what do bottom dwelling fish,sponges and corals have in common
Bottom dwelling fish, sponges, and corals share common ecological interactions and relationships in marine ecosystems. Sponges provide shelter and nutrients to various species, including fish, while corals have symbiotic associations with algae called zooxanthellae. Bottom dwelling fish, like parrotfish, contribute to reef ecosystems through their feeding behavior, which aids in sediment production and nutrient cycling.
Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3')? view available hint(s) where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3')? it would not bind the target dna. ttttagccatttacgattaatcg ttttagccatttacgattaatcg ttttagccatttacgattaatcg?
The Sun is the primary source of energy that drives all the biogeochemical cycles on Earth. Which statement best describes how the Sun’s energy powers the water cycle?
1.Plants require energy from the Sun to perform photosynthesis.
2.The Sun's heat reflects off ice sheets near the polar caps, reducing the overall temperature of Earth.
3.Heat from the Sun drives evaporation, turning water on Earth's surface into water vapor.
4.Energy from the Sun provides the warmth necessary for cold-blooded animals to survive.
Answer:
3. Heat from the Sun drives evaporation, turning water on Earth's surface into water vapor.
Explanation:
Water cycle starts with evaporation of water from water bodies which includes transition of water into water vapor by heat of sunlight. The water vapor rises up in the sky and gets condensed to form clouds. This is followed by precipitation and collection of water into the water bodies again through surface run off. Hence, the very first step of water cycle, that is, evaporation is driven by energy from Sun.
How do the number of muscles in a cow eye compare with that of a human eye, and what does this mean for each organism?
Some structures related to fungi include hyphae and mycellium. Which statement BEST explains how these structures are related?
A) Hyphae hold mushrooms and other fungi upright by attaching to a mycellium.
B) Hyphae absorb water under ground and the mycellium absorbs water above ground.
C) Hyphae are long, threadlike structures that create a network called a mycellium.
D) Hyphae absorb nutrients from the soil that the mycellium converts into carbon dioxide.
Answer:
The correct answer would be option C.
Mycelium refers to the vegetative part of a fungus which is formed by the mass of branching, thread-like hyphae.
It helps in the absorption of nutrients from the surrounding environment. The biological polymers are first converted or digested into monomers with the help of enzymes secreted by the hyphae.
These monomer units are then absorbed by the mycelium either through facilitated diffusion or active transport.
What is the purpose of the coronary artery and what results if there is blockage in this vessel ? cousrse hero?
Final answer:
The purpose of the coronary artery is to supply oxygen and nutrients to the heart muscle, while blockage in this vessel can result in severe pain and potentially a heart attack.
Explanation:
The purpose of the coronary artery:
The coronary artery supplies oxygen and nutrients to the heart muscle. It branches from the aorta and surrounds the outer surface of the heart like a crown, providing a steady blood flow that keeps the heart functioning properly.
Results of blockage in the coronary artery:
If there is a blockage in the coronary artery, oxygen supply to the heart muscle is stopped. This can lead to severe pain known as angina, and if the blockage is not treated, it can result in myocardial infarction, commonly known as a heart attack. The blocked artery prevents oxygen from reaching the areas of the heart that depend on it, causing damage to the cardiac muscle tissue.
When westerners are asked to recall autobiographical memories, this part of their brain is activated. temporal lobe motor cortex medial frontal cortex occipital lobe?
The medial temporal lobe, including the hippocampus and amygdala, is activated when recalling autobiographical memories, and is essential for memory storage and recall.
When westerners are asked to recall autobiographical memories, a key area of the brain that becomes activated is the medial temporal lobe. This part of the brain, along with structures such as the hippocampus and amygdala, is critical for the storage of memories. The case of patient HM, who had both medial temporal lobes removed, has provided substantive insights into the role of these brain structures in memory formation and recall. Specifically, the medial temporal lobe functions as the short-term storage site for memories, which over time, may relocate to other brain areas outside of the medial temporal lobe, indicating the involvement of a network of cortical and subcortical areas in memory processing.
During which stage of sleep are the major postural muscles most relaxed
In which kingdom are the organisms represented in the cartoon classified?
At a fun-house you walk into a cubical room where two opposite walls are completely covered with flat mirror panels. what do you see when you look into either of the mirrored walls? how many "images" of yourself do you "see"?
you can properly find algae____
- that conduct photosynthesis
- in polar regions or hot springs
- on your dinner plate
- all of the above
You can probably find algae in d) all of the above.
Like other plants, algae have chlorophyll. There are the so-called ice algae found in the polar regions while Thermophilic algae are abundant in hot springs. Edible seaweeds found in your plate are algae also.
Which of the following describes convection? A. a cold swimming pool making a child cold B. a campfire cooking a fish hanging over the fire C. the Sun heating the Earth D. refrigerator coils keeping the refrigerator cold
Your answer would be D. refrigerator coils keeping the refrigerator cold
Clostridium botulinum can result in paralysis. what food can potentially contain dormant spores and should not be fed to infants?
The answer is honey. It should not be fed to infants below the age of 12 months lest the child will develop botulism. When a child ingests the bacteria, they develop in their intestines and produce toxins that harm the baby.
In DNA, which of the following determines the traits of an organism?
Answer: Nitrogenous Bases
Explanation:
The deoxy ribonucleic acid is made of nitrogenous bases, phosphate and deoxy ribose sugar.
The nitrogenous bases in the DNA determines the traits of the individuals which is carried from one generation to another.
These bases determines the type of protein which is produced. The A, T, G, C combines and forms triplet code and based on that protein synthesis takes place which decides the trait of the person.
Water would be considered a _______.
Answer:
The answer is Water is a Chemical Compound.
Explanation:
Water is a compound that is formed from the union, by covalent bonds, of two hydrogen atoms and one of oxygen; Its molecular formula is H2O and it is a very stable molecule. Water is a fairly common substance on earth, where it is mainly in the form of steam or ice. It is essential for the origin and survival of the vast majority of all known life forms.
"which of these contributes to the existence of monopoly power?"
a.the control of critical resources
b.legal barriers
c.patents
d.all of the above contribute to the existence of monopoly power.
What is your preliminary idea(s) of the species of bacteria responsible for anna's infection?
As a "rule of thumb" estimate, athletes who wish to increase muscle mass should increase daily energy intake by approximately ____ kcal.
Thermal pollution kills fish primarily because _____.
all fish need cool water
fish eggs overheat
fish swim too close to pipes
warm water holds less oxygen
Answer:
Warm water holds less oxygen
Explanation:
Thermal pollution may be defined as the cahnge in the ambient water temperature that can degrade the water quality. Main cause of thermal pollution is the use of water as coolant in industries.
Thermal pollution is harmful for aquatic life. Fish and other aquatic organismsm dies because thermal pollution increases the temperature of water. This warm water has less ability to hold oxygen and fishes die due to the lack of oxygen in water.
Thus, the correct answer is option 4.
Genetic disorders caused by multiple genes interacting with the environment are called
Multifactorial disorder
Multifactorial disorders are disorders that involve variations in multiple genes joined with environmental causes. Diseases such as heart disease, type 2 diabetes, and obesity are multifactorial disorder as they do not have single genetic cause but are caused by a combination of environmental factors and life style with mutations in multiple genes.
The greenhouse effect is caused by the burning of fossil fuels and deforestation.
a. True
b. False
Answer:
False, the greenhouse effect is not caused by the burning of fossil fuels and deforestation.
Explanation:
The greenhouse effect is not caused by the burning of fossil fuels or deforestation. It was Global warming which is caused due to the burning of Fossil fuels and deforestation.The greenhouse effect is caused by the Trap heat from the sun. the greenhouse effect is important also because without this effect the earth's atmosphere becomes too cold and may cause problems to animals, plants, and Humans.
Suppose nicole recently learned that she inherited a mutant brca1 allele from her mother, who had breast cancer. brca1 is a tumor suppressor gene that is related to breast cancer. why would nicole be at higher risk for getting breast cancer at an earlier age than her sister, tiffany, who inherited a normal brca1 allele from their mother?
The answer is a mutation in her normal. Device of cancer caused by loss of BRCA1, BRCA2 gene function identified. BRCA1 allele may lead to cancer, while a normal individual would have to acquire two mutations (one in each allele) to develop cancer.
Answer:
Normal tumor suppressor gene controls excessive cell division
Explanation:
A normal tumor suppressor gene releases proteins that are essential to control and regulate the cell division. However, if this gene gets mutated then it may lead to uncontrolled cell division and hence forth cause cancer or tumor. Since Nicole got this mutant gene, hence her ability to suppress uncontrolled cell division does not work and hence she may get cancer as compared to her elder sister who received normal allele.
Evolution and selection what mechanisms lead to changes in the diversity of species on earth?
The answer is genetic drift and genetic shift. The former occurs when small changes occur in the genotype of a population that accumulates over time and changes the allelic frequency of the population. The latter (genetic shift) occurs abruptly and is usually caused by a bottleneck effect.
Filtration and distillation are ____ methods for detoxifying hazardous waste. a inexpensive b chemical c natural d physical e biological
Filtration and distillation are physical methods for detoxifying hazardous waste. Filtration is used to capture and remove microbes from samples while distillation works on the principle of different boiling points of substances.
Option D is correct
Explanation:Filtration and distillation are physical methods for detoxifying hazardous waste. Filtration, as a method of physical separation, is commonly used in various applications. It utilizes filters, such as high-efficiency particulate air (HEPA) filters, to separate and thus remove microbes from samples. With effective pore sizes of 0.3 μm, these filters are capable of capturing bacterial cells, endospores, and many viruses. Thus, the air passing through these filters becomes nearly sterilized.
Distillation, another physical method, involves the process of heating a mixture to create vapor and then cooling that vapor to create a liquid. This method separates the components of a mixture based on their different boiling points. Both filtration and distillation are used outside of the laboratory setting, with applications ranging from the cleaning of surgical instruments to detoxifying hazardous waste.
Learn more about Detoxifying Hazardous Waste here:https://brainly.com/question/34699974
#SPJ3
What did Watson and Crick’s model of DNA show?
A. two nucleotide strands wound in a double helix
B. sugars and phosphates on the inside
C. nitrogenous bases on the outside
D. a single nucleotide strand twisted in a spiral
A is most definitely the answer
If i have stress fracture of my radius bone what part of my body i have broken
Which of these are properties of elliptical galaxies? Select all that apply. A. have several arms B. rotate relatively quickly C. can have various shapes D. appear similar from each side
Answer:
D. appear similar from each side
Explanation:
Elliptical galaxies are a type of galaxy that have a spherical or ellipsoidal shape, and have no spiral-shaped structure. The vast majority of these galaxies have little gas, little dust and few young stars. More expressly, they look a lot like the nucleus and halo of spiral galaxies. Some are quite elongated and some very flat if viewed from Earth, however their shape is basically similar on each side.
About one third of the galaxies are elliptical in shape. Elliptical galaxies range in size from dwarf galaxies, often difficult to distinguish from globular clusters, to giant galaxies such as M70, a giant elliptical galaxy in the constellation Virgo.
the body loses water and satas in sweat explain why drinking large volumes of plain water after excersicing may affect the salta balance in the body
All matter, must contain
Answer: Mass and Space.
Any object that occupies space and has some weight or mass is called matter. All matter is made up of atoms. Matter can be of different types based on the type of atoms it is composed of. Mass, color, shape and size are some physical properties of solid state matter. The matter can be present in all three states of solid, liquid and gas but in every state it occupies space and has mass. Few things which are not considered to be matter are electricity, light, sound, heat etc.
Most infants are physically ready to start eating solid foods when they
a. can sit up with some back support.
b. develop the swallowing reflux.
c. lose the let-down reflex.
d. have most of their primary teeth.
Final answer:
Infants are typically ready to start eating solid foods when they develop the swallowing reflex around 4-6 months of age.
Explanation:
Most infants are physically ready to start eating solid foods when they develop the swallowing reflex. This typically occurs around 4-6 months of age. The swallowing reflex allows infants to effectively consume and digest solid food, transitioning from a diet solely composed of breast milk or formula.
While sitting up with some back support is an important milestone in an infant's development, it is not the primary indicator of readiness for solid foods. Losing the let-down reflex, which is related to breastfeeding, is not directly linked to starting solid foods. Similarly, having most of their primary teeth is not a requirement for starting solid foods as infants can chew food with their gums.