can someone help me please Write 243 in exponential form ...?

Answers

Answer 1

The exponential form of 243 is: 243 = 3⁵.

To write 243 in exponential form, you need to express it as a power of a base number.

The most common base used for this purpose is 3.

243 can be written as: 243 = 3⁵

Here's the reasoning:

[tex]\[ 3 \times 3 = 9 \][/tex]

[tex]\[ 9 \times 3 = 27 \][/tex]

[tex]\[ 27 \times 3 = 81 \][/tex]

[tex]\[ 81 \times 3 = 243 \][/tex]

So, 243 is  3  raised to the power of 5.

Therefore,  243 In exponential form is: [tex]\[ 243 = 3^5 \][/tex]


Related Questions

The ballpark made a total of $15,000 from ticket sales at Wednesday's game. The ballpark charges $20 for each adult ticket and $10 for each child's ticket. They sold 3 times as many children's tickets as adult tickets. Write a system of equations that can be used to determine the number of adult and child tickets sold.

Answers

Final answer:

To determine the number of adult and child tickets sold, we can set up a system of equations based on the given information. By solving the system of equations, we find that the number of adult tickets sold is 300, and the number of children's tickets sold is 900.

Explanation:

Let's assume that the number of adult tickets sold is represented by 'x'.

Since the number of children's tickets sold is three times the number of adult tickets, the number of children's tickets sold can be represented as '3x'.

The total revenue from ticket sales is $15,000, so we can create the following equation:

20x + 10(3x) = 15,000

Simplifying this equation, we get:

20x + 30x = 15,000

Combining like terms, we have:

50x = 15,000

Dividing both sides by 50, we find:

x = 300

So, the number of adult tickets sold is 300, and the number of children's tickets sold is 3 times that, which is 900.

Learn more about System of Equations here:

https://brainly.com/question/21620502

#SPJ12

The difference between 6 thirty-sixes and 4 thirty-sixes?

Answers

Difference between 6- 36's & 4-36's would be 2-36's
Which would be equal to 72.
6 thirty-sixes - 4 thirty-sixes = 2 thirty-sixes
2•36 = 72

general admission to the americanmuseum of natural history is $19. if a group of 125 students visits the museum how much will the group's tickets cost

Answers

The total cost would be 2,375

Use the three steps to solve the problem.

A "Local" train leaves a station and runs at an average rate of 35 mph. An hour and a half later an "Express" train leaves the station and travels at an average rate of 56 mph on a parallel track. How many hours after it starts will the Express overtake the Local?

Answers

The answer is 2.5h.

Step 1. Express distances (d1 and d2, d1 = d2 = d) using the formula for the speed v = d/t
Step 2. Make the system of equations.
Step 3. Solve the system of equations and express t2

Step 1.
Local train parameters:
rate: v1 = 35 mph
time: t1
distance: d
v1 = d/t1
d = v1 * t1 = 35*t1

Express train parameters:
rate: v2 = 56 mph
time: t2 = t1 - 1.5 h  (because it is leaves hour and a half later then the local)
distance: d
v2 = d/t2
d = v2 * t2 = 56*(t1 - 1.5)

Step 2. Make the system of equations:
d = 35*t
d = 56*(t - 1.5)

Step 3. Solve the system of equations by using substitution method and calculate t2:
35t = 56(t1 - 1.5)
35t = 56t1 - 56*1.5
35t = 56t1 - 84
84 = 56t1 - 35t1
84 = 21t1
t1 = 84/21
t1 = 4

t2 = t1 - 1.5
t2 = 4 - 1.5
t2 = 2.5 h

In forming a contract, the “meeting of the minds” is _____. a. an agreement between all parties involved in the contract of the details of the contract. b. a formal meeting of the parties involved in a contract that may or may not result in a signed agreement. c. a phrase used to describe a verbal contract or a contract made without signatures from the parties involved. d. a mental exercise used by a person involved in a contract to try to guess the contract requests of the other parties and offer a compromise

Answers

Answer:  (a) an agreement between all parties involved in the contract.

   

Step-by-step explanation: While forming a contract, we generally use the phrase "meeting of the minds" , which implies that both the parties which are involved in the contract agree to the terms and conditions mentioned in the contract and are aware of the commitments made by each of the parties. Out of the four given options, only option (a) is acceptable, because the other three do not match with our requirement.

Thus, the correct option is (a).


An agreement between all parties involved in the contract. The correct option is A.

What is a “meeting of the minds”?

  While forming a contract, we generally use the phrase "meeting of the minds", which implies that both the parties which are involved in the contract agree to the terms and conditions mentioned in the contract and are aware of the commitments made by each of the parties. Out of the four given options, only option (a) is acceptable, because the other three do not match with our requirements.

Therefore, an agreement between all parties involved in the contract. The correct option is A.

To know more about the meeting of the minds follow

https://brainly.com/question/28576937

#SPJ3

The simplified value.

4^0 + 2 ⋅ 3 - 2

1
2
5
8
14
26

Answers

You follow PEMDAS rule:
4^0 + 2 ⋅ 3 - 2
Get the values first a number with exponent and the two multiplied numbers.
= 1 + 6 - 2
Add 1 and 6 first:
= 7 - 2
Subtract:
= 5 (Answer)

Answer: option c.) 5

Step-by-step explanation: you must always follow PEMDAS

so first step would be parentheses but there are none so you move on to exponents. 4^0=1. so now you have 1+2x3-2.

Next step is multiplication. 2x3 is 6 so now you have 1+6-2.

Now we only have addition and subtraction so you move from left to right. 1+6=7

7-2=5

giving you option c. 5

what is 234/78 I need help

Answers

The answer to 234/78 is 3
the remainder of the answer is 3 or the answer is 3. 

Solve for x: 3(x + 1) = −2(x − 1) + 6

A. 1

B. 4

C. 5

D. 25

Answers

3(x+1)=-2(x-1)+6
3x+3=-2x+8
5x=5
x=1

Thus, A would be the answer.

Answer:

Correct option is:

A. 1

Step-by-step explanation:

3(x + 1) = −2(x − 1) + 6

⇒ 3x+3= -2x+2+6

⇒ 3x+3= -2x+8

⇒ 3x+2x=8-3

⇒ 5x=5

dividing both sides by 5

⇒ x=1

Hence, the correct option is:

A. 1

Please check answer. Will Upvote.
Evaluate the function rule for the given value.
y = 15 • 3x for x = –3
Is the answer -135?

Answers

Y = 15 • 3x
Y = 15 • 3(-3)
Y = 15 • (-9)
Y = -135

Answer: Yes

Step-by-step explanation:

Hi, to answer this question we have to substitute x =-3 on the function given, and solve for the variable y.

y = 15 • 3x

Replacing the value of the variable x by -3:

y = 15 • 3(-3)

Multiplying

y = 15 .-9

y = -135

It is correct, the answer is y= -135  

Feel free to ask for more if needed or if you did not understand something.

MULTIPLE CHOICE PLEASE HELP FAST!!!!!!!

in one study it was found that the correlation coefficient between two variables is -0.32. which statement is true?
A. There is a weak positive association between the variables
B. There is a weak negative association between the variable
C. There is a strong positive association between the variable
D. There is a strong negative association between the variable

A study of several cities shows a positive correlation between the percent of people biking to work and that percent of people spending their vacation time at home.
Which statement is most likely true?
A. Bike riding makes people want to vacation at home
B. Vacationing makes people want to rife their bikes
C. The correlation is due to a third variable: cost of milk
D. The correlation is due to a third variable: cost of gas


Answers

Answer:

Just took the test and got an 100% so the answers are in fact,

in one study it was found that the correlation coefficient between two variables is -0.32. which statement is true?

B. There is a weak negative association between the variable  

A study of several cities shows a positive correlation between the percent of people biking to work and the percent of people spending their vacation time at home.  

Which statement is most likely true?

A. Bike riding makes people want to vacation at home  

Have a wonderful day if you need any other questions from this test let me know!!!!!!!

Final answer:

The correct answer for the correlation coefficient of -0.32 is B. There is a weak negative association.

For the correlation between biking and vacationing at home, the likely third variable is cost of gas, choice D: The correlation is due to a third variable: cost of gas

Explanation:

The correlation coefficient measures the strength and direction of the relationship between two variables. In this case, the correlation coefficient is -0.32, which indicates a weak negative association between the variables. A negative correlation means that as one variable increases, the other variable tends to decrease. So, option B - There is a weak negative association between the variables - is true.

For the second question, based on the information given, it is most likely that option D - The correlation is due to a third variable: cost of gas - is true. This means that the positive correlation between the percent of people biking to work and the percent of people spending their vacation time at home is likely influenced by the cost of gas as a third variable.

calculated a = 8³³ ÷ [4³² × 2³⁴ (2⁵ × 2²⁰)⁵ ÷ (16 × 2²³) (7⁵ ÷ 7⁵- 1)³² × 4]b = [(11 - 0¹¹) × (3³-3²) 1²⁰²⁰] × (3²-2³) - 3² × 2.

Answers

it simpifies to
a=-8b=15
a=15

-8b=15
divide by -8
b=-15/8


a=15
b=-15/8

What is the lcm of 6,15?

Answers

The least common multiple is 30.

In a group of 10 batteries, 3 are dead. You choose 2 batteries at random.
Create a probability model for the number of good batteries.

Answers

Final answer:

The probability model for the number of good batteries when selecting 2 out of 10 with 3 dead is calculated as combinations of selecting good and dead batteries for each scenario. The probabilities are always divided by the total ways of drawing 2 from 10.

Explanation:

This question is a typical problem related to probability. Firstly, we need to identify the number of ways we can draw 2 batteries randomly from this given set. We know there are 10 batteries in total with 3 dead ones. That leaves us with 7 good batteries.

Assuming 'X' is the number of good batteries we could select when drawing two batteries at random, 'X' could be 0, 1, or 2. Here are the three possible cases:

Both batteries are good (X = 2): The number of ways to select 2 batteries from 7 is combination of 7 by 2, denoted as C(7, 2). One battery is good and one is not (X = 1): The number of ways for this case can be calculated as the combination of picking 1 good battery from 7 and 1 dead battery from 3, denoted as C(7, 1)*C(3, 1). None of the batteries are good (X = 0): The number of ways for this case can be calculated as the combination of picking 2 dead batteries from 3, denoted as C(3, 2).

To find out the probability of each scenario, we would have to divide by the total number of ways of drawing 2 batteries from 10, which equals to C(10, 2).

Learn more about Probability here:

https://brainly.com/question/32117953

#SPJ11

You invest $5,000 in a savings account that earns 6% interest each year.
A. How much money do you have in your savings account after the first year?
















B. How much money do you have in your savings account after the second year?


Answers

A. Multiply $5000 by .06, and add it back to $5000 to get the total after one year. This is $5300.
B. Multiply the new amount, or $5300 by .06, and add it back to $5300 to get the total after 2 years. This is $5618. 

A. $5300
B. $5618
Final answer:

After the first year, with an initial investment of $5,000 and an annual interest rate of 6%, the total amount in the savings account is $5,300. After the second year, the total amount in the account increases to $5,618.

Explanation:

You are investing $5,000 in a savings account with an annual interest rate of 6%. The amount of interest you earn each year is calculated using the formula: principal amount *(interest rate/100).

A. After the first year, you would have:
Interest = $5,000 * (6/100) = $300
Therefore, the total amount in the savings account after one year is $5,000 + $300 = $5,300.

B. For the second year, we apply the same formula to the updated  balance from the first year:
Interest = $5,300 * (6/100) = $318
Therefore, the total amount in the savings account after two years is $5,300 + $318 = $5,618.

Learn more about Interest Calculation here:

https://brainly.com/question/29011216

#SPJ2

Write log3 6 as a logarithm of base 2.

1) (log2)3/(log2)6
2) (log2)6/(log2)3
3) (log3)2/(log6)2
4) (log6)2/ (log3)2 ...?

Answers

The answer is 2) (log2)6/(log2)3.

Use the change-of-base formula: [tex]log_a(x)= \frac{log_b(x)}{log_b(a)} [/tex]

So, if we want to write log3(6) as a logarithm of base 2, in these example a = 3, x = 6, b = 2:
[tex]log_3(6)= \frac{log_2(6)}{log_2(3)}[/tex]

The correct expression for log3 6 as a logarithm of base 2 is option 1) (log₂ 3) / (log₂ 6).

To express log₃ 6 as a logarithm of base 2, we can use the change of base formula. The change of base formula states that logb x = (logc x) / (logc b), where c is any positive value other than 1.

Applying the change of base formula to log3 6:

log₃ 6 = (log₂ 6) / (log₂ 3)

Therefore, the correct expression for log3 6 as a logarithm of base 2 is option 1) (log₂ 3) / (log₂ 6).

To calculate it properly, we need to find the decimal approximation of this expression:

Using the appropriate logarithmic functions, we have:

(log₂ 3) / (log₂ 6) ≈ 1.58496 / 2.58496 ≈ 0.6124

Thus, log₃ 6 as a logarithm of base 2 is approximately 0.6124.

To know more about logarithm:

https://brainly.com/question/28346542


#SPJ6

How much less would a 25 year old male pay for a $50,000 policy of 20 y life insurance @ $5.84 per $1000, than a straight life policy @ $15.66 per $1000?

Answers

Final answer:

A 25-year-old male would pay $491 less for a $50,000 policy of 20-year life insurance at $5.84 per $1,000, than for a straight life policy at $15.66 per $1,000. This is calculated by first determining the total cost of each policy and then finding the difference between the two.

Explanation:

To calculate the cost difference between the 20-year life policy and the straight life policy, we first need to calculate the cost of each policy. The cost of the policies is given per $1,000, and the policies provided are worth a total of $50,000.

The 20-year life policy costs $5.84 per $1,000. Therefore, we calculate 50 (as $50,000 divided by $1,000 gives 50) multiplied by $5.84, which equals to $292. The straight life policy costs $15.66 per $1,000. Therefore, we calculate 50 multiplied by $15.66, which equals to $783.

To find out how much less a 25-year-old male would pay for the 20-year policy than the straight life policy, we subtract the cost of the 20-year policy from the cost of the straight life policy: $783 - $292 = $491.

So, a 25-year-old male would pay $491 less for a $50,000 20-year policy than a straight life policy.

Learn more about Insurance Policies here:

https://brainly.com/question/10961961

#SPJ12

Use the graph to determine and interpret the solution. A 4 cm bean plant grows at a rate of 1/2cm per week. A 5.5 cm flower grows at a rate of 1/4cm per week. If h is the height of the plant in centimeters and t is the number of weeks, then the system of equations is:
h = 1/2t + 4
h = 1/4t + 5.5
The solution to the system,___?___
, means that the plants will both be ___?___ centimeters tall after__?___weeks.

Answers

1/2t + 4 = 1/4t + 5.5
1/2t - 1/4t = 5.5 - 4
2/4t - 1/4t = 1.5
1/4t = 1.5
t = 1.5 x 4
t = 6

h = 1/2t + 4
h = 1/2(6) + 4
h = 3 + 4
h = 7

solution is (7,6)
means that the plants will both be 7 cm tall after 6 weeks

The solution of the system is h =7 and t = 6 means that the plants will both be 7 centimeters tall after 6 weeks.

Given that

A 4 cm bean plant grows at a rate of 1/2cm per week.

A 5.5 cm flower grows at a rate of 1/4cm per week.

If h is the height of the plant in centimeters and t is the number of weeks, then the system of equations is:

h = 1/2t + 4

h = 1/4t + 5.5

According to the question

The solution of the system of equation is;

h = 1/2t + 4

h = 1/4t + 5.5

Substitute the value of h from equation 1 in equation 2

[tex]\rm h = \dfrac{1}{4}+5.5\\\\\dfrac{1}{2}t +4 = \dfrac{1}{4}t +5.5\\\\\dfrac{1}{2}t-\dfrac{1}{4}t = 5.5-4\\\\\dfrac{2t-t}{4} = 1.5\\\\\dfrac{t}{4} = 1.5\\\\t = 4\times 1.5\\\\t = 6[/tex]

Substitute the value of t in equation 1

[tex]\rm h = \dfrac{1}{2}\times 6+4\\\\h = 3+4\\\\h = 7[/tex]

Hence, The solution of the system is h =7 and t = 6 means that the plants will both be 7 centimeters tall after 6 weeks.

To know more about the System of Equation click the link given below.

https://brainly.com/question/12895249

what is x+2+x^2+2
what is x+2+x^2+2
what is x+2+x^2+2

Answers

If you factor the expression, your answer would look like this:
x + x^2 + 4
If you simplify the expression, your answer would look like this:
x^2 + x + 4

Answer: x^2 + x + 4


Step-by-step explanation:

You factor the expression to x + x^2 +4

Then you simplify to x^2 + x +4

What is meant by "transposing a term"?

Answers

To move (a term) from one side of an algebraic equation to the other side by addition or subtraction which causes its sign to change.
terms are separated by + and - signs.
Example:  solve 2x+3=9                         2x+3-3=9-3 (subtract 3 from both sides)                         2x=9-3          (the 3 has been TRANSPOSED to the RHS)                         2x=6                         x=3

how do i find this answer....

215.4% of 55= 118.47...

I have a TEAS test tomorrow and i cant figure out how to find this answer! ...?

Answers

215.4 * 55 then move the decimal point left 2 spots.

Angle θ lies in the second quadrant, and sin θ = 3/5

Answers

the answer is this because it is -4/5 cost 
-3/4 tan

Answer:

sin θ [tex]=\frac{3}{5}[/tex]

It is given that , Angle θ lies in the second quadrant.

In the right triangle, Perpendicular =3 units, and Hypotenuse = 5 Units

As, sinθ  is positive in second Quadrant also.That is , sin(π-θ )=sin θ

Also, [tex]sin(\frac{\pi}{2}-\Theta)=cos\Theta[/tex]

[tex]sin (\Theta) = 3/5\\\\  (\Theta) =sin^{-1} \frac{3}{5} {\text{or}} (\Theta) =\pi -sin^{-1} \frac{3}{5}\\\\cos(\frac{\pi}{2}-\Theta)= \frac{3}{5}\\\\ \frac{\pi}{2}-\Theta=cos^{-1}[\frac{3}{5}]\\\\ \Theta= \frac{\pi}{2}-cos^{-1}[\frac{3}{5}][/tex]

So, [tex]\pi-\Theta= \frac{\pi}{2}+cos^{-1}\frac{3}{5}, {\text{or}}\pi -sin^{-1} \frac{3}{5}[/tex]

are values of theta which lies in second quadrant.

How do you solve this problem
58=(2/3)w

Answers

38.66666666666666666666666666666666666666666666666666666666666666

Which of the following sets represents the range of the function shown?

{(–3, 4), (5, 11), (9, –1), (10, 13)}


{–3, 5, 9, 10}
{–1, 4, 11, 13}
{(4, –3), (11, 5), (–1, 9), (13, 10)}
{–3, –1, 4, 5, 9, 10, 11, 13}

Answers

The range represents the y-values.
The function is:
{ ( - 3 , 4 ) , ( 5, 11 ) , ( 9 , - 1 ) , ( 10, 13 ) }
Answer:
The range of the function is B ) { - 1, 4, 11, 13 }  

The figure below shows a trapezoid, ABCD, having side AB parallel to side DC. The diagonals AC and BD intersect at point O.


If the length of AO is three times the length of CO, the length of BO is

one-third the length of AC

one-third the length of AB

three times the length of DO

three times the length of DC

Answers

BO is the same length as AO, and DO is the same length as CO. therefore BO is three times the length of DO.

Answer:

Length of BO is three times the length of DO.

Step-by-step explanation:

In trapezoid ABCD, [tex]CD\ ||\ AB[/tex]

In ΔCDO and ΔABO,

[tex]m\angle CDO=m\angle ABO[/tex] (Alternate interior angles)[tex]m\angle DCO=m\angle BAO[/tex] (Alternate interior angles)

So, [tex]\Delta CDO\sim \Delta ABO[/tex] according to Angle-Angle similarity.

Therefore, the ratio of corresponding sides will be same.

[tex]\Rightarrow \dfrac{OD}{OB}=\dfrac{OC}{OA}[/tex]

[tex]\Rightarrow \dfrac{OD}{OB}=\dfrac{OC}{3\cdot OC}[/tex]

[tex]\Rightarrow \dfrac{OD}{OB}=\dfrac{1}{3}[/tex]

[tex]\Rightarrow OB=3\cdot OD[/tex]


In the diagram below, KL = 12 and LM = 8. Which additional facts would guarantee that JKLM is a parallelogram? Check all that apply.

Answers

By definition, a parallelogram is a figure that has opposite sides parallel or it has two pairs of sides that are parallel. Based on the given figure above, the additional facts that would guarantee that JKLM is a parallelogram are the following: JK= 8 and JM= 12 and JK= 8 and JK is parallel to LM. Hope this answer helps.

Which best describes the solution to 4-7?

Answers

-3 is the answer, its a ratio too

Answer:

the answer is the second option; because 4+(-7) is an equivalent expression the answer Is -3

What is the measure of ∠XYZ

Answers

The measure of angle ∠XYZ is 66°.

Given:

∠W + ∠X = ∠XYZ (Sum of opposite interior angles is equal to the exterior angle)

Let's solve for x:

2x + 12 + 2x + 14 = 5x + 16

4x + 26 = 5x + 16

26 - 16 = 5x - 4x

10 = x

Now substitute the value of x into the equation for ∠XYZ:

∠XYZ = 5x + 16

∠XYZ = 5 * 10 + 16

∠XYZ = 50 + 16

∠XYZ = 66°

Therefore, the measure of ∠XYZ is 66°.

To know more about angle:

https://brainly.com/question/13954458


#SPJ6

Charlene is knitting a baby blanket. She wants its width, w, to be at least half its length, l. She estimates that she has enough yarn to put fringe around the blanket, as long as the perimeter of the blanket is no more than 180 inches. The system of inequalities shown represents the width of the blanket in inches, w, and the length in inches, l.

w ≥ 0.5l

2l + 2w ≤ 180

Answers

Answer:

The length of the blanket should be less than or equal to 60 inches.

The width should be greater than or equal to 30 inches.

Step-by-step explanation:

Let the length of the blanket be = l

Let the width of the blanket be = w

Charlene wants the width, w, to be at least half its length, l. This can be shown as :

[tex]w\geq 0.5l[/tex]

She estimates that she has enough yarn to put fringe around the blanket, as long as the perimeter of the blanket is no more than 180 inches.

This can be shown as :

[tex]2l+2w\leq 180[/tex]

[tex]2l+2(0.5l) \leq 180[/tex]

[tex]2l+1l \leq 180[/tex]

[tex]3l \leq 180[/tex]

[tex]l\leq 30[/tex]

So, we get length of the blanket should be less than or equal to 60 inches.

And the width should be greater than or equal to 30 inches.

If ON = 5x – 4, LM = 4x + 7, NM = x – 7 and OL = 2y – 6, find the values of x and y for which LMNO must be a parallelogram. The diagram is not to scale. ...?

Answers

Final answer:

Opposite sides of parallelogram LMNO must be equal. By setting the equations for opposite sides equal and solving, we find x = 11 and y = 5.

Explanation:

To determine the values of x and y for which LMNO is a parallelogram, we can use the properties of a parallelogram which state that opposite sides are equal in length. Since ON and LM are opposite sides, as well as OL and MN, we set their equations equal to each other:

ON = LM means 5x - 4 = 4x + 7.OL = NM means 2y - 6 = x - 7.

Solving the first equation gives us x = 11. Substituting x = 11 in the second equation gives 2y - 6 = 4, which simplifies to y = 5. Therefore, the values are x = 11 and y = 5 for LMNO to be a parallelogram.

Which of the following is not equivalent to the formula for the circumference of a circle, C = 2pir ?

A) C over r equals 2 times pi

B) C over pi equals 2 times r

C) C over the quantity of r times pi equals 2

D) Cr = 2pi

Answers

Answer:

the answer is d. Cr= 2 pi

Step-by-step explanation:

The correct answer that is not equivalent to the formula for the circumference of a circle  is:  Cr = 2pi. (Option D).

How to get the Circumference of a Circle?

To prove the options, it is important to test the formulas given:

In option A,  C over r equals 2 times pi:

C/r = 2 * pi

This equation is equivalent to the formula for the circumference of a circle, C = 2 * pi * r, as you can simply multiply both sides by 'r' to get the standard formula.

In Option B, C over pi equals 2 times r:

C/pi = 2 * r

This equation is equivalent to the formula for the circumference of a circle as pi can be multiplied on both sides

In Option C, C over the quantity of r times pi equals 2:

C / (r * pi) = 2

This equation is equivalent to the formula for the circumference of a circle since you can multiply both sides by (r * pi) to get C = 2 * (r * pi).

In option D, This equation is not equivalent to the formula for the circumference of a circle. It is missing the division by 'r' on the right side of the equation.

Learn more about circumference of circle here: https://brainly.com/question/18571680

#SPJ2

Other Questions
Solve the given differential equation dN/dt=kN, (k=constant) ...? The trash, located by the sink, is always taken out at least once a week to keep the kitchen from smelling. What is the dangling modifier in this sentence? Given the ip address 192.168.112.0. each network requires between 35 and 60 hosts. what is the broadcast address of the first available subnet? 30 POINTS DONT ANSWER IF YOU DONT KNOW THE ANSWER FOR SUREIn the gene TATTCATTGTTATGATTTATTCG, CATTGTTA encodes for pepsin, a digestive enzyme. The rest of the sequence doesnt code for any protein. Which sequence contains a mutation that will affect the formation of pepsin?A. TATTCATTCATTATGATTTATTCGB. TATTCATTGTTATGACTTTATTCGC. TATTCATTGTTATGATTTATTGGCGD. TATTCATTGTTATGATATTCGE. TGCATTCATTGTTATGATTTATTCG A box is given a push so that it slides across the floor. How far will it go, given that the coefficient of kinetic friction is 0.15 and the push imparts an initial speed of 3.5m/s? When was the u.s. constitution written? what is bulimia? can someone explain it to me. Which items describe people's interactions with their environment?Technology does not affect the earth's environment.People adapt to their environment.People adapt their environment.Population growth and the environment are unrelated.Changes to the earth's environment rarely matter.Changes to the earth's environment can be harmful.Changes to the earth's environment can be beneficial. Choose the sentence that has the correct form of the verb ser. Ellas es muy inteligentes. Clara no es cubana. Nosotros son amigos. Yo eres serio. A rate that describes how much smaller or larger the scale drawing is than the real object Write 6% as a decimal. There are two main functions for polysaccharides in living things. Discuss these two functions, and how the structures of polysaccharide molecules support these functions.Now I know that all polysaccharides are made up of the same monomer, glucose. Is this question essentially asking me the use of glucose throughout different organisms? Which of the following represents the graph of f(x) = 2x + 2? algebra help?write a function rule for the area of a triangle with a base of 3 cm greater than 5 times its height. what is the area of a triangle when its height is 6 cm? 6 letter word: a stack of thylakoids in a chloroplast Explain how the powers of the Supreme Court and federal law were extended by significant court cases during the period Algae uses all the energy in sunlight to perform photosynthesis.true or false what is 2 1/2 divided by 1/3 The ratio of the number of red marbles to the number of green marbles in a bag is 2:3. The ratio of the number of green marble to the number of blue marbles is 9:4 There are 76 marbles in the bag. a) Find the number of red marbles in the bag.b) Find the number of green marbles in the bag.C) Find the number of blue marbles in the bag///I already did a and b can you guys help me with c/// Endorphins can help reduce stress and are natural painkillers.TrueFalsei think its true?