Answer:
thylakoid membrane
Explanation:
The green pigment chlorophyll is located within the thylakoid membrane, and the space between the thylakoid and the chloroplast membranes is called the stroma
Chlorophyll molecules, which are key in photosynthesis, are located in the thylakoid membrane of the chloroplast. They absorb light to initiate the light-dependent reactions of photosynthesis.
Explanation:Chlorophyll molecules are located in the thylakoid membrane of the chloroplast. The thylakoid membrane is a system of interconnected discs where the light-dependent reactions of photosynthesis occur. These reactions convert light energy into chemical energy, specifically ATP and NADPH, which are then used in the Calvin cycle in the stroma of the chloroplast to create glucose. The chlorophyll in the thylakoid membrane absorbs light and uses that energy to initiate photosynthesis.
Learn more about Chlorophyll in Chloroplast here:https://brainly.com/question/33440530
#SPJ6
Proprioceptive neuromuscular facilitation technique requires
Answer:
A partner
Explanation:
Proprioceptive neuromuscular facilitation technique is a stretching technique that is aimed at rehabilitating or restoring back to health the proprioceptors present in the body also known as sensory organs of the muscles and tendons, bones and joints of the body
Proprioceptive neuromuscular facilitation technique uses stretching techniques involving contraction and relaxation to achieve a maximum flexibility of the muscular system of the body.
Proprioceptive neuromuscular facilitation technique is always done or carried out with a partner or a trainer.
Answer:
The proprioceptive neuromuscular facilitation technique requires organic proprioceptors
Explanation:
Proprioceptive neuromuscular facilitation techniques are therapeutic methods used in order to obtain specific responses of the neuromuscular system from the stimulation of organic proprioceptors.
Walking along a beach, you find a section of an adult gray whale's vertebral column with three vertebrae. You saw one of the vertebra in half, revealing a hard outer layer of _____ forming the wall, and a network of _____ with _____ in the center.
Answer:
Walking along a beach, you find a section of an adult gray whale's vertebral column with three vertebrae. You saw one of the vertebra in half, revealing a hard outer layer of compact bone forming the wall, and a network of spongy bone with trabeculae in the center.
Explanation:
The harder structures of a skeleton are made by the compact bone. Compact bones are dense and rigid. They are non-porous.Spongy bones are porous bones which are covered by the compact bones as they themselves are not hard. They are also known as cancellous bones.
Trabeculae are thin plates which give a spongy structure to the spongy bones. The trabeculae are present in the center of the spongy bones.
The four pulmonary veins return oxygenated blood to this chamber. What is this chamber?
The left atrium receives oxygenated blood from the four pulmonary veins.
Explanation:The chamber that receives oxygenated blood from the four pulmonary veins is the left atrium.
Learn more about Pulmonary veins and left atrium here:https://brainly.com/question/34323562
#SPJ6
What are the two ultimate sources of energy for all the living things on Earth?
After watching the squirrels at the local park for several days, Sergei asks his science teacher the following question: "Do more squirrels live in maple trees or oak trees in the city park?”
Is Sergei's question a scientific question? Why or why not?
Answer:
Sergei's question is a scientific question because it is based on observations and could be answered through an investigation. His question may lead to a testable hypothesis.
Answer:
Sample Response: Sergei's question is a scientific question because it is based on observations and could be answered through an investigation. His question has a narrow focus, addresses a gap in his knowledge, and may lead to a hypothesis that can be tested.
Which body system is most like the cell wall?
Answer:
The digestive system
Explanation:
fthe human body is made up of several organs that work together to break down food so it can be used in the body.
The bonesin of the body can be represented as cell wall can be represented because the bones provide extra support for the cell just like the cell wall does to its plant cell.
what is the function of cell wall ?A cell wall referred as the non-living component of a living cell which act as an outer covering of the cell mostly present in prokaryotes, plants.
The function of cell wall include separation of the interior cell contents of the cell from the exterior environment.
The cell wall provides shape, support, and protection to the cell from external environment, Prokaryotic cell has cell walls are chemically different from the cell wall found in plants and fungi.
The prokaryotic cell walls composed of large polymers called peptidoglycans which serve as a protective layer and prevent lysis;
For more details regarding cell wall, visit
brainly.com/question/965751
#SPJ5
The is the sac-like structure that holds the testes is called
Answer:
The scrotum
Explanation: It is a loose sac which contains the 2 testes. Both the testes are attached to a cord-like structure called spermatic cord which contains testicular artery, vein, nerve and also vas deferens tube which takes sperms from the testes into the penile urethra.
What are the three domains of life?
Plantae, Animalia, and Fungi
class, kingdom, and phylum
Eubacteria, family, and Eukarya
Bacteria, Archaea, and Eukarya
The three domains of life are Bacteria, Archaea, and Eukarya. These cater to different types of life forms based on their cell structure and environments. Bacteria and Archaea are prokaryotes, while Eukarya includes animals, plants, and fungi.
Explanation:The three domains of life are Bacteria, Archaea, and Eukarya. These domains are a way of grouping life on Earth and are above the Kingdom level in taxonomic ranking. Bacteria and Archaea include various prokaryotic microorganisms, but Archaea are often found in extreme environments. Eukarya consists of organisms whose cells have a nucleus enclosed within membranes, including animals, plants, and fungi, among others.
Learn more about domains of life here:https://brainly.com/question/32820008
#SPJ12
HELPPPPP WILLL GIVE BRAINLIEST!!!!!RATE!!!!! AND THANKS!!!!! EASY BUT IM DUMB!!!!
What evidence BEST supports the presence of atmospheric oxygen 2.7 billion years ago?
A) organic material in meteorites
B) layered iron rust in rocks
C) fossils found in stomatolites
D) carbon 14 in plants
Answer:
c
Explanation:
Answer:
D) carbon 14 in plants
Explanation:
Plants fix atmospheric carbon during photosynthesis, so the level of 14C in plants and animals when they die approximately equals the level of 14C in the atmosphere at that time. However, it decreases thereafter from radioactive decay, allowing the date of death or fixation to be estimated.
How did Hershey and Chase help build our understanding of genetics?
A.
They showed that DNA cannot move between cells.
B.
They showed that DNA carries genetic material.
C.
They showed that viruses cannot infect cells.
D.
They showed that traits cannot be inherited.
Answer: They showed that DNA carries genetic natural
Explanation: How did Hershey and cheese help build our understanding of genetics
They showed that DNA carries genetic material. The correct option is B.
What is genetic material?Any substance that contains genetic information and transmits it from one generation to the next, whether it be from a plant, animal, microbial, or other source.
The molecule that carries genes, is passed down from parents to offspring, and contains the instructions for the development and operation of living things is known as DNA.
DNA is the genetic material that is found in the cytoplasm of prokaryotic (bacteria) and eukaryotic (animals and plants) cells and determines an organism's make-up.
Every cell has a nucleus that contains DNA, which is same in every cell.
Chase and Hershey contribute to our growing grasp of genetics. They demonstrated how DNA carries genetic information.
Thus, the correct option is B.
For more details regarding genetic material, visit:
https://brainly.com/question/14530382
#SPJ6
The neuronal circuitry to skeletal muscles involves neurons that stimulate contractions and those that inhibit contractions. The muscle spindles and Golgi tendon organs are involved in maintaining the proper muscle tonus (resting muscle tension); they work by signaling the CNS. Since tetanus involves __________, the neurons involved in muscle contraction __________ are affected.
Answer:
somatic motor neuron hyperexcitability; inhibition
The neuronal circuitry to skeletal muscles involves neurons that stimulate contractions and those that inhibit contractions. The muscle spindles and Golgi tendon organs are involved in maintaining the proper muscle tonus (resting muscle tension); they work by signaling the CNS. Since tetanus involves SOMATIC MOTOR NEURON HYPEREXCITABILITY, the neurons involved in muscle contraction INHIBITION are affected.
Explanation:
Tetanus is a infection that is caused by a bacteria called Clostridium tetani. It occurs when open wounds in the body are not properly treated and they get infected. This wound can be caused by stepping on a nail or sharp object like broken bottle.
When tetanus enters an open wound present on the body, it attacks the neurons in the body, specifically the somatic motor neurons. Tetanus hinders the release of neurotransmitters and blocks the inhibitory properties of the muscles. These causes the muscles of the body to contract unhindered and uncontrollably resulting in spasms. This can also be referred to as neuronal hyperexcitabilty.
Answer:
1) Somatic motor neuron hyperexcitability 2) inhibition
Explanation:
Tetanus is infection caused by the toxin produced by the bacterium Clostridium tetani. The tetanus injections are highly recommended whenever a person got injured like on bike accident because it entered the body by break in skin.
Tetanus toxin is transported to spinal cord by binding to presynaptic membrane of neuromuscular junction. Tetanus blocks the neurotransmitter ( GABA and glycine) release from inhibitory neuron which causes the continuous hyperexcitability of motor neuron. So The motor neurons keeps on exiting because inhibitory neurons are unable to release neurotransmitter and this conditions interferes with muscles relaxation.
It may cause fever, headache, breathing problem and bone fracture.
Sonny took 16 seconds to finish a 100 m race . what was sonny 's average speed in the race ? give your answer decimal form
Answer:
6.25 meters per second
Explanation:
100 / 16 = 6.25
Sonny took 16 seconds to finish a 100 m race. Then, the average speed of Sonny will be 6.25 meters per second.
What is Average speed?The average speed can be defined as the total distance traveled by the object in a particular time interval. The average speed is a scalar quantity because it has only magnitude and no direction. The SI unit of average speed is meter per second.
Average speed = Distance covered/ Time taken
Average speed = 100m/ 16 sec
Average speed = 6.25m/s
Therefore, the average speed of Sonny is 6.25 meters per second.
Learn more about Average speed here:
https://brainly.com/question/12322912
#SPJ6
Below is the double-stranded DNA sequence of part of a hypothetical yeast genome. Within this sequence is a small gene, PICO8, that codes for an 8 amino-acid peptide (assume traditional start codon). Transcription of PICO8 starts at the Transcription Start Site (TSS) after the promoter and proceeds in the direction of the arrow. Transcription stops at the end of the transcription terminator.
5' - CTATAAAGAGCCATGCATATCTAGATAGTAGGCTCTGAGAATTTATCTCACT - 3
3 - GATATTTCTCGGTACGTATAGATCTATCATCCGAGACTCTTAA ATAGAGTGA - 5
promoter terminator
Which strand of DNA is the CODING strand? (TOP OF BOTTOM?) Select only ONE answer choice.
A. Top
B. Bottom
C. Either can serve as the codong strand
D. There isn't enough information to determine which is the coding strand
Answer:
D. There isn't enough information to determine which is the coding strand
Explanation:
In this protein, it would be necessary to observe a start codon (ATG) and one-stop codon (either TAA, TAG, or TGA) which should be separated by six (6) intern codons. It is not observable this nucleotide sequence in any of both DNA strands.
Transcription and Translation are the two steps of the central dogma, in which genetic information from the DNA is converted into the RNA, then a long chain of polypeptides.
The correct answer is:
Option A. Top
In the given sequence of the hypothetical yeast genome, the PlCO8 gene codes for a small peptide chain of 8 amino acids.
The transcription starts from the traditional start site, in which the nucleotides in the template strand are converted into the corresponding base pair in the mRNA.
In the given sequences of nucleotides, the coding strands will be the strand that runs in the direction of 5'-3'.
The codes from the coding strand are then transcribed into the mRNA, followed by the translation.
Therefore, option A is correct.
To know more about Transcription, refer to the following link:
https://brainly.com/question/14136689
Selective serotonin reuptake inhibitors a. act to stabilize the mood swings of those with bipolar disorder b. were the first antidepressants to be developed c. may lead to sexual problems d. are more effective than tricyclic antidepressants
Answer:
B
Explanation:
SSRI stands for Selective Serotonin Reuptake Inhibitor. SSRI antidepressants are a type of antidepressant that work by increasing levels of serotonin within the brain.
You just ate a bowl of mashed potatoes. The starch began chemical digestion in your mouth and finished in your duodenum with hydrolysis into glucose molecules. The fate of the starch is conversion to glycogen in your liver. What did the glucose travel through in order to get to your liver?
Answer: Glucose is travelled through the blood stream to get to the liver
Explanation:during digestion,food is broken by physical and chemical processes. This may involve chewing or the use of enzymes to break down food.
When food is taken in through the mouth, it is chew and saliva acts on it.saliva helps to lubricate the food and assist in swallowing.from there the food passes through the oesophagus into the intestine. In the intestine food is further mixed with digestive enzymes.From the the stomach the food moves to the intestine where absorption of digested food takes place .
Starch is digested by saliva in the mouth and pancreatic juice, into glucose
Glucose is absorbed across the mucusa to the blood and carried of to the liver ,where it is stored
True or false? Charles Darwin noticed that all of the Galapagos islands had 1
species that were all exactly the same.
Answer:
true
Explanation:
The ________ of the lungs is an indication of their expandability, how easily the lungs expand and contract.
Answer:
The answer is compliance.
Explanation:
Answer:
Rib CageExplanation:
A _______________ tree is one that has a unique common ancestor that shares traits which are not associated with other types of organisms.
Select the correct answer.
Chordates are deuterostomes. Which invertebrates are also deuterostomes?
O A. Arthropoda
OB. Mollusca
O C.
Echinodermata
Habituation refers to the __________.
a. awareness that things continue to exist even when not perceived.
b. decreasing responsiveness to a stimulus to which one is repeatedly exposed.
c. adjustment of current thinking to make sense of new information.
d. the tendency to gaze longer at face-like images.
Answer:
Habituation refers to the adjustment of current thinking to make sense of new information.
Explanation:
Final answer:
Habituation is the process where there is a decrease in response to a repeatedly presented stimulus, with no rewards or punishments associated with it, and is a form of learning that is long-lasting.
Explanation:
Habituation refers to the decreasing responsiveness to a stimulus to which one is repeatedly exposed. Therefore, the correct answer is (b). This form of learning is seen across various species and is not due to fatigue or sensory adaptation. An example of habituation can be observed when a dog stops responding to a repetitive sound after learning that it has no significant consequence. The process of habituation is long-lasting, and it is considered one of the simplest forms of learning, highlighting an organism's ability to filter out repetitive, inconsequential stimuli over time.
The term transgenes refers to
genes that are transmitted from one generation to the next.
genes that are transferred from the genome of one organism into another.
genes that make trans-double bonds.
gene products that are modified on the trans-face of the Golgi apparatus.
Answer:
The term transgenes refers to
genes that are transferred from the genome of one organism into another.
Explanation:
Which plays both a role in physical and chemical digestion?
Answer:
Carbohydrate digestion starts in the mouth and protein digestion starts in the stomach.The digestive system fuels the cells and the excretory system rids the body of the cells' waste.
Explanation:
Saliva plays both a role in physical and chemical digestion. So, the correct option is B.
What is Digestion?Digestion is defined as the breakdown of large insoluble food molecules into smaller water soluble food molecules, through which they can be absorbed into the watery blood plasma. These small substances are absorbed into the bloodstream through the small intestine in some organisms.
Chemical digestion is described as the conversion of bonds in food into organic molecules while physical digestion is described as the mechanical breakdown of food. Physiological or physical digestion in the mouth involves mastication, which is chewing, or grinding, of food. Saliva plays both a role in physical and chemical digestion.
So, the correct option is B
Learn more about Digestion, here:
https://brainly.com/question/29028558
#SPJ5
Your question is incomplete, most probably the complete question is:
Which plays both a role in physical and chemical digestion?
Teeth Saliva Gall bladder VilliCheck all the characteristics below that describe
elements
one type of atom
a pure substance
more than one type of atom
chemically combined elements
Answer:
The Answer your looking for is A and B
A-one type of atom
B- a pure substance
Explanation:
__________
_____________
The characteristics below that describe elements are: one type of atom and a pure substance. The correct options are A and B.
What is an element?An element is a kind of atom that contain a specific amount of protons in its nuclei, and they can be a pure species. Chemical elements can be divided any further.
It is clear that the elements are pure substances, and they are one type of atom.
Thus, options A and B are correct regarding the characteristics of elements.
Learn more about an element, here:
https://brainly.com/question/13794764
#SPJ2
The following table shows the kinds of seed that are commonly eaten by four types of birds. In the table, an X indicates that the bird eats the seed from that plant.
corn millet safflowe sunflower
bunting X X
cardinal X X
pigeon X X
sparrow X X X
An ecosystem originally has an adequate supply of corn, millet seeds, safflower seeds, and sunflower seeds. One year, a disease kills most of the corn and millet plants. Based on the table, which kind of bird is best adapted to the ecosystem after the disease kills the corn and millet plants?
corn and millet plants?
A.
cardinal
B.
jay
C.
sparrow
D.
bunting
Answer:Cardinal
Explanation: Doesnt rely on corn or millet plant.
Answer:
Cardinal
Explanation:
Immunoglobulins that attach to and sensitize mast cells and basophils are
Answer:
IgE
Explanation:
Immunoglobulins can be described as antibodies that are found in blood and other bodily fluids of humans and other vertebrate animals. And their major function is that they help identify and destroy foreign substances such as microbes such as bacteria and protozoan parasites.
They are known to be produced by produced by plasma cells (white blood cells).
Immunoglobulins are classified into five categories: IgA, IgD, IgE, IgG and IgM. And are distinguished by the type of heavy chain they contain. IgG molecules possess heavy chains known as γ-chains; IgMs have μ-chains; IgAs have α-chains; IgEs have ε-chains; and IgDs have δ-chains.
In this case, IgE is the immunoglobulin that attach to and sensitize mast cells and basophils.
The correct answer is D) IgE, which attaches to and sensitizes mast cells and basophils, playing a significant role in allergic responses and defense against parasitic infections.
The immunoglobulin that attaches to and sensitizes mast cells and basophils is D) IgE. Here's why:
IgE binds to the Fc receptors on the surface of mast cells and basophils.These cells then become sensitized to future exposures of the same allergen.Upon re-exposure to the allergen, IgE triggers these cells to release histamine and other chemicals, leading to an allergic reaction.IgE is involved in defense against parasitic infections, which also relies on its ability to activate mast cells and basophils.Its primary role is mediating immediate hypersensitivity reactions, including allergies like hay fever, asthma, and anaphylaxis.Compared to other immunoglobulins, IgE is present in very small quantities in the serum but has significant effects on immune response once bound to mast cells and basophils.
Complete question:
Immunoglobulins that attach to and sensitize mast cells and basophils are
A) lg D.
B) lg G.
C) Ig M.
D) lg E.
E) lg A
You have just finished a really long workout at the gym. You are sweating quite a bit and feel thirsty. You have lost a lot of water and some ions while sweating. In response to decreased Na+ in body fluids (Na+ depletion), your kidneys will _____ renin secretion. decrease increase stop
Answer:
increase
Explanation:
As water and ions are lost through exercise, overall blood volume can decrease. To maintain adequate blood volume and blood pressure, renin is secreted to help in the conversion of angiotensin I to angiotensin II. This will cause vessels to constrict and sodium and water to be retained by the kidneys.
Final answer:
The kidneys will increase renin secretion in response to decreased Na⁺ in body fluids. This is due to activation of the renin-angiotensin-aldosterone system, which restores Na⁺ balance and blood pressure by increasing aldosterone release, leading to reabsorption of sodium and water in the kidneys.
Explanation:
In response to decreased Na⁺ in body fluids (Na⁺ depletion), your kidneys will increase renin secretion. This is because renin activates the renin-angiotensin-aldosterone system (RAAS) which is crucial for regulating blood pressure and fluid balance. When there is a decrease in blood volume, blood pressure, or specifically, Na⁺ levels, the kidneys release more renin. This leads to the formation of angiotensin II, a potent vasoconstrictor that also stimulates the release of aldosterone from the adrenal glands.
Aldosterone plays a key role in directing the kidneys to reabsorb sodium, which in turn causes water to be reabsorbed, thus increasing blood volume and blood pressure. The responses to aldosterone help to restore Na⁺ balance and normalize blood pressure.
A computer crossmatch requires that an ABO phenotype be performed on the current specimen and a second phenotype must be performed or available for confirmation of the blood type. The recipient must be negative for clinically significant antibodies both with current sample and historically.
True / False.
Answer:
True
Explanation:
A computer cross match checks the compatibility of the final ABO in selecting units instead of serologic procedures.
The recipient must not have antibodies or history of it.
Barcodes are used in providing other safety measures. The computer provides the signal to show if the recipient is eligible or not for a computer cross match.
A computer cross match is a computerised way of analysing the compatibility of a donor's cell type with that of the serum or plasma type of the person receiving it. This process is aimed at ensuring that blood sample used for transfusion is compatible with that of the person meant to receive it.
Answer:
True.
Explanation:
Crossmatch or compatibility testing is basically performed to check the compatibility of donor blood (RBCs) to the recipient to prevent the transfusion reaction and to maximize the in-vivo survival of transfused RBCs.
Computer cross match is to counter check the donor blood sample phenotype and recipient phenotype along with any previous transfusion history with antibodies (recipient must not have antibodies against the phenotype of donor blood).
Another feature of computer crossmatch is bar coding. Bar codes detects the recipients eligibility or ineligibility for computer crossmatch by tagging or flag.
A nursing student is learning about newborn congenital defects. The defect with symptoms that include a shiny scalp, dilated scalp veins, a bulging anterior fontanelle, and eyes pushed downward with the sclerae visible above the irises is which defect?
Answer:
The correct answer is hydrocephalus.
Explanation:
The accumulation of fluid within the cavities deep inside the brain is termed as hydrocephalus. This fluid build-up enhances the size of the ventricles and imparts pressure on the brain. This condition eventually makes the head appear larger than normal with broadening cranial sutures. With the enlargement of the head, the distinction of suture lines takes place, creating the spaces through the scalp.
The skull increases in size, the anterior fontanelle bulges and becomes tense, and the dilation of veins takes place. In certain conditions, with more increase in pressure, the eyes seem to get pushed slightly downward and the sclerae appear over the irises.
A client has undergone scratch testing but the causative allergen is yet to be identified. what would be the next step to confirm a strongly suspected allergen?
Answer:
Begin intradermal testing
Explanation:
Begin Intradermal allergy testing is a skin testing tool that provides a strong reposne against any specific allergen.
The procedure involves injecting a small amount of the alleged allergens under the skin surface. The region is being checked for a reaction at the site after around 20 minutes.
As intradermal test are invasive, they will give quick response in comparison to scratch test which is unable to identify teh allergen.
Hence, the correct answer is Begin Intradermal testing.
Pathogenic bacteria that succeed in penetrating the wall of the large intestine into the blood circulation are removed or destroyed by
Explanation:
Polarized intestinal epithelial cells (IEC), as well as the resident microflora, provide a barrier that guards against microbial invasionThe necessity for the epithelium to maintain an intact barrier between lumen bacteria and the lamina propria is exemplified by the consequences after the barrier function is alteredImpairment of the barrier function of the intestinal epithelium may be a predominant mechanism in the pathogenesis of inflammatory bowel disease (IBD)