All of these viruses typically result in persistent infections rather than cellular death except:
A) HIV
B) Hepatitis
C) Epstein-Barr
D) Herpes

Answers

Answer 1

Answer:

C) Epstein-Barr

Explanation:

Usually virus can kill cells directly when virus copies emerge as buds that burst through the cell membrane, killing the cell in the process.

Another way is killing the host cell directly just by exhausting its resources.

And another way is when the host cell machinery becomes grossly distorted triggering a process known as programmed cell death or apoptosis.

The Epstein-Barr virus can block apoptosis, therefore making the cells more likely to become cancerous.


Related Questions

Summarize the key factors DNA polymerase requires to replicate DNA.

Answers

Answer:

Explanation:

DNA polymerase is an enzyme that helps in the synthesis of new strands of DNA. It is found in both prokaryote and eukaryotes. In prokaryotes, there are 3 types of DNA polymerase and more DNA polymerase found in eukaryotes.  

The 3 types of DNA polymerase are DNA polymerase I, DNA polymerase II, DNA polymerase III.  The DNA pol I and DNA pol II helps in DNA repair rather than DNA replication. The DNA pol III is the major enzyme that initiates the replication.  

DNA polymerase III is a multisubunit enzyme that functions as a dimer of these multiple subunits. The DNA polymerase enzyme has 3 significant enzymatic activities -  

All DNA polymerase direct the synthesis of DNA from 3' to 5' end.

It possesses 3' to 5' exonuclease activity. It also helps in proofreading activity by replacing the incorrect nucleotides with the correct base sequence.  

Some DNA polymerase has a 5' to 3' exonuclease activity. It is found in the lagging strand.

DNA polymerase is not able to initiate DNA synthesis alone. They need a free 3' end, where the enzyme can add new nucleotides. It means they require 2 primers to initiate the DNA replication in both the direction.  

The strands act as complementary to the DNA polymerase. The DNA polymerase adds new strands continuously in 5' to 3' direction in the leading strand. While in lagging strand short fragments of DNA formed. Later they attached by DNA ligase.

DNA polymerase also needs RNA polymerase in some cases to start replication. Such a process is called reverse transcription.

The key factors DNA polymerase requires to replicate DNA are:

 1. A template strand of DNA to guide the synthesis of the new strand.

 2. Deoxyribonucleoside triphosphates (dNTPs) as the building blocks for the new DNA strand.

3. A primer, typically an RNA primer, to initiate the synthesis of the new strand.

DNA polymerase is an enzyme that synthesizes DNA from deoxyribonucleotides, the monomers of DNA. The process of DNA replication is semiconservative, meaning that each strand of the original DNA molecule serves as a template for the synthesis of a new complementary strand.

Here are the key factors required for DNA polymerase to function in DNA replication:

1. Template Strand: DNA polymerase requires a single-stranded DNA template to direct the synthesis of the new strand. The enzyme reads the template strand in the 3' to 5' direction and adds nucleotides to the 3' end of the growing strand.

2. Deoxyribonucleoside Triphosphates (dNTPs): These are the precursors for DNA synthesis. dNTPs include adenine (A), thymine (T), cytosine (C), and guanine (G) nucleotides. DNA polymerase links these nucleotides together in a sequence that is complementary to the template strand.

3. Primer: DNA polymerase cannot initiate synthesis de novo; it requires a short piece of RNA or DNA called a primer that is hydrogen-bonded to the template strand. DNA synthesis starts at the 3' end of this primer.

4.Temperature Conditions: DNA polymerase has optimal temperatures at which it functions most efficiently. In humans and other eukaryotes, this temperature is around 37°C, while in bacteria like E. coli, it is slightly higher.

In summary, DNA polymerase requires a template strand, dNTPs, a primer, magnesium ions, and appropriate temperature conditions to accurately replicate DNA. These factors ensure the high fidelity of DNA replication, which is crucial for the maintenance of genetic information."

In patients infected with nonresistant strains of the tuberculosis bacterium, antibiotics can relieve symptoms in a few weeks. However, it takes much longer to halt the infection, and patients may discontinue treatment while bacteria are still present. How might this result in the evolution of drug-resistant pathogens?

Answers

Final answer:

When patients infected with nonresistant strains of tuberculosis discontinue treatment before completing the full course, it can lead to the evolution of drug-resistant bacteria. This is because some bacteria may survive and develop resistance to the antibiotics.

Explanation:

Patients infected with nonresistant strains of the tuberculosis bacterium may discontinue treatment once their symptoms are relieved, but before the planned course of treatment is complete. This can result in the evolution of drug-resistant pathogens. The reason for this is that when patients stop taking antibiotics prematurely, there is a higher chance that some bacteria may survive and develop resistance to the drugs. These drug-resistant bacteria can then continue to spread and cause infections that are more difficult to treat.

The discontinuation of antibiotic treatment in patients infected with non-resistant strains of the tuberculosis bacterium can indeed result in the evolution of drug-resistant pathogens through a process known as natural selection.

1. Initial Effectiveness of Antibiotics: When antibiotics are administered to a patient with a non-resistant strain of tuberculosis, the drugs begin to kill the bacteria. This is because the antibiotics are specifically designed to target and disrupt essential processes in the bacteria, leading to their death.

2. Persistence of Bacteria: Despite the effectiveness of the antibiotics, a small number of bacteria may survive. This could be due to various reasons, such as the bacteria being in a dormant state, residing in parts of the body that are less accessible to the antibiotics, or having genetic mutations that confer some level of resistance.

3. Incomplete Treatment Course: If a patient stops taking the antibiotics prematurely, the surviving bacteria are given an opportunity to multiply and grow in number. Since the antibiotics are no longer present at therapeutic levels, there is no pressure to suppress the bacterial population.

4. Selection for Resistance: Among the surviving bacteria, some may have acquired mutations that make them less susceptible to the antibiotics. These mutations might have arisen randomly or as a response to the antibiotic pressure. When the patient discontinues treatment, these less susceptible bacteria have a survival advantage and are more likely to reproduce and pass on their resistance genes.

5. Spread of Resistance: As the resistant bacteria replicate, they can accumulate additional mutations that further enhance their resistance. These resistant strains can then be transmitted to other individuals, spreading the drug-resistant form of tuberculosis.

6. Evolution of Drug-Resistant Pathogens: Over time, and with repeated cycles of incomplete treatment and transmission, the resistant strains become more prevalent in the population. This leads to the evolution of tuberculosis strains that are resistant to one or more of the antibiotics that were previously effective.

To prevent the evolution and spread of drug-resistant tuberculosis, it is crucial for patients to complete the full course of antibiotics as prescribed by healthcare professionals. This ensures that all bacteria are eliminated, thus preventing the survival and proliferation of resistant strains. Public health measures, including infection control practices, regular monitoring, and the development of new antibiotics and treatment regimens, are also essential in combating the rise of drug-resistant pathogens.

What are some symptoms you might expect an individual suffering from anemia to exhibit?

Answers

Answer:

Anaemia is the major blood related disease whose symptoms can include the following.

1- weakness

2- tiredness

3- pale coloured skin

4- cold extremities

5- irritation

Explanation:

Anaemia is defined as the condition which arises due to lack of red blood cells. Red blood cells contain protein, haemoglobin, whose major constituent is iron. Human body uses iron to produce red blood cells in the bone marrow.

This haemoglobin helps red blood cells to transport oxygen to all the parts of human body. Oxygen gets attached to the haemoglobin and is carried all over the body. This oxygen is necessary for the cells of human body to function properly and survive.

Anaemia can be said to occur due to the lack of iron in human body. Lack of iron results in lack of red blood cells which results in decrease in oxygen supply to all the parts of the body.  

Lack of oxygen hampers the normal functioning of human body as described below.

1- Capacity to work reduces and causes easy tiredness.

2- Weakness increases due to lack of iron.

3- The skin changes its colour, loses its shine and becomes yellowish showing lack of red blood cells.

4- The body temperature is also affected due to lack of oxygen. Hands and legs become cold.

5- Irritation increases. The patient becomes irritated easily due to weakness and fatigue.

Reasons for risk of anaemia

1- Disorder of intestine affects intake of nutrients by the small intestine. This increases chances of anaemia.

2- Menstrual cycle results in loss of blood. This also increases the chances of getting anaemia.

3- Anaemia can be hereditary. It can be genetically acquired.

4- Improper diet including heavy intake of coffee and tea also leads to Anaemia.

The severity of anaemia can vary from mild to severe. Treatment can be in the form of supplements for mild anaemia to medical procedures in case of severe anaemia.

A genetic engineer needs to use gene therapy to help a person with cystic fibrosis. Arrange the following steps in the order the engineer would use them.
a. Use only the steps you need. Inject the modified CFRT gene into a fertilized egg and implant into a woman who will be the surrogate mother.
b. Combine the cloned CFRT gene with a disarmed respiratory virus.
c. Clone the CFRT gene from someone with cystic fibrosis.
d. Clone the CFRT gene from someone without cystic fibrosis.
e.Modify the CFRT gene by putting on a different promoter
f. Test the patient’s blood cell DNA with PCR to see if they have the CFRT transgene.
g. Have the patient use an inhaler that contains the modified respiratory virus.

Answers

Answer:

d-b-g-f

Explanation:

1. Clone the CFRT gene from someone without cystic fibrosis.

This will make millions of copies of the gene (wild type, not being mutated and thus unable of producing the disease).

2. Combine the cloned CFRT gene with a disarmed respiratory virus.

This step will allow the virus to transport the gene of interest.

4. Have the patient use an inhaler that contains the modified respiratory virus.

This step helps the virus to enter and infect the patient's cells and thus allowing the copies of the transgene to be integrated into the patient's genome.

3. Test the patient's blood cell DNA with PCR to see if they have the CFRT transgene.

This will confirm if the transgene has actually been integrated into patient's genome.

Luteinizing hormone stimulates testosterone secretion by the leydig cells of the testes.
a. True
b. False

Answers

Answer:

True

Explanation:

Testosterone is the primary male sex hormone. It is produced by the Leydig cells of the testis. The testosterone produced by both males and females. The amount is more male than females. In females, testosterone is in the form of androgen hormone.  

The anterior pituitary secretes 2 hormones i.e. LH and FSH. The luteinizing hormone from the pituitary gland enters into the interstitial space of the testis. In the interstitial space, Leydig cells are present, which are the target organ for LH. The LH stimulates the Leydig cells to produce testosterone. Hence Leydig cells are also called interstitial cells.

Testosterone secretes from the Leydig cells of the testis and mixes with the bloodstream. It produces in the presence of LH. Then it reaches to different cells of the body by the bloodstream. Testosterone maintains bone and muscle growth, induces the secondary sexual characters.

When testosterone level is high in the blood, it sends a signal to the brain to decrease the secretion of testosterone. This is the negative feedback mechanism of testosterone.

Which of the following is
true aboutimprinting?








It may betriggered by visual or chemical
stimuli.




It happens tomany adult animals, but not to their
young.




It is a type oflearning that does not involve
innate behavior.




It results inbehaviors that cease after the
critical period.

Answers

Answer: It may be triggered by visual or chemical stimuli

Explanation:

Imprinting in pyschobiology is a phenomena of learning in animals. In this the young animals are exposed to one object or stimulus that can be visual, tactile, auditory and later on experience the other object or stimulus. This is tested on some birds such as chickens, geese, ducks also in some fishes, mammals and insects.

A slice of pizza has 500 kcal. If we could burn the pizza and use all the heat to warm a 50-L container of cold water, what would be the approximate increase in the temperature of the water? (Note: A liter of cold water weighs about 1 kg.)
a.50°C c.100°C
b. 5°C d.10°C

Answers

Answer:

Option D, There will be an increase of [tex]10[/tex] degree Celsius in the temperature of the water

Explanation:

As we know -

[tex]Q = m*C* dT\\[/tex]

Where Q is the total amount of heat produced

m signifies mass of any substance

C signifies specific heat

and dT represents change in temperature

Specific heat of water is 1 calories per gram per degree Celsius

On substituting the given values in above equation, we get -

[tex]500* 1000 = 50000 * 1* dT\\dT = \frac{500000}{50000} \\dT = 10[/tex]

Hence , there will be an increase of approximately[tex]10[/tex] degree Celsius in the temperature of the water

Would you expect a shrub or dandelion (dispersed by wind-blown seed) to be a more likely pioneer plant species? why? Thank you so much for helping! means a lot !

Answers

Answer:

Dandelions may appear quicker after harsh conditions and reproduce at a faster rate. However, both dandelions and shrubs are considered fast-growing plant species that can be categorized as pioneer species.

Explanation:

Secondary succession refers to the changes that take place in a disturbed habitat. Pioneer plant species are those that colonize new habitats after harsh climate conditions and that tend to reproduce at a fast rate.

According to researcher J.W. Darlling (2008), pioneer herbs and shrubs are species that tend to grow faster in comparison to other species, making them excellent pioneer species.

This occurs thanks to plants that are wind-pollinated, such as dandelions, have a higher chance to appear because, as it is a disturbed environment, there are no insects or other fauna present. In addition, shrubs are persistent species that are able to reproduce fast with limited soil availability but a bit slower in comparison to dandelions.

A dandelion (dispersed by wind-blown seed) would be a more likely pioneer plant species because wind-dispersed seeds enable rapid colonization of disturbed or barren environments, while shrubs may take longer to establish.

I would expect a dandelion (dispersed by wind-blown seed) to be a more likely pioneer plant species. Pioneer plant species typically need to colonize disturbed or barren environments quickly, and wind-dispersed seeds like those of dandelions have the advantage of being able to spread over long distances and establish themselves rapidly in new areas.

Additionally, dandelions are known for their ability to grow in a variety of soil conditions and climates, making them well-suited to colonize and stabilize the soil in harsh or unpredictable environments. In contrast, shrubs might take longer to establish themselves and may not have the same capacity for rapid colonization as plants with wind-dispersed seeds.

All of the following are products or intermediaries in glycolysis except
A) ATP.
B) NADH
C) FADH2.
D) pyruvate.
E) phosphoenolpyruvate.

Answers

Answer:

The correct answer for this is C, because the Fadh2 is only involved at the redox reactions.

Explanation:

ATP is just a product from glycolysis. Remember that when you break the glucose, energy is been free as an ATP molecule. NADH2 is a substratum, you need it, to get NAD at the fermentation process in the cytoplasmic matrix. Pyruvate and phosphoenolpyruvate are also products at the glycolysis.

Explain how DNA stores complex information.

Answers

Answer: Via four types of smaller molecules (adenine, cytosine, guanine, and thymine) called nucleotides.

Explanation:

DNA is the main molecule of life on Earth, it is present in the cells of all living beings, being responsible for storing the information necessary for its formation and reproduction. DNA is a double strand of nucleotides that twist to form a double helix with a rotational sense on the right.

Basically, the binding between two single strands of DNA, forming the double helix, occurs following a single rule, adenine always binds to thymine and cytosine always binds to guanine and vice versa. The DNA molecule is made up of smaller molecules called nucleotides. There are four types of nucleotides that make up DNA, they are adenine, cytosine, guanine, and thymine, represented by their first letter {A, C, G, T}, forming the DNA alphabet.

Describe two ways in which yeasts are useful to humans.

Answers

Yeasts are essential in the production of food and beverages, such as bread and alcoholic drinks, and are also used in biotechnology and medicine for producing compounds like insulin and as a model organism in research.

Food and Beverage Production: Yeasts, particularly Saccharomyces cerevisiae, are crucial in baking and the fermentation of alcoholic beverages. In baking, yeast ferments sugars to produce carbon dioxide, causing bread to rise. In alcoholic beverage production, yeast converts sugars into ethanol and carbon dioxide.Biotechnology and Medicine: Genetically engineered yeast is used in the production of various compounds, including insulin. This application is essential for diabetic patients who need insulin therapy. Furthermore, yeast is a model organism in research, helping scientists understand basic biological processes.

The old-growth forests of the Pacific Northwest are considered to be rainforests, which means it rains a lot. How do the forests help people deal with the rain?
A. They stick up into the clouds and absorb some rain directly.
B. They direct the water into the salmon streams.
C. They provide shelter to people out hiking.
D. They make it seem less gloomy.
E. They retain water to prevent flooding and erosion.

Answers

Answer:

The correct answer is E.They retain water to prevent flooding and erosion.

Explanation:

Rain forests are used to be very dense forests where lots of raining takes place. The forest floor can soak up lots of rain and during flood dense forest with woodland trees do not allow water to run fast through them thereby reducing flood's effect significantly.  

The roots of the trees in the forest binds to the soil on the floor and prevent soil erosion during flooding. Study shows that water retention is more in summer than in winters. Forest can store lots of water and transfer it to the streams which is helpful in providing clean water to the people in dry season.

Therefore, the correct answer is E. They retain water to prevent flooding and erosion.

Which of the following statements about DNA structure is true? View Available Hint(s) Which of the following statements about DNA structure is true? The nucleic acid strands in a DNA molecule are oriented antiparallel to each other, meaning they run in opposite directions. Hydrogen bonds formed between the sugar‑phosphate backbones of the two DNA chains help to stabilize DNA structure. Nucleic acids are formed through phosphodiester bonds that link nucleosides together. The pentose sugar in DNA is ribose.

Answers

Answer:

The correct answer will be option- the nucleic acid strands in a DNA molecule are oriented antiparallel to each other, meaning they run in opposite directions.

Explanation:

Deoxyribose nucleic acid or DNA is the molecule which acts as the genetic material of the organisms.

The structure of DNA suggests that DNA molecule is made of two strands of nucleotides which are oriented in the opposite direction with respect to each other.

Each nucleotide is composed  of a five-carbon sugar called deoxyribose bonded with a phosphate group via ester bond and four types of nitrogenous bases bonded to complementary bases via hydrogen bond.

The sugar-phosphate backbone runs in the opposite direction with a free 5' carbon atom of phosphate group end a 3' OH group of sugar. The orientation of strands is that one strand run from 5' to 3' direction while another runs from 3' to 5' direction.

Thus, the selected option is the correct answer.

Final answer:

DNA consists of two antiparallel strands forming a double-helix structure. Each strand is made of nucleotides linked with phosphodiester bonds, and the pentose sugar in DNA is deoxyribose.

Explanation:

The correct statement about the structure of DNA is that the nucleic acid strands in a DNA molecule are oriented antiparallel to each other, meaning they run in opposite directions. DNA is composed of two strands that are twisted to form a double helix; each strand composed of nucleotides that include a nitrogenous base, a five-carbon sugar (deoxyribose), and a phosphate group. The two DNA strands are antiparallel, such that the 3' end of one strand faces the 5' end of the other, resulting in the nitrogenous bases of each strand facing inward and forming hydrogen bonds, which stabilizes the double helix structure. Nucleic acids are indeed formed through phosphodiester bonds that link nucleotides together, but the pentose sugar in DNA is not ribose, but deoxyribose.

Learn more about DNA Structure here:

https://brainly.com/question/36469737

#SPJ11

Which of the following statements about eating disorders is false?
a. Demineralization of teeth tfrom exposure to stomach acid is a health issue associated with purging
b. Prolonged anorexia often leads to a reduced metabolic rate due to underproduction of thyroid hormones
c. Prevention of eating disorders involves weighing often.
d. The primary goal of nutrition therapy in anorexia nervosa is to have the patient slowy increase oral food intake
e. Bulimia most commonly occurs in adolescent and college age individuals

Answers

The correct answer is C. Prevention of eating disorders involves weighing often.

Explanation:

Eating disorders include multiple disorders that involve unhealthy eating habits as well as thoughts and emotions related to them. Individuals who suffer from these disorders constantly worry about their weight and appearance or have an unhealthy relationship with food, for example, individuals with anorexia or bulimia tend to believe they are "fat" even if they had low weight.

Due to this, weighing often is not a way of preventing eating disorders as this behavior just supports an unhealthy obsession with weight and appearance that can lead to eating disorders, instead, a balanced diet should be promoted and risk factors such as depression, anxiety, low self-esteem, etc should be addressed. Thus, the false statement is "Prevention of eating disorders involves weighing often".

Distinguish between sister chromatids and non-sister chromatids.

Answers

Answer:

Sister chromatids:

The chromatids of replicated chromosome that are joined through a centromere is known as sister chromatids. These chromatids are identical to each other. They contains the same allele at similar loci. They are formed at the synthesis phase of cell cycle.

Non-sister chromatids:

The chromatids of the different homologous chromosomes are known as non-sister chromatids. These chromatids are non- identical to each other. They contains the different allele at similar loci. They are formed at the prophase I of phase of meiosis.

A stack of thylakoids are known as
a. Thylakoid discs
b. Grama
c. thylakoid lumen
d. Stroma

Answers

granum is what the answer should be
Final answer:

A stack of thylakoids in a chloroplast is called a granum, which is the correct answer to the question.

Explanation:

A stack of thylakoids within a chloroplast is known as a granum (plural = grana). Thylakoids are disc-shaped, membrane-bound structures where the light-dependent reactions of photosynthesis take place. Each thylakoid disc contains chlorophyll, which is responsible for the initial interaction between light and plant material. The inner membrane space that surrounds the grana is termed the stroma. Therefore, the correct answer to the question is 'b. Grama'. Thylakoids are disc-shaped, membrane-bound structures where the light-dependent reactions of photosynthesis occur.

The bases of one of the strands of DNA in a region where DNA replication begins are shown here. What is the sequence of the primer that is synthesized complementary to the bases in bold? (Indicate the 5' and 3' ends of the sequence.) 5' AGGCCTCGAATTCGTATAGCTTTCAGAAA 3'

Answers

Answer:

Complementary primer-      3' TCCGGAGCTTAAGCATATCGAAAGTCTTT 5'

Explanation:

The synthesized primer will have base pair complementary to the given strand and also the leading and lagging ends will be opposite to the given strand.

As per the base pair rule for DNA

Guanine binds to cytosine & vice versa

Adenine always binds to thymine & vice versa

Given Sequence -                5' AGGCCTCGAATTCGTATAGCTTTCAGAAA 3'

Complementary primer-      3' TCCGGAGCTTAAGCATATCGAAAGTCTTT 5'

You have discovered a new species of microbe. This microbe is unicellular, has a cell wall, and possess ribosomes. This microbe is most likely which of the following?
a. a bacterium
b. a protist
c. a fungus
d. it could be any of these three types of microbes

Answers

Answer:

d. it could be any of these three types of microbes

Explanation:

Cell wall made of peptidoglycan is a characteristic feature of bacteria that are otherwise unicellular prokaryotes.

Fungi have a chitinous cell wall and may be unicellular or multicellular. The example of unicellular fungi is yeast.

Protists are unicellular eukaryotes and have a cell wall made of cellulose.

Ribosomes are the site of protein synthesis and are present in all the organisms. Bacteria have 70S type of ribosomes while the eukaryotic fungi and protists have 80S ribosomes.

Describe the "blender experiments" of Hershey and Chase and what they revealed about DNA versus protein.

Answers

Answer:

Explanation:

Alfred Hershey and Martha Chase showed that DNA is the genetic material by their blending experiment. Earlier it was believed that protein is the genetic material. As it is found in a larger amount in the cell.  

Hershey and Chase infected the bacteria E coli with the T2 phage virus. In the bacteria, the viral DNA is replicated as the bacterial DNA. They prepare 2 culture media one contains radiolabeled phosphorus (32P) and another has radiolabeled (35 S)sulfur. Then he cultures the bacteria in separate culture medium and infected with many T2 phages.  

After the infection, they isolated the infected cell and centrifuge the cells. When they tested separate supernatant of 2 culture mediums, they found the virus of radiolabeled phosphorus doesn't show any radioactivity. But the virus in the radiolabeled sulfur contains the radiolabeled.  

The viruses have 2 biomolecules one is protein and the other is DNA/RNA. When they have centrifuged the cells which are the palette, the phosphorus is found there and it also degrades. But the sulfur which is present in the supernatant is present in the newly replicated viruses.

He also treated the virus with both the culture medium but newly infected cells show radiolabeled sulfur, not the phosphorus. Thus they concluded DNA is the genetic material.

During _____________ ______________, oxygen enters the blood and carbon dioxide leaves the blood, and enters the alveoli.

Answers

During respiration oxygen enters the blood and carbon dioxide leaves the blood

In maize (corn) plants, a dominant allele I inhibits kernel color, while the recessive allele i permits color when homozygous. At a different locus, the dominant allele P causes purple kernel color, while the homozygous recessive genotype pp causes red kernels. If plants heterozygous at both loci are crossed, what will be the genotypic and phenotypic ratios of the offspring?

Answers

Answer:

Phenotype ratio= 12 colorless : 3 purple : 1 red

Genotype ratio= 1:2:1:2:4:2:1:2:1

Explanation:

According to the given information, the dominant allele "I" is epistatic to P and p alleles and presence of "I" inhibits the expression of both "P" and "p" alleles.

A cross between two heterozygous plants for both locus would give the F2 progeny in 12 colorless: 3 purple: 1 red ratio.

Here, the F2 genotype with "I-G" and "I-gg" would produce colorless kernels while the ones with "ii-G-" would exhibit purple colored kernels. The F2 genotype "iigg" would beak red kernels.

Hence, the phenotype ratio= 12 colorless : 3 purple : 1 red

Genotype ratio would be same as for the mendelian dihybrid cross= 1 IIPP: 2 IIPp :1 IIpp: 2 IiPP :4 IiPp: 2 Iipp: 1 iiPP :2 iiPp: 1 iipp

Final answer:

When heterozygous maize plants are crossed, the genotypic ratio of the offspring will be 1IIpp:2Iipp:1iipp. The phenotypic ratio will be 1 purple:2 yellow:1 red.

Explanation:

In the given scenario, the maize plants have two different gene loci: one for kernel color and the other for kernel color. The genotype for kernel color is represented by the alleles I (dominant, inhibits color) and i (recessive, allows color). The genotype for kernel color is represented by the alleles P (dominant, purple) and pp (recessive, red). When plants heterozygous at both loci are crossed, the genotypic ratio of the offspring will be 1IIpp:2Iipp:1iipp. The phenotypic ratio will be 1 purple:2 yellow:1 red.

Learn more about Mendel's experiments here:

https://brainly.com/question/35864275

#SPJ3

Explain the differences between the central nervous system and the peripheral nervous system.

Answers

Answer:

Central nervous system:

Central nervous system consists of the brain and the spinal cord. Short nerve impulse are present in the central nervous system. The information are obtained from the sensory organs. The damage of nerve fibers are irreparable in the central nervous system.

Peripheral nervous system:

Peripheral nervous system consists of the motor neurons, sensory receptor and sensory neurons. Long nerve impulse are present in the peripheral nervous system. The information are pass out to the effector organs. The damage of nerve fibers are reparable in the peripheral nervous system.

Explain Mendel's law of independent assortment and how the 9:3:3:1 phenotypic ratio among the F2 of a dihybrid cross provides evidence for this law.

Answers

Answer:

Explanation:

Mendel's law of independent assortment state that two different genes assort independently in gamete formation.

To reach this conclusion, one has to do a dihybrid cross. This means that two genes responsible for different traits need to be analyzed at the same time.

1) Starting with a parental generation of a cross between two pure lines (homozygous for both genes) with different traits, a plant with yellow and round seeds (YYRR) and another with green and wrinkled seeds (yyrr). The F1 will be phenotypically homogeneous (yellow and round), and genotypically heterozygous (YyRr).

2) If the individuals from the F1 are crossed with one another,  we have to do a Punnett Square to determine the phenotypic ratio of the F2.

If the genes assort independently, the F1 individuals will produce their different gametes with the same probability. Each possible gamete will appear in a 1/4 proportion: YR, Yr, yR, yr.The 9:3:3:1 ratio is a result of analyzing the possible phenotypes that result from the dihybrid cross.

See the attached image for an illustration of the crosses in each generation and the Punnett Square.

Final answer:

Mendel's law of independent assortment demonstrates that alleles for different traits segregate independently during gamete formation, which was evidenced by the 9:3:3:1 phenotypic ratio seen in the F2 generation of a dihybrid cross. This law contrasts with gene linkage, which would lead to non-independent assortment and different ratios.

Explanation:

Mendel's Law of Independent Assortment

Mendel's law of independent assortment states that the inheritance pattern of one trait will not affect the inheritance pattern of another. This principle emerged from dihybrid cross experiments, indicating that the alleles for different traits segregate independently during the formation of gametes. By crossing two pea plants that were true-breeding for two different traits (e.g., seed color and seed texture), Mendel found that the F2 generation exhibited a phenotypic ratio of 9:3:3:1.

How does this support the law? If we consider two traits—seed color (yellow Y, green y) and seed texture (round R, wrinkled r)—the cross between F1 heterozygotes (YyRr × YyRr) should produce offspring with varying combinations. Using a Punnett Square, we find that the gametes form four possible allele combinations (YR, Yr, yR, yr) in equal proportions, leading to the 9:3:3:1 phenotypic ratio. This ratio emerges because, for example, 9/16 of the progeny will be both dominant for both traits (YR), 3/16 will be dominant for one and recessive for the other (Yr or yR), and 1/16 will be recessive for both (yr), provided the two traits assort independently.

What if genes were linked? If traits were linked, meaning they do not follow independent assortment, the observed phenotypic ratios would deviate significantly from the 9:3:3:1 expectation. Instead, some combinations of traits would occur more frequently than others, reflecting the physical proximity of the genes on the chromosomes and their tendency to be inherited together.

All animals must get oxygen for respiration. Which of the following is NOT involved in this critical function
A. Diffusion
B. Vascularized gills
C. Trachea found in crustaceans and insects
D. Lungs of lungfish
E. Corpus luteum

Answers

Answer:

E

Explanation:

Corpus luteum is not involved in respiration, it is a temporary structure (mass of cells) formed in the female body, precisely in the ovary,  after the ovulation. If an oocyte is fertilized, It is responsible for the production progesterone during the first stages of pregnancy, if the oocyte is not fertilized the corpus luteum will break down.

Where would you find a Riboswitch?

Answers

Answer:

The correct answer will be- in the 5' untranslated region of prokaryotic mRNA.

Explanation:

Riboswitches are the cis-regulatory RNA elements present in the non-coding segment of the mRNA.The riboswitches are common in prokaryotes but research showed that they are also present in the few eukaryotes. They are located in the non-coding 5' untranslated region of prokaryotic mRNA.

The riboswitches are usually made of 35 to 200 nucleotides which can bind to co-enzymes, small molecules and metabolites and change their conformation to regulated gene expression.

Thus, in the 5' untranslated region of prokaryotic mRNA is the correct answer.

Of the 64 possible nucleotide codon triplets, how many specify polypeptide chain termination?
a. 61
b. 1
c. 2
d. 3
e. 64

Answers

Of the 64 possible mRNA codons, three are designated for polypeptide chain termination, also known as stop codons. The correct answer to the multiple choice question is d. 3.

In the universal genetic code, of the 64 possible mRNA codons, which are triplet combinations of the nucleotide bases Adenine (A), Uracil (U), Guanine (G), and Cytosine (C), a total of three specify polypeptide chain termination. These are often referred to as stop codons or termination codons. They include the codons UAA, UAG, and UGA, with UGA sometimes serving a dual function to encode selenocysteine—a rare 21st amino acid—given the presence of a SECIS element. The remaining 61 codons correspond to the addition of amino acids to the growing polypeptide chain during translation, with the codon AUG also doubling as the start codon for initiation of translation.

To answer the multiple choice question: Of the 64 possible nucleotide codon triplets, three specify polypeptide chain termination. So, the correct answer is d. 3.

Which of the following BEST describes transcriptional regulation of the lac operon in E. coli?
a. On in the presence of lactose
b. On in the presence of lactose and presence of glucose
c. Off in the presence of glucose
d. On in the absence of lactose and presence of glucose
e. On in the presence of lactose and absence of glucose

Answers

Answer:

E. On in the presence of lactose and absence of glucose

Explanation:

Expression of lac operon synthesizes the enzymes required for catabolism of lactose sugar. When both glucose and lactose are available, glucose is preferred as a nutrient and the lac operon is not expressed.

Lac operon is expressed only when glucose is absent in the medium and lactose is present. If any of the two conditions deviate, the operon is not expressed.

In the absence of glucose and the presence of lactose, the repressor is rendered inactive to bind to the operator. RNA polymerase enzyme is free to bind to the promoter and continue the process of transcription.

The reduced levels of glucose increase the cAMP levels which in turn bind to the Catabolite activator protein (CAP). CAP is a positive regulator that binds to the promoter to facilitate the transcription of the operon by RNA polymerase.

Final answer:

The lac operon in E. coli is 'on' in the presence of lactose and the absence of glucose, allowing the bacteria to respond efficiently to changes in the nutritional environment.

Explanation:

The transcriptional regulation of the lac operon in E. coli is a complex process. 'e. On in the presence of lactose and absence of glucose' best describes this regulation. The lac operon is activated, or 'turned on', in the presence of lactose when glucose is not present. If glucose is available, the bacteria preferentially use glucose, and the lac operon is turned off. The lac operon system thus helps the bacteria efficiently respond to changes in the nutritional environment.

Learn more about lac operon here:

https://brainly.com/question/33360857

#SPJ3

There are many different types of touch receptors (hot, cold, etc.) in the skin, and these different types of receptors are not distributed throughout the various parts of the body equally.
a. True
b. False

Answers

Answer:

It is true.

Explanation:

Throughout the skin, there are sensitivity receptors, no matter what sector we look for.

The difference is that there are areas of higher density.

Places like the hand and fingers are the ones that help us explore and know things. The number of receptors there is much greater than in areas such as the back or neck.

Twogenes,
A and B, are located 10 maps units fromeach
other. A third
gene,
C, is located 15 map units from B and 5 mapunits
from A. A parental
generation
consists of AAbbCC and aaBBccindividuals. The F1
are then test-
crossed to
aabbcc individuals. What percentage ofthe offspring would
you
expect to be
AaBbCc?

Answers

Answer:

5%

Explanation:

We have the following loci map:

C/c -------------A/a--------------------------B/b         5 m.u.                  10 m.u.

The parental cross was between the individuals:

CCbbAA, which can be written as CAb/CAb.ccBBaa, which can be written as caB/caB.

Each parental individual can produce only 1 type of gamete, so the F1 will be homogeneous with the genotype: CAb/caB.

The F1 are test crossed to cba/cba individuals.

CAb/caB  X  cab/cab

The homozygous recessive can only produce cba gametes.

The F1 can produce 8 types of gametes:

The parentals: CAb and caBThe crossovers between the genes C/c and A/a: CaB and cAbThe crossovers between the genes A/a and B/b : CAB and cabThe double crossovers: Cab and cAB

The question is asking about the percentage of offspring that will have the genotype CAB/cab

The cab chromosome comes from the homozygous recessive individual with a probability of 1.

The CAB chromosome comes from the F1 individual, and was a result of crossing over between the genes A/a and B/b.

The formula to relate genetic distance with recombination frequency is:  

Genetic Distance (m.u.)= Recombination Frequency X 100.

In our problem, Genetic distance between A/a and B/b loci is 10 map units.

Therefore:

10 m.u. = (Recombination Frequency between A/a and B/b) x 100.

0.1 = Recombination Frequency between A/a and B/b

When crossing over happens between the A/a and B/b genes, both CAB and cab are generated, so each of them will appear in a frequency of half the total recombination frequency between those genes, to add a total of 0.1.

The gamete CAB will appear with a frequency of 0.05.

The gamete cab will appear with a frequency of 1.

The percentage of the offspring that will be CAB/cab is:

0.05 x 1 x 100% = 5%

If a mutation occur in a somatic cell, the resulting mutant phenotype will occur:
a. only in the individual cell
b. only in the progeny from that individual cell
c. only in the offspring of that organism
d. in both the progeny of that individual cell and the individual cell itself
e. neither the progeny from that individual cell or the offspring of the organism

Answers

Answer:

d. in both the progeny of that individual cell and the individual cell itself

Explanation:

Somatic mutations occur in the somatic cells of the individuals. Since the genetic material of the somatic cells is not passed to the next generation of an organism, the somatic mutations do not appear in the progeny of an individual.

Somatic cells divide by mitosis which in turn maintains the identity of DNA between the parent and the daughter cells. Therefore, the new cells derived from a mutated somatic cell would also carry the same mutation.

Final answer:

A mutation in a somatic cell results in a mutant phenotype in the individual cell itself and the progeny or descendants of that cell, but it will not be passed to the organism's offspring.

Explanation:

If a mutation occurs in a somatic cell (i.e., a non-reproductive cell), the resulting mutant phenotype will occur in both the mutant cell itself and the progeny that arises from the cell division of that individual cell. So, the correct answer is. in both the progeny of that individual cell and the individual cell itself.' This happens because the mutation becomes part of the cellular DNA and will therefore be replicated each time that cell divides, spreading to all descendent cells. However, because somatic cells do not participate in sexual reproduction, these mutations will not be passed to the offspring of the organism.

Learn more about Mutation in Somatic Cells here:

https://brainly.com/question/11333262

#SPJ3

Other Questions
Christina accepts as true a claim that orange juice consumption triggers hyperactivity in children. She simply assumes that it was based on scientific evidence, and that no alternative explanations are possible. By accepting this claim as fact, Christina was NOT demonstrating _____ thinking. Jane is saving to buy a cell phone. She is given a $100.00 gift to start and saves $35 a month from her allowance. So after 1 month, Jane has saved $135. Does it make sense to represent the relationship between the amount saved and the number of months with one constant rate? Why or why not? *Please Show Work* Your grades on four exams are 78, 85, 97, and 92What grade do you need on the next exam to have anaverage of 90 on the five exams? 263 grams dental stone powder80 milliliters of waterIf you use 70 grams of stone, how many milliliters of water are needed? which of the following did not influence the industrial revolution?a. Increase in Productionb. The creation and use of machines c.New energy sourcesd. Slave Labor Help find the distance between two points? find the coordinates of the midpoint of the segment with the given endpoints. Y(-13,8) and Z (2,-10) Most modern nations have __________ economies. A. traditional B. purely free-market C. government-planned D. mixed Please select the best answer from the choices provided Alicia is talking on her cell phone to her friend Maya. If Maya is in a crowded subway terminal, Alicia finds that she has to nearly shout for Maya to be able to hear her. However, when Maya is in a meadow on her grandparents' farm, she can easily tell what Alicia is watching on TV as they talk. This is one illustration of __________. Which of the following is the measure of how fast the particles are moving in an object?A. Boiling point B. Freezing pointC. EvaporationD. Temperature The light dependent reactions of photosynthesis take energy from sunlight and convert it into stored chemical energy. Which compounds are produced in the light-dependent reactions? A) ADP and NADP + B) ADP and NADPH C) ATP and NADP + D) ATP and NADPH If pressure p A + B/T+C/T, where A, B, and C are constants, and T is the temperature. What is the unit of A, B and C? Problem 2 (3 pts): If a system is at steady state, do properties vary with time? Can properties vary with location under steady state? A flat disk of radius 0.50 m is oriented so that the plane of the disk makes an angle of 30 degrees with a uniform electric field. If the field strength is 713.0 N/C find the electric Tiux through the surface A) 560 Nm2/C B) 620 Nm2/C C) 160 n N.m2/C D) 280 N.m2/C Suppose that a worker in Country A can make either 10 iPods or 5 tablets each year. Country A has 100 workers. Suppose a worker in Country B can make either 2 iPods or 10 tablets each year. Country B has 200 workers. A bundle of goods that Country A could not make would be: The amount of garbage, G, in tons per week, produced by a city with population p, measured in thousands of people, is given by G = f ( p ) The town of Tola has a population of 50,000 and produces 14 tons of garbage each week. Express this information in terms of the function f Nitric acid is usually purchased in a concentrated form that is 70.3% HNO3 by mass and has a density of 1.41 g/mL. How much concentrated solution would you take to prepare 1.00 L of 0.120 M HNO3 by mixing with water? If the discriminant of a quadratic equation is equal to -8, which statement describes the roots? In the higher education of women it is evident that the author was classically because ___select all that apply 2=2 x 7 -22=? too what A solid sphere of uniform density has a mass of 8.4 104 kg and a radius of 4.0 m. What is the magnitude of the gravitational force due to the sphere on a particle of mass 9.8 kg located at a distance of (a) 19 m and (b) 0.52 m from the center of the sphere