' AGGCCTCGAATTCGTATAGCTTTCAGAAA 3' what is 3.149 rounded to the nearest hundredth What did the Gestapo and SS do? What is different about the number of course options kids get in virtual schools compared to typical schools? I don't know how to solve this: In a pair of complementary angles, one angle measures 18* less than three times the other angle. Find the measure of each angle. Explainthe benefits a recursive algorithm can provide. Usean example from a process in your organization or with which you are familiar. The square of the product of 4 and a number is the sum of the number and 15