An RNA virus that infects plant cells is copied into a DNA molecule after it enters the plant cell. What would be the sequence of bases in the first strand of DNA made complementary to the section of viral RNA shown here? 5' CCCUUGGAACUACAAAGCCGAGAUUAA 3'

Answers

Answer 1

Answer: Thecorrect answer would be

3' GGGAACCTTGATGTTTCGGCTCTAATT 5'

Explanation:

DNA and RNA are nucleic acids, that is, polymers of nucleotide. DNA consists of adenine, guanine, cytosine, and thymine. In contrast, RNA contains uracil in place of thymine. Rest three nucleotide are same.

Please note that transcription (DNA to RNA) as well as reverse transcription (RNA to DNA) is done on the basis of base complementary nature.

The base pairs are:

adenine- thymine/uracilguanine- cytosine

So, if adenine is present in DNA then uracil will be incorporated in RNA and vice-versa.

For example, the initial 5 nucleotide of given RNA are 5' CCCUU...3'

So, in DNA, based on base complementary rule, G will be incorporated against C and A will be incorporated against U. Thus, the DNA sequence would be 3' GGGAA...5'.

Similarly, the whole sequence can be worked out.

Answer 2

Final answer:

The complementary DNA sequence would be: 3' GGGAA CCTTGAUGUUUCGGCUCTAA 5'

Explanation:

To find the sequence of bases in the first strand of DNA complementary to the given RNA sequence, we need to use the complementary base pairing rules:

Adenine (A) pairs with Thymine (T) in DNA or Uracil (U) in RNA.

Thymine (T) pairs with Adenine (A) in DNA.

Cytosine (C) pairs with Guanine (G).

Given the RNA sequence:

5' CCCUUGGAACUACAAAGCCGAGAUUAA 3'

The complementary bases for DNA are:

Adenine (A) → Thymine (T)

Uracil (U) → Adenine (A)

Cytosine (C) → Guanine (G)

Guanine (G) → Cytosine (C)

So, the complementary DNA sequence would be: 3' GGGAA CCTTGAUGUUUCGGCUCTAA 5'.


Related Questions

The citric acid cycle occurs in the:
a. Golgi apparatus
b. Thylakoid lumen
c. Mitochondrial matrix
d. Across the inner membrane of the mitochondria

Answers

Answer:

The correct answer will be option-C.

Explanation:

Cellular respiration is a slow process which breakdown the food components via oxidation to convert them into energy molecules.  The respiration proceeds in four stages: Glycolysis, pyruvate decarboxylation, citric acid cycle and electron transport chain.

All these processes take place in different compartments of the cell-like glycolysis takes place in the cytoplasm and citric acid cycle or Kreb cycle takes place in the matrix of the mitochondria. The matrix of the mitochondria provides the necessary environment to proceed the step of the respiration.

Thus, option- C is the correct answer.

List and describe the function of each of the four components of blood.

Answers

Answer:

The four components of blood are RBC, WBC, Platelets, and blood plasma.

Explanation:

The major 4 components of blood are RBC, WBC, platelets, and plasma. Plasma is the fluid part of the blood and the remaining 3 are the cellular part.  

Plasma is the yellow color liquid. In the plasma, all cellular components float. Plasma constitutes approximately 55% of the total volume of the blood.

The various functions of plasma are - It carries different nutrients from the alimentary canal to the liver and other parts of the body. Simultaneously it carries the CO2 from the different tissues and reaches them to lungs for expiration. It distributes the hormones and vitamins from endocrine glands to different target organs. Plasma also plays a role in the water balance in the body. It supplies water to tissues and receives excess water from them. Thus regulate the water balance in the body.

RBC is the enucleated cellular organelle of blood. The absence of nucleus enables it to carry more oxygen. It is red due to the presence of Hb and carries O2 and CO2 in the form of oxyhemoglobin and carbaminohemoglobin. It also helps in releasing energy through the metabolic process.

WBC is concerned with the immunity of the body. It acts as a defense mechanism of the body. The components of leukocytes such as granulocytes and agranulocytes are phagocytic. They engulf bacteria and viruses. Eosinophils fight against the allergic reaction in the body.

The blood platelets have blood clotting factors. There are 12 blood clotting factors which help in the clotting of blood.

Products of glycolysis include:
a. a total of 2 ATP
b. a net gain of 4 ATP
c. 2 pyruvate molecules
d. all of the above

Answers

Final answer:

The products of glycolysis include a net gain of 2 ATP and 2 pyruvate molecules, so the correct answer is 'all of the above'.

Explanation:

The correct answer to the question, 'Products of glycolysis include' is d. all of the above. This is because glycolysis, a pivotal process in cellular respiration, indeed yields these outcomes. First, there is a net gain of 2 ATP, meaning that while four ATP molecules are produced during glycolysis, two are consumed, resulting in an overall gain of 2 ATP. Secondly, 2 pyruvate molecules are produced during the final phase of glycolysis. Therefore, answering all of the above is accurate considering these facts.

Learn more about glycolysis here:

https://brainly.com/question/14089531

#SPJ3

Final answer:

The products of glycolysis include a total of 2 ATP, a net gain of 4 ATP, and 2 pyruvate molecules.

Explanation:

The products of glycolysis include:

a total of 2 ATPa net gain of 4 ATP2 pyruvate molecules

Therefore, the correct answer is d. all of the above. Glycolysis is the first step in cellular respiration and occurs in the cytoplasm of cells. It is an anaerobic process that breaks down glucose into two molecules of pyruvate, resulting in a net gain of 2 ATP (although 4 ATP are produced in total, 2 ATP are used during glycolysis).

Learn more about Glycolysis here:

https://brainly.com/question/29604117

#SPJ6

Some of our neurons (cells of our nervous system) have ATP-gated calcium (Ca+2) channels in both their plasma membrane and nuclear envelope. (tricky
a. True
b. False

Answers

Answer:

The given statement is true.

Explanation:

Some of the neurons possess ATP-gated calcium channels in both their nuclear envelope and plasma membrane. The majority of the ion channels are ligand-gated and stays in their position, which shows that they do not move from one membrane to another.  

However, the ATP gated calcium channels have been located in both the nuclear envelopes of some of the neurons and plasma membrane, which signifies that the channel may socialize between the two compartments.  

Now that you have come up with an equation that describes the relationship between amounts of different nucleotide bases in DNA, can you use it to predict the amounts of all four nucleotide bases when you only know the amount of one type of base? Approximately 21% of the human genome is comprised of nucleotides containing C. Given this information, calculate the percentage of the human genome that is comprised of nucleotides containing G, T, and A.

Answers

Answer:

G=21 %

T= 29 %

A= 29 %

Explanation:

Since C only binds to G, you have the same amount of C and G, so G is 21 %.

100 % minus 42 % ( 21 % C plus 21 % G=) equals 58 %.

So the other 58 % is made of T and A. Since T only binds to A , the half of the extra 58 % is T and the other half is A. Therefore 29 % is T and 29 % is A

Which of the following sequences in double-stranded DNA is most likely to be recognized as a cutting site for a restriction enzyme?
a. AAGG
TTCC
b. GGCC
CCGG
c. ACCA
TGGT
d. AAAA
TTTT

Answers

Answer:

b. GGCC

CCGG

Explanation:

Restriction enzyme cleaves DNA at the restriction site. Restriction site has 4-8 nucleotide base pairs which are recognized by the restriction enzyme. This site usually has a palindromic sequence which means that the sequence is read as same on both the strands in 5' to 3' direction. Palindromic sequence is used because it increases the chances that both the strands are cut. Enzyme is also able to recognize the sequence no matter from which side it approaches the DNA. The enzyme also works as homodimers sometimes so having the same sequence makes the dimers easier to recognize it. Here, the sequence is GGCC in 5' to 3' direction on both the strands making it a palindromic sequence. Hence it is most likely to be recognized as a cutting site for a restriction enzyme.  

Which of these is not a feature that links "dinosaurs' to modern day extant birds"?
a. A furcula
b. Feathers
c. S-shaped neck
d. Nasal turbinates
e. The flight stroke

Answers

Answer:

The correct answer is option d. "Nasal turbinates".

Explanation:

Most mammals and modern day birds have nasal turbinates that perform two functions: improve the sense of smell by providing a wider area for airborne chemicals absorption and warm and moisten inhaled air while extracting heat and moisture during air exhalation. On the other hand, no evidence have been found that suggest that dinosaurs had nasal turbinates. Although most dinosaurs had nasal passages, they were too narrow and short to accommodate nasal turbinates.

Which gland of the cane toad produces poison?
a. parotoid gland
b. tympanic membrane
c. glottis
d. eustachian tubes

Answers

Answer:

The correct option is: a. parotoid gland

Explanation:

Cane toads, also known as Bufo marinus or Rana marina Linnaeus, are the giant old species of the terrestrial true toads. The female cane toads are longer than the male cane toads.

The skin of the cane toad is highly toxic. An adult cane toad has large parotoid gland behind each eye, which secretes a milky-white toxic fluid called bufotoxin.

How can a stem cell contain the same genetic information, yet specialize as bone cells nerve cells, muscle cells and connective tissue cells?

Answers

Answer: All cells in the body contain the same DNA, but different RNA, according to which proteins need to be synthesized.

Explanation:

DNA is the molecule that contains the genetic information necessary to generate proteins. This is due to the sequence of nucleotides, which are monomers of DNA. Each nucleotide contains a different base: Adenine (A), Timine (T), Guanine (G), Cytosine (C). But when the cell needs to synthesize proteins, DNA is not used directly but transcribed into RNA. This RNA is directed to the ribosomes, organelles where protein synthesis takes place, and according to the sequence of RNA (which is complementary to DNA), a different amino acids is coded. During translation, aminoacids are joined together to form proteins.

All cells in the body contain the same DNA, but different RNA, according to which proteins need to be synthesized. For example, a stem cell can give rise to any specialized cell in the body such as a nerve or muscle cell. All three have the same DNA but a nerve cell specializes in the transmission of impulses and neurotransmitters so it will replicate only the DNA genes that are necessary for this and this is how only part of the genetic material is replicated into RNA. The same goes for the muscle cell, which needs genes necessary for force and motion.

____ is a type of weathering where rock is dissolved by an acid

Answers

Answer:

Chemical Weathering is a type of weathering where rock is dissolved by an acid

Explanation:

The weathering of rocks by chemicals is called chemical weathering . Rainwater is naturally slightly acidic because carbon dioxide from the air dissolves in it. Minerals in rocks may react with the rainwater, causing the rock to be weathered. Some types of rock are easily weathered by chemicals.

Answer:

Chemical Weathering  is a type of weathering where rock is dissolved by an acid

Explanation:

Weathering are of two types- Mechanical and Chemical Weathering. In chemical weathering, the molecular structure of different rocks and soils change through chemical reactions.

For example, in carbonation the carbon dioxide of air and often soil mixes with water. This combination forms a acid named carbonic acid that dissolves rock. It especially dissolves the limestone rock. Through the dissolving of limestone huge caves are formed.

Choose one property of water that makes it unique. Describe the property and explain the chemical or physical reason that causes water to have that property.

Answers

Answer:

Water has a pH value of 7. It is colorless and has a fixed boiling point at 100 Degree Celsius.

Explanation:

Answer: Water has many properties in it which makes it unique. This is because the reason water is known as universal solvent.

Explanation:

The water is considered as universal solvent because it has the ability to dissolve many solutes in it.

This ability of water is due to the presence of hydrogen bonding which dissolves different types of solutes in water.

The presence of hydrogen bonding in water provides it some more properties like surface tension, adhesion, cohesion.

Prokaryotes used to be classified into one group, but now they are classified in the Domains Bacteria and Archaea.
a. True
b. False

Answers

Answer:

True.

Explanation:

Three domains of life are prokarya, eukarya and archae. Prokaryotes are the organism that lacks the well developed nucleus and membrane bound cell organelle.

Earlier the prokaryotes are classified in the one group. But the prokaryotes are now further classified into the domains archaea and bacteria. As prkaryotic organism shows the similar characteristics with the archae and prokarya. To make the study more simpler, prokaryotes are splits into the domains of bacteria and archaea.

Thus, the answer is true.

The androgen-binding protein functions to
A. Confer responsiveness of certain cells to male sex hormones.
B. Transport androgens in the plasma.
C. Bind and maintain high concentrations of testosterone in the seminiferous tubules.
D. A and B.
E. A, B and C

Answers

Answer:

C. Bind and maintain high concentrations of testosterone in the seminiferous tubules.

Explanation:

Seminiferous tubules are present within the testis of male reproductive system. In adults, each testis is oval in shape and is about 4-5 cm in length. Each testis has about 250 compartments called testicular lobules. These compartments contain highly coiled tubules called seminiferous tubules.

Within the seminiferous tubules, the male gamete i.e sperms are produced. Seminiferous tubules are lined inside by two types of cells called male germ cells (spermatogonia) and sertoli cells.

Spermatogonia give rise to spermatozoa which are released into the lumen of the tubule. In between spermatogenic cells, sertoli cells or sustentacular cells or nurse cells are present which provide nourishment to developing spermatozoa.

One of the function of sertoli cells are to release androgen binding protein (ABP) which binds and concentrates testosterone with in the seminiferous tubules.

The hormone testosterone is produced by the interstitial cells of Leydig located around the seminiferous tubules.

Before Baby A was born, she was not sending much blood to her lungs. Instead, the blood passed through the septal defect into the left atrium, which sent it to the left ventricle and to her body. But why didn't the baby die if no blood was going through her lungs?
(A) She was so small that the small amount of blood that did go through her lungs was enough
(B) She was getting her oxygen from placenta, not from breathing
(C) Before the last trimester, babies use anaerobic respiration, so she did not need oxygen
(D) She sent her blood out into her mother's body and through her mothers lungs instead

Answers

The right answer is B.

The purpose of breathing is to do homeostasis, which means, to take CO2 out and get oxygen to our blood.

Babies live into the wound surrounded by liquid, so they don't need to breathe with their lungs.

All the things they needed to survive are taken from the mother thought the placenta.

Answer:

The correct answer is option (B) "She was getting her oxygen from placenta, not from breathing".

Explanation:

In order to get the oxygen we need to live is necessary that the blood gets through our lungs. If an unborn baby has a problem that does not allow her to get blood to her lungs, she is still able to survive because she could get her oxygen from placenta, not from breathing. Placenta has a respiratory function that allows the baby for fetal oxygen supply and fetal carbon dioxide removal.

The final electron acceptor of the electron transport chain that functions in aerobic oxidative phosphorylation is
a. oxygen. b. water. c. NAD+. d. pyruvate.

Answers

Answer: a. oxygen

Basically what (/the) ETC and oxidative phosphorylation is, is the products of the Krebs cycle being oxidized and oxygen receiving electrons. And when the phosphorylation part of oxidative phosphorylation occurs is when ADP gains its third phosphate group becoming ATP.

Forgive me for this poor response I was trying to be quick and it resulted in this vague and disorganized mess. To properly explain the ETC and oxidative phosphorylation it would be best to start from the beginning and explain all the stages of Aerobic respiration. Then it would be easier to Segway in to this final stage which would definitely take 2-3 descriptive paragraphs to cover.

Final answer:

The final electron acceptor in the electron transport chain during aerobic oxidative phosphorylation is oxygen. This is because oxygen combines with hydrogen ions and electrons to form water at the end of this process.

Explanation:

The final electron acceptor in the electron transport chain during aerobic oxidative phosphorylation is oxygen (option a.)

Here's why it's oxygen: Aerobic oxidative phosphorylation is the process during which ATP (the main energy source for most cellular functions) is produced. This process happens in the mitochondria of our cells, and it's a part of cellular respiration.

In this process, the electron transport chain plays a vital role. Electrons travel down the chain, moving from one protein complex to the next. These electrons ultimately combine with hydrogen ions and oxygen to form water. Thus, oxygen acts as the final electron acceptor in the chain.

Learn more about Aerobic Oxidative Phosphorylation here:

https://brainly.com/question/36345114

#SPJ3

Consider this pathway: epinephrine → G protein-coupled receptor → G protein → adenylyl cyclase → cAMP. Identify the second messenger.
a. cAMP
b. G protein
c. GTP
d. adenylyl cyclase

Answers

Answer:

a. cAMP

Explanation:

Secondary messengers are signaling molecules which are present intracellularly and play a great role in amplification of a signal during signal transduction pathway.

cAMP, DAG and IP3 are common secondary messengers in GPCR signalling. GPCR are largest family of cell surface receptors which are associated with various functions like control of blood vessel dialation, interstitial epithelial cells, glycogen breakdown, inflammation, photoisomerization reaction etc.

Final answer:

The second messenger in the given pathway is cAMP.

Explanation:

The second messenger in the given pathway is cAMP. In this pathway, epinephrine binds to a G protein-coupled receptor, which activates a G protein. The G protein then activates adenylyl cyclase, an enzyme that converts ATP into cAMP. Therefore, cAMP acts as the second messenger in this pathway.

Learn more about Second messenger in a pathway here:

https://brainly.com/question/30627647

#SPJ3

Make connections Imagine you want to study one of the human crystallins, proteins present in the lens of the eye (see Figure 1.8). To obtain a sufficient amount of the protein of interest, you decide to clone the gene that codes for it. Assume you know the sequence of this gene. How would you go about this?

Answers

Answer:

In order to clone the sequence of the gene for one of the human crystallins found in the eye, there is a need for the application of polymerase chain reaction. In the process, the particular sequence of gene is denatured and then replicated various times to generate various clones of the gene sequence.  

By producing various copies of the gene sequence for the human crystallin, that is, desirable, a scientist can examine various distinct characteristics of the protein as there is always more to examine with.  

Why would you not expect amylase to digest protein?

Answers

because amylase is made to digest amylose, a kind of starch found in carbohydrates

_______are a group of very small, pleomorphic bacteria without cell walls, previously thought to be viruses, because they are capable of crossing bacterial filters.
A) Mycoplasma
B) Clostridia
C) Anthrax
D) Spirochetes

Answers

Answer:

A) Mycoplasma

Explanation:

This kind of bacteria does not have a cell wall.

This is why it's so difficult to kill them with antibiotics that block cell wall synthesis like penicillin. They do not respond to them.

Atypical pneumonia and some pelvic inflammations are caused by this kind of bacteria.

Both plant and animal cells have a chloroplast.
a. True
b. False

Answers

Answer:

False

Explanation:

Only plants have chloroplast.

This statement is FALSE. Only plant cells contain a chloroplast.

Hope this helps you

- AaronWiseIsBae

What feature distinguishes male embryo from female at eight weeks of age?
a. males have a Y chromosome
b. males have well developed primary reproductive organs
c. male testes have descended into the scrotum
d. in males, the ovaries have degenerated
e. all of the above

Answers

Answer:

A, B & D

Explanation:

It is not possible to distinguish the sex of a fetus below seven (7)weeks. At this stage only observation of chromosomes through karyotype can determine the sex.  The male fetus will have an XY sex chromosome pair while females will have an XX chromosome pair. After the eighth weeks internal and external genitalia begins to differentiate. The testes and ovaries (the primary reproductive organs) begin to develop in males and females respectively. In males the paramesonephric ducts regresses while the mesonephric ducts begin to develop into testes. In females the mesonephric ducts regresses while the paramesonephric ducts begin to develop into ovaries.

ATP molecules from Glycolysis + Krebs cycle are _______________
a. 12 ATP
b. 28 ATP
c. 32 STP
d. 4 ATP

Answers

Answer:

The correct answer will be option-D.

Explanation:

Cellular respiration proceeds in four stages: glycolysis, link reaction, Krebs cycle and electron transport chain.  ATP is produced in each step along with other reducing equivalents which gets reduced during the electron transport chain to form ATP.

In the given question, only ATP molecules formed during both glycolysis and Krebs cycle will be 4 ATP as 2 ATP are produced in glycolysis and 2 ATP are produced in the Krebs cycle per two molecules of pyruvic acid.

Thus, option-D is the correct answer.

Each of these practices has greatly reduced the spread of infectious diseases in the developed world except
A) vaccination.
B) antibiotics.
C) reduced population growth.
D) water purification.

Answers

Answer:

C) Reduced population growth

Explanation:

Vaccination avoids that an infectious agent causes a disease in a person, so it stops the spread of these diseases. Also, antibiotics kill bacteria responsible for infections in an ill person, therefore, they also end the spread. Water purification eliminates pathogens from the water such as bacteria or fungus, so it helps to prevent infections in a population. Finally, reducing the growth of the population doesn't directly affect the spread of infectious diseases.

Chorionic villus sampling is a prenatal test usually performed in the second trimester.
a. True
b. False

Answers

Answer:

b. False

Explanation:

Chorionic villus sampling test is used to determine the genetic disorder or chromosomal disorder in a fetus. Chorionic villus test is done by the PCR or by FISH. This test can take place usually performed in 10 to 12 weeks gestation i.e. first trimester, before amniocentesis. Chorionic villus can be removed by a needle. Pregnancy loss in CVS (Chorionic villus sampling) is 2-3 percent. So it is highly accurate.

Final answer:

Chorionic villus sampling is a prenatal test performed in the first trimester, specifically at 10-12 weeks of pregnancy, not in the second trimester. It is used to diagnose genetic abnormalities and determine the sex of the fetus, offering an earlier alternative to amniocentesis.

Explanation:

The statement that chorionic villus sampling (CVS) is a prenatal test usually performed in the second trimester is false. CVS is an alternative method of prenatal diagnosis to amniocentesis and is typically performed earlier in pregnancy, between 10-12 weeks, during the first trimester. This procedure involves extracting a small amount of placental tissue, either through the abdominal wall or through the vagina, which provides cells for testing. The extracted cells can be used to diagnose over 100 genetic abnormalities, including chromosomal abnormalities like Down syndrome, enzymatic defects, and determining the sex of the fetus.

Unlike amniocentesis, which is done after 14-22 weeks and involves extracting amniotic fluid to obtain fetal cells for analysis, CVS allows for earlier detection and the possibility of a simpler process if an abortion is considered. Moms-to-be are also advised to avoid substances that can be fetotoxic as these can cross the placenta and affect the developing fetus, potentially leading to disorders like Fetal Alcohol Spectrum Disorders (FASD).

Explain how a testcross can provide evidence for or against linkage.

Answers

Answer:

Testcrosses clarify linkage because each phenotypic class of progeny corresponds to each gamete type produced by the dihybrid parent.

Explanation:

A test cross involves the crossing of an individual with another phenotypically recessive individual so as to determine the zygosity of the former by analyses of the proportions of offspring phenotypes.In order to determine linkage, the test cross shows that if the parentals are more than the recombinants, we can say that the two genes such as b and c  are genetically linked and therefore, they must be on the same chromosome.Also, the test-crosses help to find out which alleles came from which parent.By setting up testcrosses in which one parent is homozygous for the recessive alleles of both genes,we can analyze the gene combinations received in the gametes from the other, doubly heterozygous parent.

The final product of the Calvin cycle is:
a. RuBisCo
b. ATP
c. CO2
d. G3P

Answers

Answer:

The correct answer will be option-D

Explanation:

Calvin cycle or C₃ cycle is a set of a cyclic reaction which takes place in the light-independent reactions of photosynthesis.  Calvin cycle proceeds in three phases: carboxylation, reduction and regeneration.

The cycle produces two molecules of Glyceraldehyde-3-phosphate (G3P) molecule during the reductional step of the cycle. Out of these two molecules, one G3P undergo for the regeneration of RuBP and one G3P undergo for the formation of a glucose molecule.

Thus, option-D is the correct answer.

Describe the key events of meiosis that explain Mendel's first and second laws.

Answers

Answer:

Explained

Explanation:

During Meiosis the Chromosomes line up or assort independently from one another. Therefore, genes located on each chromosomes are also segregate of one another. Therefore, the gene for seed color (G & g) will assort independent of the gene for plant height (T & t) , thus producing 4 different gene combinations of gametes,they are : GT, Gt, gT & gt.

In evolution, why is it important that individuals vary from each other?
A. Variation allows some individuals to do better than others, so those variations are selected for.
B. If variations or mutations are extreme enough, new species can result.
C. Variations are important because individuals have to change through time.
D. Variations are important because they're inherited.
E. Variation gives every individual an equal chance of surviving so they can be selected for.

Answers

Answer:

D. Variations are important because they're inherited.

Explanation:

A. False

Not all variations are just beneficial, there are variations that can be harmful, leading natural selection to eliminate these individuals.

B. False

Without some environmental pressure, that is, any change that drives the selection of an individual, mutation alone cannot generate a new individual. If this mutation is not selected as "beneficial" and is not passed on to future generations, this mutation will disappear in that individual.

C. False

Not necessarily. Genetic variations occur at random, so those species that survive are selected and able to adapt.

E. False

It does not give an equal chance of surviving.

Tuberculosis is caused by the pathogen Mycobacterium tuberculosis, which currently latently infects nearly a third of the world's population. It is thought that host fatty acids can serve as a sole carbon source during infection. How does M. tuberculosis most likely metabolize fatty acids as an energy source?
A) By converting the fatty acids directly to glucose, which is then oxidized via glycolysis and the citric acid cycle
B) By a process called beta-oxidation, in which two carbon groups are removed to form acetyl-coA that enters the citric acid cycle and is oxidized to form ATP and reducing power.
C) By substrate level phosphorylation that removes phosphate groups from the fatty acids and transfers them to ADP to form ATP.
D) By reducing them and taking the electrons and protons and entering them into the electron transport chain to set up a proton motive force to generate ATP via ATP synthase.

Answers

Answer:

Option B is correct.

Explanation:

By a process called beta-oxidation, in which two carbon groups are removed to form acetyl-coA that enters the citric acid cycle and is oxidized to form ATP and reducing power.

Reliability refers to the ability of a test to produce consistent results each time it is administered
a. True
b. False

Answers

Answer: a. True

Explanation:

Reliability can be define as the consistency in the results or measure. A test is said to be reliable if the results obtained are repeated the same. For example,  if a test is designed to observe and measure the trait, then each time the test is administered to the subjects, the results obtain will be approximately the same.

Other Questions
The graph shows the cost of some taxi journeys work out a formula for c in terms of n A materials chemical property could be described as its reaction with other chemicals (gases, liquids and solid materials). a) True b) False Dr. Fitzgerald has graded 15 of 26 exams for Epi 501. (a) What proportion of all exams has Dr. Fitzgerald graded? (b) What was the ratio of graded to ungraded tests? The region in which an electron is likely to be found is known as a(n) ____________. A. energy level B. Aufbau level C. orbital D. None of these Why was the journey of the Cherokees called the Trail of Tears? Convert A4B from hexadecimal to binary. Show your work. Which of the following characterized big business during the guided age Keisha looks out the window from a tall building at her friend Monique standing on the ground, 8.3 m away from the side of the building, as shown. If Keisha's line of sight makes a 30 angle with the side of the building, what is Keisha's height above the ground? Assume Monique is 1.5 m tall. A. 14 m B. 15 m C. 16 m D. 17 m What are the names of the following compounds: FeCl HNO NaSO SO Select all molecules that are considered to be macromolecules. Check all that apply. An mRNA that will be translated to make a catabolic enzyme An mRNA that will be translated to make a catabolic enzyme An individual lipid found in a cell membrane An individual lipid found in a cell membrane A protein that is involved in DNA replication Which of the following is a career within the communications industry? Immunizations are less effective in malnourished children because immunizations are actually more effective because of the small body size. their blood circulation is too slow. their immune systems are compromised. their body tissues are growing too slowly. What is virtual representation Nike, now a triple bottom line company, had previously come under fire for the low wages that factory workers in Indonesia were paid. These low wages had an impact on which part of the triple bottom line? The altitude of the International Space Station ttt minutes after its perigee (closest point), in kilometers, is given by \qquad A(t) = 415 - \sin\left(\dfrac{2\pi (t + 23.2)}{92.8}\right)A(t)=415sin( 92.8 2(t+23.2) )space, A, left parenthesis, t, right parenthesis, equals, 415, minus, sine, left parenthesis, start fraction, 2, pi, left parenthesis, t, plus, 23, point, 2, right parenthesis, divided by, 92, point, 8, end fraction, right parenthesis. The International Space Station reaches its perigee once in every orbit. How long does the International Space Station take to orbit the earth? Give an exact answer. What characteristics do all living things share In maize (corn) plants, a dominant allele I inhibits kernel color, while the recessive allele i permits color when homozygous. At a different locus, the dominant allele P causes purple kernel color, while the homozygous recessive genotype pp causes red kernels. If plants heterozygous at both loci are crossed, what will be the genotypic and phenotypic ratios of the offspring? Which o the following statements is not true about the respiratory mucosa? a. The cilia can "taste" bitter toxins in the air. b. The cilia respond to toxins by moving more rapidly to remove the toxin. c. The longer a cilia is exposed to a toxin, the more effectively it moves to expel it. d. All of the above statements are true about the respiratory mucosa. Correct the possessive noun in the sentence The three tornadoes winds reached 200 miles per hour Upon joining the Girl Scouts a member receives 4 patches. Karen has been in the girls scouts for quite awhile and has a total of 70 patches. If Karen earns 3 patches each month,how many months has Karen been a member of the girls scouts?