During most of the mesozoic era, earth was ________.
a. about as warm as present
b. cooler than present
c. warmer than present
d. experiencing wild temperature fluctuations

Answers

Answer 1
Mesozoic Era is the second of the Earth's major era geologically of the Phanerozoic time. It means middle life in Greek. The climate during this time was warm and had less difference in the temperature today thus the answer is a. About as warm as present.
Answer 2

Answer:

c. warmer than present

Explanation:

The Mesozoic Era (Meso = Middle and Zoic = Life) is marked by the emergence of dinosaurs and encompasses the period from approximately 250 to 65 million years ago. It is divided into three periods, from oldest to most recent: Triassic, Jurassic and Cretaceous. This era was warmer than the present.

Its onset is marked by a large mass extinction of unknown causes and the formation and fragmentation of Pangeia. The enhancement and extinction of dinosaurs is also a striking fact of this era called the “age of dinosaurs” because that was when they developed most. It is also in this Era that the first flowering plants and the first birds appear.


Related Questions

Water would be considered a _______.

Answers

Water is Considered a Compound, A liquid, and much more, but i would say if your answering a science question, thats all you need.  Water is formed when 2  Hydrogen atoms, bond to an Oxygen Atom!

                                                                              ~Hope this Helps, Journeyxo

Answer:

The answer is Water is a Chemical Compound.

Explanation:

Water is a compound that is formed from the union, by covalent bonds, of two hydrogen atoms and one of oxygen; Its molecular formula is H2O and it is a very stable molecule. Water is a fairly common substance on earth, where it is mainly in the form of steam or ice. It is essential for the origin and survival of the vast majority of all known life forms.

Which of the following describes convection? A. a cold swimming pool making a child cold B. a campfire cooking a fish hanging over the fire C. the Sun heating the Earth D. refrigerator coils keeping the refrigerator cold

Answers

Your answer would be  D. refrigerator coils keeping the refrigerator cold

If i have stress fracture of my radius bone what part of my body i have broken

Answers

you have broken one of your forearms.

In DNA, which of the following determines the traits of an organism?

Answers

The sequence of nitrogen bases

Answer: Nitrogenous Bases

Explanation:

The deoxy ribonucleic acid is made of nitrogenous bases, phosphate and deoxy ribose sugar.

The nitrogenous bases in the DNA determines the traits of the individuals which is carried from one generation to another.

These bases determines the type of protein which is produced. The A, T, G, C combines and forms triplet code and based on that protein synthesis takes place which decides the trait of the person.

the body loses water and satas in sweat explain why drinking large volumes of plain water after excersicing may affect the salta balance in the body

Answers

Sodium plays a critical role in balancing components of the body, and a lack of this element can become lethal if a large enough deficit is established. Losing salt through sweat reduces the concentration of Sodium in the body; however, drinking plain water dilutes what is left to a much larger degree (the loss of salt is accompanied by a loss of water, which keeps the concentration of Sodium in the body relatively constant), and this dilution causes consequences.

What did Watson and Crick’s model of DNA show?
A. two nucleotide strands wound in a double helix
B. sugars and phosphates on the inside
C. nitrogenous bases on the outside
D. a single nucleotide strand twisted in a spiral

Answers

Answer
The option A is correct, becuse their model shiw tha DNA is composed of two double strand of nucleotide which are twisted around each other and run in antiparallel direction. the phisphate group and pentose sugar are present on outside, while nitrogenous base is present on inside.

A is most definitely the answer

Which of these are properties of elliptical galaxies? Select all that apply. A. have several arms B. rotate relatively quickly C. can have various shapes D. appear similar from each side

Answers

D. Appear similar from each side
100% right

Answer:

D. appear similar from each side

Explanation:

Elliptical galaxies are a type of galaxy that have a spherical or ellipsoidal shape, and have no spiral-shaped structure. The vast majority of these galaxies have little gas, little dust and few young stars. More expressly, they look a lot like the nucleus and halo of spiral galaxies. Some are quite elongated and some very flat if viewed from Earth, however their shape is basically similar on each side.

About one third of the galaxies are elliptical in shape. Elliptical galaxies range in size from dwarf galaxies, often difficult to distinguish from globular clusters, to giant galaxies such as M70, a giant elliptical galaxy in the constellation Virgo.

Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3')? view available hint(s) where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3')? it would not bind the target dna. ttttagccatttacgattaatcg ttttagccatttacgattaatcg ttttagccatttacgattaatcg?

Answers

If the DNA sequence is: 5’  TTTTAGCCATTTACGATTAATCG  3’
The probe  5’ AATCG  3’ will bind for the CGATT part of DNA.
The two complementary strands of DNA are usually differentiated as the "sense" strand (5’-3’) and the "antisense" strand (3’-5’), meaning that they have different directions. According to this, the probe in antisense would be 3’ GCTAA 5’. 

Some structures related to fungi include hyphae and mycellium. Which statement BEST explains how these structures are related?
A) Hyphae hold mushrooms and other fungi upright by attaching to a mycellium.
B) Hyphae absorb water under ground and the mycellium absorbs water above ground.
C) Hyphae are long, threadlike structures that create a network called a mycellium.
D) Hyphae absorb nutrients from the soil that the mycellium converts into carbon dioxide.

Answers

hyphae are long threadlike structures that create a network called a mycelium

Answer:

The correct answer would be option C.

Mycelium refers to the vegetative part of a fungus which is formed by the mass of branching, thread-like hyphae.

It helps in the absorption of nutrients from the surrounding environment. The biological polymers are first converted or digested into monomers with the help of enzymes secreted by the hyphae.

These monomer units are then absorbed by the mycelium either through facilitated diffusion or active transport.

As a "rule of thumb" estimate, athletes who wish to increase muscle mass should increase daily energy intake by approximately ____ kcal.

Answers

As a "rule of thumb" estimate, athletes who wish to increase muscle mass should increase daily energy intake by approximately 400 to 500 kcal.

What is your preliminary idea(s) of the species of bacteria responsible for anna's infection?

Answers

Preliminary ideas are that the bacteria species is:
-Gram-negative
- Rod-shaped

After the Gram test, the bacteria that caused Anna's infection was pink, indicating that is Gram negative. 
Also if you look at their shape through a microscope, you see that the bacteria has a rod-shaped (also called a bacillus).

what do bottom dwelling fish,sponges and corals have in common

Answers

Bottom dwelling fish, sponges, and corals share common ecological interactions and relationships in marine ecosystems. Sponges provide shelter and nutrients to various species, including fish, while corals have symbiotic associations with algae called zooxanthellae. Bottom dwelling fish, like parrotfish, contribute to reef ecosystems through their feeding behavior, which aids in sediment production and nutrient cycling.

When westerners are asked to recall autobiographical memories, this part of their brain is activated. temporal lobe motor cortex medial frontal cortex occipital lobe?

Answers

The correct answer is medial frontal cortex.

Autobiographical memory is part of the explicit memory and it is a memory system which consists of episodes recollected from a person's life. It consists each person's sense of personal past history and present self. The part of the brain connected to this type of memory is the medial frontal cortex.

The medial temporal lobe, including the hippocampus and amygdala, is activated when recalling autobiographical memories, and is essential for memory storage and recall.

When westerners are asked to recall autobiographical memories, a key area of the brain that becomes activated is the medial temporal lobe. This part of the brain, along with structures such as the hippocampus and amygdala, is critical for the storage of memories. The case of patient HM, who had both medial temporal lobes removed, has provided substantive insights into the role of these brain structures in memory formation and recall. Specifically, the medial temporal lobe functions as the short-term storage site for memories, which over time, may relocate to other brain areas outside of the medial temporal lobe, indicating the involvement of a network of cortical and subcortical areas in memory processing.

Genetic disorders caused by multiple genes interacting with the environment are called

Answers

Multifactorial disorder

Multifactorial disorders are disorders that involve variations in multiple genes joined with environmental causes. Diseases such as heart disease, type 2 diabetes, and obesity are multifactorial disorder as they do not have single genetic cause but are caused by a combination of environmental factors and life style with mutations in multiple genes.






In a human eye, there are three types of cones that allow us to see colors. the three different types are most sensitive to red, green, and blue light, respectively. all three contain retinal bonded to a large protein. the way that retinal bonds to the protein can change the length of the potential well within which the electrons are confined. how would the length have to change from that given in the introduction to make the molecule more sensitive to blue or red light? view available hint(s)

Answers

The answer is ‘the molecule would have to be longer to be more sensitive to red light and shorter to be more sensitive to blue light.’The cones change shape and vary their length once they absorb a photon. This change is transduced, through biochemical pathways, into nerve impulse and carried to the brain.

To make the retinal molecule more sensitive to blue light, the potential well's length should be decreased. To make it more sensitive to red light, the potential well's length should be increased.

In the human eye, the three types of cones are sensitive to blue, green, and red light, corresponding to short, medium, and long wavelengths respectively. These cones contain retinal bonded to a large protein, and the way retinal bonds to the protein changes the length of the potential well within which the electrons are confined. To make the molecule more sensitive to blue light, the potential well's length must be decreased, as shorter wavelengths (blue light) require higher energy levels. Conversely, to make the molecule more sensitive to red light, the potential well's length must be increased to respond to longer wavelengths (red light) which have lower energy levels.

Thermal pollution kills fish primarily because _____.

all fish need cool water

fish eggs overheat

fish swim too close to pipes

warm water holds less oxygen

Answers

warm water holds less oxygen 

Answer:

Warm water holds less oxygen

Explanation:

Thermal pollution may be defined as the cahnge in the ambient water temperature that can degrade the water quality. Main cause of thermal pollution is the use of water as coolant in industries.

Thermal pollution is harmful for aquatic life. Fish and other aquatic organismsm dies because thermal pollution increases the temperature of water. This warm water has less ability to hold oxygen and fishes die due to the lack of oxygen in water.

Thus, the correct answer is option 4.

What is the purpose of the coronary artery and what results if there is blockage in this vessel ? cousrse hero?

Answers

Coronary arteries supply blood to the heart muscle, The left one, arises from the aorta and feeds blood to the left side of the heart and the right one supplies blood to the right ventricle, the right atrium, and the SA (sinoatrial) and AV (atrioventricular) nodes, which regulate the heart rhythm. Blockage in this vessel result in reducing the flow of oxygen and nutrients to the heart muscle and that can lead to a heart attack. Atherosclerosis and arteriosclerosis are the most common causes of heart disease.

Final answer:

The purpose of the coronary artery is to supply oxygen and nutrients to the heart muscle, while blockage in this vessel can result in severe pain and potentially a heart attack.

Explanation:

The purpose of the coronary artery:

The coronary artery supplies oxygen and nutrients to the heart muscle. It branches from the aorta and surrounds the outer surface of the heart like a crown, providing a steady blood flow that keeps the heart functioning properly.

Results of blockage in the coronary artery:

If there is a blockage in the coronary artery, oxygen supply to the heart muscle is stopped. This can lead to severe pain known as angina, and if the blockage is not treated, it can result in myocardial infarction, commonly known as a heart attack. The blocked artery prevents oxygen from reaching the areas of the heart that depend on it, causing damage to the cardiac muscle tissue.

"which of these contributes to the existence of monopoly power?"
a.the control of critical resources
b.legal barriers
c.patents
d.all of the above contribute to the existence of monopoly power.

Answers

i think the correct answer is A

Suppose nicole recently learned that she inherited a mutant brca1 allele from her mother, who had breast cancer. brca1 is a tumor suppressor gene that is related to breast cancer. why would nicole be at higher risk for getting breast cancer at an earlier age than her sister, tiffany, who inherited a normal brca1 allele from their mother?

Answers

The answer is a mutation in her normal.  Device of cancer caused by loss of BRCA1, BRCA2 gene function identified.  BRCA1 allele may lead to cancer, while a normal individual would have to acquire two mutations (one in each allele) to develop cancer.  

Answer:

Normal tumor suppressor gene controls excessive cell division

Explanation:

A normal tumor suppressor gene releases proteins that are essential to control and regulate the cell division. However, if this gene gets mutated then it may lead to uncontrolled cell division and hence forth cause cancer or tumor. Since Nicole got this mutant gene, hence her ability to suppress uncontrolled cell division does not work and hence she may get cancer as compared to her elder sister who received normal allele.

Evolution and selection what mechanisms lead to changes in the diversity of species on earth?

Answers

The answer is genetic drift and genetic shift. The former occurs when small changes occur in the genotype of a population that accumulates over time and changes the allelic frequency of the population. The latter (genetic shift) occurs abruptly and is usually caused by a bottleneck effect.

How do the number of muscles in a cow eye compare with that of a human eye, and what does this mean for each organism?

Answers

• there a 6 muscles (extralocular muscles) that control the movement of the human eye but a cow only has 4. therefore, they can look up, down, left and right but they cannot move their eyes in certain ways that humans can, such as rolling their eyes; humans are able to move their eyes in more directions.

Filtration and distillation are ____ methods for detoxifying hazardous waste. a inexpensive b chemical c natural d physical e biological

Answers

Filtration and distillation are D. Physical methods
Final answer:

Filtration and distillation are physical methods for detoxifying hazardous waste. Filtration is used to capture and remove microbes from samples while distillation works on the principle of different boiling points of substances.

Option D is correct

Explanation:

Filtration and distillation are physical methods for detoxifying hazardous waste. Filtration, as a method of physical separation, is commonly used in various applications. It utilizes filters, such as high-efficiency particulate air (HEPA) filters, to separate and thus remove microbes from samples. With effective pore sizes of 0.3 μm, these filters are capable of capturing bacterial cells, endospores, and many viruses. Thus, the air passing through these filters becomes nearly sterilized.

Distillation, another physical method, involves the process of heating a mixture to create vapor and then cooling that vapor to create a liquid. This method separates the components of a mixture based on their different boiling points. Both filtration and distillation are used outside of the laboratory setting, with applications ranging from the cleaning of surgical instruments to detoxifying hazardous waste.

Learn more about Detoxifying Hazardous Waste here:

https://brainly.com/question/34699974

#SPJ3

The Sun is the primary source of energy that drives all the biogeochemical cycles on Earth. Which statement best describes how the Sun’s energy powers the water cycle?

1.Plants require energy from the Sun to perform photosynthesis.

2.The Sun's heat reflects off ice sheets near the polar caps, reducing the overall temperature of Earth.

3.Heat from the Sun drives evaporation, turning water on Earth's surface into water vapor.

4.Energy from the Sun provides the warmth necessary for cold-blooded animals to survive.

Answers

It should be 3! That is the only logical answer to the question...

Answer:

3. Heat from the Sun drives evaporation, turning water on Earth's surface into water vapor.

Explanation:

Water cycle starts with evaporation of water from water bodies which includes transition of water into water vapor by heat of sunlight. The water vapor rises up in the sky and gets condensed to form clouds. This is followed by precipitation and collection of water into the water bodies again through surface run off. Hence, the very first step of water cycle, that is, evaporation is driven by energy from Sun.

All matter, must contain

Answers

All matter must have mass and take up space

Answer: Mass and Space.

Any object that occupies space and has some weight or mass is called matter. All matter is made up of atoms. Matter can be of different types based on the type of atoms it is composed of. Mass, color, shape and size are some physical properties of solid state matter. The matter can be present in all three states of solid, liquid and gas but in every state it occupies space and has mass. Few things which are not considered to be matter are electricity, light, sound, heat etc.

During which stage of sleep are the major postural muscles most relaxed

Answers

At The Middle Stage We Get More Pleasure........!!!!!!

Clostridium botulinum can result in paralysis. what food can potentially contain dormant spores and should not be fed to infants?

Answers

The answer is honey. It should not be fed to infants below the age of 12 months lest the child will develop botulism. When a child ingests the bacteria, they develop in their intestines and produce toxins that harm the baby.

In which kingdom are the organisms represented in the cartoon classified?

Answers

In protista kingdom the organisms are represented in cartoon classified

you can properly find algae____
- that conduct photosynthesis
- in polar regions or hot springs
- on your dinner plate
- all of the above

Answers

You can probably find algae in d) all of the above.
Like other plants, algae have chlorophyll. There are the so-called ice algae found in the polar regions while Thermophilic algae are abundant in hot springs. Edible seaweeds found in your plate are algae also. 

Most infants are physically ready to start eating solid foods when they
a. can sit up with some back support.
b. develop the swallowing reflux.
c. lose the let-down reflex.
d. have most of their primary teeth.

Answers

The correct answer is A.
The official guidelines from doctors state that infants should start consuming solid food after the age of six months. In order for the infants to be safe and healthy, they need to be able to sit up, support their back and chew safely before being given solid food. 

Final answer:

Infants are typically ready to start eating solid foods when they develop the swallowing reflex around 4-6 months of age.

Explanation:

Most infants are physically ready to start eating solid foods when they develop the swallowing reflex. This typically occurs around 4-6 months of age. The swallowing reflex allows infants to effectively consume and digest solid food, transitioning from a diet solely composed of breast milk or formula.

While sitting up with some back support is an important milestone in an infant's development, it is not the primary indicator of readiness for solid foods. Losing the let-down reflex, which is related to breastfeeding, is not directly linked to starting solid foods. Similarly, having most of their primary teeth is not a requirement for starting solid foods as infants can chew food with their gums.

The greenhouse effect is caused by the burning of fossil fuels and deforestation.
a. True
b. False

Answers

i think it's a. True

Answer:

False, the greenhouse effect is not caused by the burning of fossil fuels and deforestation.

Explanation:

The greenhouse effect is not caused by the burning of fossil fuels or deforestation. It was Global warming which is caused due to the burning of Fossil fuels and deforestation.The greenhouse effect is caused by the Trap heat from the sun. the greenhouse effect is important also because without this effect the earth's atmosphere becomes too cold and may cause problems to animals, plants, and Humans.

Other Questions
How many people were killed on the 9-11-2001 attack Which of the following climate zones typically is not found in midlatitude regions What is the geometry around the bottom carbon atom in acetonitrile? what is the geometry around the bottom carbon atom in acetonitrile? tetrahedral trigonal planar linear? List 3 ways taoism impacted chinese culture and values William jennings bryan supported the cause of __________ in the 1896 presidential election. Which does not describe a physical change happening to water? A triangle has sides with lengths: 6, 9, and 5. How do you find the area of the triangle using Heron's formula? The graph of linear equation A passes thru the points (-7,4) and (3,-10), while the graph of linear equation B passes thru the points (-7,4) and (5,11). which of these is a solution to the system of equations consisting of linear equation A and Ba. (-7,4)b. (3,-10)c. (5,11)d. (7,4)show work and i need really bad Your friend andre comes to school and tells you that he has a dislocated shoulder. based on what you now know about joints, what do you think this means? Plato and Aristotle had strong beliefs against _______ What is another significant process or event that occurred during Nixon's Administration? How did Nixon's involvement in the Watergate Scandal affect American politics? What is 1/9 of 63% of 6000 Aaron took three times as many pictures as jennifer.jennifer has 16 fewer pictures than aaron.which system of equations can be used to find the number of oictures each person took? Suppose a customer is the one who randomly selects and then purchases the four apples. if an apple is damaged, the customer will complain. to keep the customer satisfied, the store has a policy of replacing any damaged item (here the apple) and giving the customer a coupon for future purchases. the cost of this program has, through time, been found to be c Joy started with 2.75 gallons of milk. She used 1.5 pints to make mashed potatoes and another cup to make cookies. How much milk does Joy have left? Give your answers in three different way (using cups, pints, and gallons). SHOW WORK. Please please help quickly! I have been waiting for over a half our and still no one has helped!!! Please only answer if you KNOW you have the correct answer!!!Thank you so much in advance! In the 1970s, President Nixon began a program of dtente in an attempt to _____.Support Afghanistans fight against Soviet forcesIncrease American stockpile of nuclear warAchieve a decisive victory in the Vietnam warEase tensions with the Soviet Union and China Was the first major mexican-cuban crisis. was a direct attempt by the united states to remove fidel castro from power. was a direct attempt by the soviet union to launch a nuclear attack on america. brought the world to the brink of nuclear war, but eventually produced a lessening of cold war tension between the superpowers. caused several military confrontations between the superpowers in world "hot zones." What was the main reason for the opposition of the south to the election of abraham lincoln in 1860? When the United States was founded, who could vote?