Answer:
Well, photosynthesis converts CO2 into Oxygen, so it helps in that way. Also, by eating insects and decomposing them, it also helps with the carbon cycle.
Hope this helps :)
Choose all of the following that are examples of SECONDARY SUCCESSION? a. wild fire b. volcanic eruption c. glacier melting d. flood e. tsunami f. abandoned parking lot
Answer:
i think it would be A for wild fire, D for flood and E for Tsunami
Explanation: wild fire are one of the most common ways for a secondary succession that can bring change when the environment is disturbed or damaged. For instance, by allowing fast-growing plants to grow and provide a source of food and shelter for many animals to use and eventually draw them back into the ecosystem. Both flooding and tsunamis help push older organisms and other stuff from the environment to create for room for other plants and animals to come and keep the ecosystem healthy and ongoing.
i hope this can help you with your work mate!
Secondary succession is the reestablishment of a damaged ecosystem in areas where the soil is left intact. Natural disasters like wildfire and floods, or human activities causing areas to be abandoned are examples of secondary succession.
Explanation:Secondary succession refers to the series of community changes that occur in previously colonized but disturbed or damaged habitats. Examples of disturbances include fires, floods, windstorms, and human activities such as deforestation. Therefore, the correct answers from your set of options are a. wildfire, d. flood and f. abandoned parking lot. When these events occur, they eliminate or reduce the local vegetation, alter the availability of resources, and create opportunities for new species to colonize.
In the case of a wildfire, the area becomes devoid of life but the nutrients are returned to the ground in the form of ash, making the soil ready for new life. Similarly, floods and abandonment of areas such as parking lots create a void that nature quickly tries to fill, leading to secondary succession. The species that establish first (pioneer species) will change the environment in a way that either promotes or hinders the establishment of other species.
Learn more about Secondary Succession here:https://brainly.com/question/26675203
#SPJ2
If the statement is true, write true. If the statement is false, replace the italicized word or phrase to make it true. 9. Penicillin is a drug that comes from a fungus. Another fungus is the source of antiheadache drugs for organ transplant patients. 10. People eat fungi such as truffles, mushrooms, and the yeast in bread. Fungi also give flavor to cheeses and soda drinks. 11. Respiration produces airy bread and the alcohol in beer and wine. 12. The use of fungi and bacteria to remove pollution is called enviroremediation
Answer:
Each statement is followed by an indication for whether the statement is true or false and an explanation:
9. Penicillin is a drug that comes from a fungus. Another fungus is the source of antiheadache drugs for organ transplant patients.
The first part of this statement is true, penicillium is the fungus that produces penicillium. However, there isn't a record of antiheadache drugs being produced from a fungus for organ transplant patients, or otherwise for that matter.
10. People eat fungi such as truffles, mushrooms, and the yeast in bread. Fungi also give flavor to cheeses and soda drinks.
True. Not all types of fungi are harmful to us, there are several ways we take advantage of micro-organisms and this is just on example.
11. Respiration produces airy bread and the alcohol in beer and wine.
True. The yeast cells undergo aerobic respiration in case of making bread, it's the carbon dioxide they release that causes the bread to rise. During anaerobic respiration, the yeast cells produce alcohol - this process is also called as fermentation.
12. The use of fungi and bacteria to remove pollution is called enviroremediation
False. Environmental remediation is a general term for removing pollution in the environment. When bacteria and fungi are used to help in this process, it is referred to as Bioremediation.
Hope that answers the question, have a great day!
9. True
10. True.
11. True.
12. False.
The following information should be considered:
9. It is true because penicillium is the fungus that generated penicillium. But, there isn't a record of antiheadache drugs being generated from a fungus for organ transplant patients
10. True. As we know that Not all types of fungi should be harmful to us, there are various ways we take advantage of micro-organisms .
11. True. The yeast cells undergo aerobic respiration by making bread, it's the carbon dioxide they release that causes the bread to rise. During anaerobic respiration, the yeast cells generated alcohol - this process is also called as fermentation.
12. False. Environmental remediation is a general term for removing pollution in the environment. At the time When bacteria and fungi are used to help in this process, it is known as Bioremediation.
Learn more: https://brainly.com/question/24908711?referrer=searchResults
are nucleic acids proteins
Answer:
Proteins are polymers of amino acids while nucleotides are sugar molecules covalently bonded to nitrogenous bases, which can be either a purine or prymidine
Which of the following among A-D is false concerning animal viruses? A) During the courses of an influenza virus infection, flu virus proteins are likely to be found in the nucleus, host cell membrane, and cytosol. B) The type of life cycle an animal virus possesses is mostly determined by its genome type C) Lambda phage can form a prophage; an equivalent animal virus type like this would be a retrovirus D) Interferons are produced by certain hosts to defend against animal viruses E) None of A-D is false; all are true
Answer:E. None of A-D is false; all are true
Explanation: virus protein are most likely to be found in nucleus, cytosol and host membrane during the cause of an influenza because the virus first penetrate the cytosol before it RNA are transported to the nucleus where transcription and replication of the viral RNA occurs. Every other option is correct
An orange tree is an example of a because it contains seeds in fruit.
Answer:
flowering plant
Explanation:
Answer:
Flowering plant
Explanation:
It contains seeds in the fruit.
How are the two life cycles different between humans and plants regarding any dominant stages, internalization, and how fertilization happens?
In human life cycles, the dominant stage is the diploid and fertilization is internal. However, plant life cycles commonly involve alternation of generations with a dominant diploid stage and external fertilization that involves pollinators.
Explanation:The life cycles of humans and plants show significant differences. In humans, the dominant stage is the diploid, which is the stage after fertilization and encompasses most of a human's life. Human fertilization is internal and involves the fusion of a male sperm and a female egg within a woman's body. It becomes a zygote, which evolves into a multicellular organism through cell division.
In plants, particularly among angiosperms, the life cycle involves alternation of generations. The diploid (2n) sporophyte is usually the dominant and noticeable stage. The sporophyte develops spores through meiosis which germinate into a gametophyte (n). The gametophyte may produce eggs in archegonia and sperm in antheridia, and fertilization results in a zygote that develops into a sporophyte. Notably, the fertilization in plants is external, with pollen containing sperm cells transferring to eggs by wind, insects or other pollinators.
Learn more about Life Cycles here:https://brainly.com/question/31945588
#SPJ3
How can you (and scientists) tell that a model is good? What kinds of tests can you run to assess the validity of a climate change model?
Model validity can be assessed by analyzing past and present data, such as glacier dimensions, water levels, tree rings, and greenhouse gas levels. Scientific research aiming to develop a deeper understanding of these factors and carbon dioxide concentrations in the atmosphere can also help improve model accuracy.
Explanation:A good model, whether physical or computer-based, is built around a hypothesis and can effectively test this hypothesis. The validity of these models, such as those used in climate change considerations, can be assessed through a variety of tests.
For example, scientists can predict the rise in Earth's temperature by analyzing previous and current data such as the dimensions and locations of glaciers, as well as the water levels in lakes, rivers, and oceans. Analysis of annual tree rings and greenhouse gas levels in the current atmosphere are also methods employed to validate climate change models.
Additionally, scientific questions that lead to an improved understanding of temperature acclimation or advancements in modeling atmospheric carbon dioxide concentrations can further enhance the accuracy of these models. This combination of past data, current measurements, and ongoing scientific inquiry helps ensure that models provide a realistic representation of our planet's changing climate.
Learn more about Climate Change Model Validation here:https://brainly.com/question/33409989
#SPJ3
True or false in terms of symmetry, the human body is radically symmetrical
Answer:
False
Explanation:
Humans and most animals exhibit "bilateral symmetry"
ATP is a source of free energy that drives unfavorable reactions. Which of the processes are coupled to the dephosphorylation of ATP?
A. the exergonic hydrolysis of creatine phosphate
B. reversible isomerization of glucose‑6‑phosphate to fructose‑6‑phosphate during glucose catabolism
C. de novo (from scratch) anabolism of nucleotides
D. myosin action during muscle contraction
Answer:
Explanation:
ATP is a source of free energy that drives unfavorable reactions. Which of the processes are coupled to the dephosphorylation of ATP?
C. de novo (from scratch) anabolism of nucleotides
D. myosin action during muscle contraction
What role do photosynthetic play in the process of photosynthesis ?
Answer:
Photosynthetic organisms capture energy from sunlight with pigments.
Explanation:
Answer:
photosynthesis is the process by which plant make their own food in the presence of light....
Explanation:
the factors required for photosynthesis are:
sunlight
chlorophyll
carbon dioxide
water
plants need carbon dioxide,water,chlorophyll and sunlight
1 Which of the following is not a household use of water?
A. laundry
B. drip irrigation
C. bathing
D. watering the lawn
Answer:
Drip Irrigation
Explanation:
First of, using process of elimination, laundry, bathing, and watering the lawn are all household uses of water. Drip irrigation is a way of watering large areas of land, like on a large scale farm. Hope this helps!
Please answer!!!!! What is the best description of the role of decomposers in the carbon cycle?
A. They release the carbon that remains in the bodies of dead organisms.
B. They absorb carbon from carbon dioxide in the atmosphere.
C. They change carbon dioxide into a form that organisms can use.
D. They prevent carbon from escaping into the atmosphere.
Answer:
D.They prevent carbon from escaping into the atmosphere.
Explanation:
They absorb carbon from carbon dioxide in the atmosphere. They change carbon dioxide into a form that organisms can use.
Hope this helps! : )
The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along this template from left to right. • Which end of the DNA template is 5’ and which end is 3’? • Give the sequence and identify the 5’ and 3’ ends of the RNA copied from this template.
Answer:
1) The right end is the 5' region and the left end is the 3' region
2) 5'-UAACGGUGCAUCGAUAGCAUGC-3
For each of the following sentences, fill in the blanks with the best word or phrase selected from the list below. Not all words or phrases will be used; each word or phrase should be used only once. Transporter proteins and ion channels function in membrane transport by providing a ________1__________ pathway through the membrane for specific polar solutes or inorganic ions. A _________2_________ is highly selective in the solute it transports, binding the solute at a specific site and changing conformation so as to transport the solute across the membrane. For an uncharged molecule, the direction of passive transport across a membrane is determined solely by its ________3__________ gradient. On the other hand, for a charged molecule, the _________4_________ must also be considered. The Na K pump is responsible for maintaining high extracellular sodium ion concentrations. This pump carries out a type of transport called _________5_________ . Group of answer choices 1
Answer:
I believe the answer choices are:
passive, symport, free diffusion, hydrophobic, ion channel, hydrophilic, light-driven, passive transport, facilitated diffusion, concentration, amino acid, membrane potential, active transport, transporter protein, noncovalent, amphipathic.
Transporter proteins and ion channels function in membrane transport by providing a 1. hydrophilic pathway through the membrane for specific polar solutes or inorganic ions. A 2. transporter protein is highly selective in the solute it transports, binding the solute at a specific site and changing conformation so as to transport the solute across the membrane. For an uncharged molecule, the direction of passive transport across a membrane is determined solely by its 3. concentration gradient. On the other hand, for a charged molecule, the 4. membrane potential must also be considered. The Na+/ K+ pump is responsible for maintaining high extracellular sodium ion concentrations. This pump carries out a type of transport called 5. active transport.
Explanation:
Polar or water soluble solutes can only interact with the hydrophilic domains of transport proteins.Transporters, along with permeases and carriers, are a type of membrane transport proteins. Transport proteins bind the solute molecules and undergo conformational changes to transfer the molecule across the membrane.Uncharged molecules moves across membranes based on their concentration gradient i.e. the difference of concentration between the intra and extracellular environment. Whereas, charged molecules and ions require a membrane potential to be transported. One example is the Na+/K+ pump.Na+/K+ pump is an ATP dependent ion channel that utilizes the enzyme Na+/K+-ATPase to break down ATP into ADP and inorganic phosphates.Scientists are studying the structure and function of receptor x, a single-polypeptide protein that is found in the membrane around certain types of cells. receptor x contains no alpha-helices or beta sheets. a specific molecule outside the cells is recognized and bound by receptor x. the binding of the molecule to receptor x causes the cells to have a particular response. identify the process used to form the covalent peptide bonds that join amino acids into a polypeptide
The process used to form the covalent peptide bonds joining amino acids into polypeptide is : Condensation reaction
Although your question is incomplete attached below is the missing data related to your question.
Covalent Peptide bonds are bonds formed between the carboxyl group of a molecule reacting with the amino group of a different molecule producing water molecule as part of its product. and this process is known as dehydration synthesis mechanism ( aka Condensation reaction )
Hence the process used to form the covalent peptide bonds joining amino acids into a polypeptide is Condensation reaction
Learn more : https://brainly.com/question/11007378
Final answer:
The covalent peptide bonds forming polypeptides are created during protein synthesis, specifically in the translation stage. Receptor X involves in signal transduction by binding to an external ligand and initiating an intracellular response without the ligand entering the cell.
Explanation:
The process used to form the covalent peptide bonds that join amino acids into a polypeptide is called protein synthesis. Specifically, this takes place during a stage called translation, where ribosomes translate mRNA sequences into polypeptide chains using tRNA molecules that bring the specific amino acids. These amino acids are then connected through peptide bonds, resulting in a long chain that folds into a functional protein. Regarding Receptor X, its response to a molecule binding can be thought of as part of signal transduction, a process where an extracellular signal is converted to an intracellular action. Receptor X, as described, is a cell-surface receptor that is involved in signalling without the need for the ligand to enter the cell.
According to the text, which statement best describes stem cells? A Stem cells hold genes that send messages to the brains of babies. B Stem cells can change into specific cells and then turn back into stem cells again. C Stem cells are undifferentiated cells that can become any other kind of cell. D Stem cells first develop in adults and are passed on to their offspring.
Stem cells are undifferentiated cells that have the potential to develop into different cell types and are important in the body's development and repair.
Explanation:According to the text, stem cells are undifferentiated cells that can become any other kind of cell. Stem cells have the ability to differentiate into various cell types and can be found in both embryos and adult tissue. They play a crucial role in the development and repair of the body by replenishing damaged or lost cells. Unlike other cells, stem cells can self-renew and maintain their undifferentiated state, making them valuable resources for medical research and potential therapies.
Learn more about Stem Cells here:https://brainly.com/question/34281766
#SPJ11
occurs when nearby objects obstruct the solar radiation to the PV module.
Answer:
dem points forgive me
Explanation:
runj u jik mii
To be classified as organic, a chemical’s molecules must be
Answer:
based on carbon
Explanation:
Answer:
based on carbon
Explanation:
Plz Help if anyone know this I’m really struggling especially because this question is just 50 points it’s self.
Answer: The inner planets are Mercury, Venus, Earth, and Mars
Explanation:
The inner planets are also called the terrestrial planets by astrologers. This is because they have a distinguished characteristics which make them.distinct from the outer plantets. They are small Rocky planets and they are made up of silicate , iron and nickel metal.
These planets are arranged based on their distance from the sun i.e from the closet to the sun to there farthest.
They are Mercury, Venus, Earth and Mars.
which plane velocity was greatest? Yeagers Bell x-1, The Concorde, SR71 blackbird, none they all traveled at the same speed.
Answer:
The SR-71 Blackbird.
Explanation:
The Lockheed SR-71 "Blackbird" was an American strategic reconnaissance aircraft that traveled at over mach 3, or 3 times the speed of sound. The Concorde was a French passenger jet with a top speed of just over mach 2. The Bell X-1 was the first supersonic test plane and had to be dropped from a larger plane to reach altitude.
The plane velocity of SR71 blackbird was the greatest. The correct option is C.
What is velocity?The directional speed of an item in motion, as measured by a specific unit of time and observed from a certain point of reference, is what is referred to as velocity.
Velocity is the pace and direction of an object's movement, whereas speed is the time rate at which an object is travelling along a path. In other words, velocity is a vector, whereas speed is a scalar value.
The SR 71 Blackbird is the fastest piloted aircraft. (Some unmanned vehicles have moved more quickly.) It has moved at a 936 m/s speed. This is Mach 3, or roughly three times the speed of sound.
Thus, the correct option is C.
For more details regarding velocity, visit:
https://brainly.com/question/18084516
#SPJ2
How would a change to the sequence of nucleotides in a DNA segment affect the
mRNA transcribed from the DNA?
Answer:
The mRNA that was transcirbed determines what amino acid would be attached.
Explanation:
For instance, lets say the complementery mRNA codon said GAU, the amino acid assosioted with this codon is aspartic acid. If the sequence were to change to GAA then the amino acid would be glutamic acid. I hoped this helped! If need any clarifications tell mehhhhh!!
Yes, any change in the gene sequence WILL AFFECT the mRNA transcribed from the DNA. However, a change in the mRNA sequence MAY or MAY NOT affect the protein translated from the mRNA.
During gene transcription, a fragment of DNA is used as a template to create an exactly complementary messenger RNA (mRNA) sequence.
In consequence, any change in the DNA nucleotide sequence will produce a change in the complementary mRNA sequence.
Subsequently, this mRNA travels to the ribosome where it is used as a template to create a protein by a process called 'translation'.
During translation, triplets of nucleotides or 'codons' are read by the ribosome in order to add specific amino acids in the nascent polypeptide chain.
There are codons that encode for the same amino acid, thereby a change in the mRNA sequence may or may not produce changes in the protein synthesized from the mRNA. It is for that reason that the genetic code is said to be redundant.
In conclusion, any change in the gene sequence WILL AFFECT the mRNA transcribed from the DNA. However, a change in the mRNA sequence MAY or MAY NOT affect the protein translated from the mRNA.
Learn more in:
https://brainly.com/question/7239640?referrer=searchResults
You are studying body color in an African spider and have found that it is controlled by a single gene with four alleles: B (brown), br (red), bg (green), and by (yellow). B is dominant to all the other alleles, and by is recessive to all the other alleles. The bg allele is dominant to by but recessive to br. You cross a brown (B/by) spider with a pure-breeding green spider. Predict the phenotype of the progeny.
Answer:
50% are brown.50% are green.Explanation:
Given;
B allele is for brown color, so B = brown,
br= red,
bg= green,
by= yellow.
B is dominant over all;
bg is dominant over by;
br is dominant over bg;
by is recessive to all other alleles.
Here, cross between brown (B/by) and pure green (bg/bg).
B/by× bg/bg
progeny
Genotype= B/bg, B/bg, by/bg and by/bg.
Phenotype= B/bg= brown;
by/bg= green
So, 1/2 are brown and 1/2 are green.
In this genetics problem, we are predicting the phenotype of the progeny from a cross between a heterozygous brown spider and a homozygous green spider. Given the dominance relationships of the alleles, the offspring can be either brown (B/bg) or green (by/bg).
Explanation:This question pertains to genetics, specifically, allele dominance. In the given scenario, the B (brown) allele is dominant over all other alleles which means a spider will be brown if it has at least one B allele. The by (yellow) allele is recessive to all other alleles, indicating that a spider will only be yellow if it inherits the by allele from both parents and doesn't have any B allele. The bg (green) allele is dominant to by but recessive to br, hence, a spider will be green if it doesn't have a B or br allele and at least one bg allele.
When a brown spider (B/by) is crossed with a pure-breeding green spider (bg/bg), the offspring will inherit one allele from each parent. Thus, there are two possibilities: B/bg and by/bg. As B is dominant to all, the phenotype of B/bg spider will be brown. For by/bg, since bg is dominant to by, the phenotype will be green. Therefore, the expected phenotypes of the offspring are either brown or green.
Learn more about Genetics here:https://brainly.com/question/32287923
#SPJ3
Nylon-eating bacteria were discovered growing in ponds containing waste products from a nylon manufacturer. Further study revealed that the enzymes the bacteria used to digest the waste products were different from enzymes produced by other bacteria. Also, the enzymes were not effective on any material other than the nylon waste products. Nylon is an artificial product that was invented in 1935. What does this information MOST likely suggest about the development of the bacteria?
Select one:
a. Bacteria that can digest nylon have a reproductive advantage in the pond.
b. The availability of food forced a change in the living things in the area.
c. Bacteria can create enzymes to digest anything in their environment.
d. Natural selection eliminated the other bacteria in the pond ecosystem.
Answer:
d. Natural selection eliminated the other bacteria in the pond ecosystem.
Explanation:
Natural selection is a type of selection in which nature selects the most suited species or organisms for a particular environment. In this pond environment, only nylon eating bacteria survive due to the availability of food in the form of nylon while all other bacteria die due to the unavailability of food or they are unable to consume nylon in the pond. So that's why nylon eating bacteria survived and other bacteria removed from the pond.
Which image represents cytokinesis in an animal cell
Answer:the third image represents
Explanation:
Cytokines is the third image
Body fluid accounts for more than 50% of a healthy adult’s body weight and water plays a critical role in human health.
Three possible body functions are listed below. Decide which are functions of water and which are not.
Body Functions
yes or no
Acts to maintain body temperature
Protects against bacterial infections
Provides lubrication for organs
Dehydration occurs when water excretion __________________________ water intake. Individuals at risk include the elderly, infants, people exercising heavily for prolonged periods in the heat, and individuals suffering from both short and prolonged bouts of vomiting and diarrhea. Most problems associated with dehydration can be avoided if they are recognized and treated early. If left untreated, however, dehydration can lead to severe consequences including seizures, brain damage, shock, or even death.
Answer:
- These are functions of body water:
Acts to maintain body temperature (YES).Protects against bacterial infections (YES) .Provides lubrication for organs (YES).- Dehydration occurs when the excretion is higher than the intake.
Explanation:
1. One of the main functions of water in the body is to dissolve substances and facilitate their transport, which occurs in the blood flow and in the transport of transcellular substances. This allows the water to fulfill the function of:
Maintain body temperature, contributing to changes in circulation that lead to the maintenance and loss of heat. Protection against infection, by conducting leukocytes and immune system cells to the site of infection. Lubrication and cleaning of tissues and organs, where water is part of the bloodstream and other body fluids that remove waste products and can keep organic surfaces lubricated (urine, synovial fluid, serous fludi, among others).2. Water balance refers to the maintenance of an adequate amount of water in the body, which depends on intake and excretion.
When water intake decreases or excretion increases, there is a water imbalance -linked to the electrolytes dissolved in it- leading to dehydration and electrolyte imbalance in the body.
These can be causes of dehydration:
a) Decreased intake, due to not having water or liquids to ingest.
b) Increased water loss due to:
increased sweating in hot environments. Vomiting. Diarrhea. Polyuria, or increased urine volume.Combinatorial control of gene expression a. involves every gene using a different combination of transcriptional regulators for its proper expression. b. is seen only when genes are arranged in operons. c. involves only the use of gene activators that together regulate genes appropriately. d. involves groups of transcription regulators working together to determine the expression of a gene.
Answer:
The true statement will be - D
It is a involvement of groups of transcriptional regulators which work together to determine the expression of a gene.
Explanation:
Combinatorial gene regulation is a mechanism by which small numbers or groups of transcriptional factors or regulators can control the expression of a much larger gene with temporal and spatial patterns.
The process by which a cell regulates the conversion of DNA to RNA to increase gene activity is known as Transcriptional regulation. A single gene can be regulated by altering the RNA which is transcribed.
The gene control allows the cell to respond to a variety of intracellular and extracellular signals.
Combinatorial control of gene expression involves groups of transcription regulators working collectively to regulate the expression of a gene. Every gene can potentially use a unique combination of these regulators for its adequate expression. It's not confined to operons or with the use of only gene activators.
Explanation:The combinatorial control of gene expression refers to a mode of gene regulation where groups of transcription regulators work collectively to determine the expression of a gene. This principle infers that every gene can potentially use a unique combination of transcriptional regulators for its appropriate expression. However, it's not exclusive to genes arranged in operons or involving only gene activators. This control is a complex process which involves both activators and repressors that bind to specific DNA sequences, thereby increasing or decreasing the transcription of genes.
Learn more about Combinatorial Control here:https://brainly.com/question/33439981
#SPJ3
Which of the following statements is correct? Which of the following statements is correct? The heart is ventral to the breastbone. The heart is posterior to the spine. The breastbone is posterior to the spine. The breastbone is ventral to the spine
Answer:
The correct is, the breastbone is anterior (ventral) to the spine.Explanation:
1. Anterior; it means that something is towards the front of the body or is more towards the front of the body than something else.
2. Posterior: the word posterior means that something is towards the back of the body or more towards the back of the body than another thing when comparing two different structures.
For example, our breastbone, is anterior to our spine, and our spine is posterior to our breastbone, since the breastbone is towards the front of our body and the spine is toward the back of our body.
The correct statement is: 'The heart is ventral to the breastbone'. 'Ventral' refers to the front side of the body. Therefore, the heart is located in front of the breastbone. Other statements are incorrect based on anatomical orientations.
Explanation:The correct statement is: 'The heart is ventral to the breastbone'. In anatomical terminology, 'ventral' refers to the front side of the body.
Therefore, when you say the heart is ventral to the breastbone, you're saying the heart is located in front of the breastbone (or sternum), which is correct. The heart is not posterior (behind) the spine as the heart is located in between the lungs, slightly towards the left.
Similarly, the breastbone is not posterior to the spine, but is in front of it. So, it is not correct to say 'The breastbone is ventral to the spine' as the breastbone is dorsal (towards the back) to the spine.
Learn more about Anatomical Orientation here:https://brainly.com/question/35495394
#SPJ6
In his early work on the Citric Acid Cycle, Hans Krebs made measurements of oxygen consumption by suspensions of muscle cells. He found that addition of succinate, fumarate or malate to the cell suspension stimulated oxygen consumption, and that the amount of oxygen consumed was about 10-fold more than the amount needed for the complete oxidation of the added compound. Moreover, the succinate, fumarate or malate was not consumed by the cell suspension but was still detectable at the end of the experiment. What is the correct interpretation of these observations
Answer:
TCA sequence succinate, fumarate or malate is that the intermediary composite. separately kind that influence interruption conjointly comprises product of metabolic process (pyruvate) that is the 1st substrate of TCA sequence once it react with acetyl radical CoA and change its state. This change state particle additional regenerate into iso-citrate and alpha-keto glutarate. Throughout the adaptation of iso-citrate to alpha- keto glutarate oxygen is utilized and greenhouse emission is free. That’s the reason why oxygen utilization is increased.
what happens in anaphase 2
Answer:
During anaphase II, the third step of meiosis II, the sister chromatids of each chromosome separate and move toward opposite poles.
Explanation:
The different from of a gene for a given trait are called
Their called Alleles
Answer:
Genes come in different varieties, called alleles. Somatic cells contain two alleles for every gene, with one allele provided by each parent of an organism.
Explanation: