During the 1920s, how did overproduction play a role in causing the Great Depression?


There were not enough products to satisfy consumer needs.
High tariffs kept goods from being sold to foreign countries.
There were not enough consumers to buy the excess goods.
It kept too many people employed longer than necessary.

Answers

Answer 1

Answer:

The Great Depression was a time of economic hardship in America. ... A main cause of the Great Depression was overproduction. Factories and farms were producing more goods than the people could afford to buy. As a result, prices fell, factories closed and workers were laid off.   Your Welcome!

Explanation:

Answer 2

Explanation:

The correct answer is 3. During the 1920s, there were not enough consumers to buy the excess goods, specifically in the real estate market. The construction of houses during the 20s exceeded the population growth by 25%.  To make matters worse, a large part of the population was unemployed. This meant that even fewer people could buy the goods that were produced in the country. In 1925 there were twelve milli


Related Questions

6. Analyze Causes What caused Japan to
institute a policy of isolation? Defend your
viewpoint with evidence from the text.​

Answers

Answer:

Explanation:

The Tokugawa shared Hideyoshi's suspicions that Christian missionary work could be a pretext for a future invasion of Japan by one of the European powers. In 1635, shogun Tokugawa Iemitsu decided that the only way to ensure Japan's stability and independence was to cut off almost all contact with other nations.

The policy of isolation in Japan, known as Sakoku, was primarily motivated by several key factors like: Internal Stability; Control of Foreign Influence; Concerns about Colonial Expansion; and Economic Protectionism.

These factors combined to shape Japan's policy of isolation or sakoku, which lasted from the early 17th century until the mid-19th century. The policy effectively restricted foreign contact, limited trade to a few designated ports, and restricted the activities of Japanese citizens abroad. However, it's important to note that the policy of isolation eventually ended in the 1850s with the arrival of Commodore Matthew Perry's expedition, which led to the opening of Japan to foreign trade and diplomatic relations.

Learn more about Sakoku here:

https://brainly.com/question/30604422

#SPJ6

The correct question might be:

Analyze Causes What caused Japan to institute a policy of isolation?

In the north many African Americans were :
A. Only able to buy houses in certain areas
B.the victims of lynch one and groups like the Ku klux klan
C. Unable to vote in national elections
D. Not facing any type of discrimination

Answers

Answer:

A: only able to buy houses in certain areas

Explanation:

Answer:

A. Only able to buy houses in certain areas

Explanation:

Hope this helps have a great day :D

“We… do… solemnly and mutually in the presence of God, and one of another, covenant and combine ourselves together into a civil body politic, for our better ordering and preservation.” Which of the following is a true statement about the quote? This is a quote from the Mayflower Compact and reflects the principle of self-government. This is a quote from the Magna Carta and reflects the principle of limited monarchy. This is a quote from Common Sense and explains why the American colonists should declare independence. This is a quote from the English Bill of Rights and describes the basic rights of all citizens.

Answers

The quote is from the Mayflower Compact and demonstrates the concept of self-government.

Answer:

i believe its the mayflower compact

Explanation:

i toke a test on it

What caused the Cold War to escalate during the post world war 2 period

Answers

Answer:

The release of two atomic bombs on Japan in August 1945 helped end World War II but ushered in the Cold War,

Explanation:

a conflict between the United States and the Soviet Union that dragged on nearly half a century.

Answer:

The Soviet Union and USA fought in the Cold War because USA was against communism and Soviet Union was based on communism. They didnt want to fight in a real war with bombs and nuclear weapons because they have just went through the horrible WW2. So instead they chose to "fight" with words. This soon led to the collapse of the Soviet Union.

Explanation:

Which best describes a result of the midterm election in 1994?

Answers

Answer:

b .

Explanation:

Answer:

Republicans won majorities in the House and the Senate.

Explanation:

What is the main idea of this passage? Sir Isaac Newton is the greatest scientist of this era. Light comes from the sun in fewer than seven minutes. The followers of Descartes know more than those who follow Newton. People still don’t understand how the world works.

Answers

Answer:

the answer is below

Explanation:

Which of the following best describes nativism?
a group's shared beliefs, values, and ways of life
the belief that the interests of native citizens should come bef
the act of separating one group from another group
a distinct group that lives or works together within a larger community

Answers

Answer: the belief that the interests of native citizens should come... bef?

Explanation: Nativism is protecting native citizens beliefs... this option makes the most sense given the definition of the word

Answer:

b is the answer

Explanation:

In what way can citizens pArticipate in the political process

Answers

Answer:

Voting.

Explanation:

We participate in political process by voting for presidents.

voting is a way citizens participate in the political process.

Which of the 13 colonies had the most slaves ?

Answers

The First Enslaved Africans:

Carolinas.

Virginia and Chesapeake bay.

New England.

New Jersey and New York.

Midwest, Mississippi River, Louisiana.

Florida.

Georgia.

The development of slavery in 17-century America.


DMS me if you need more help :)
Final answer:

Among the 13 colonies, the Southern colonies, especially those in the Deep South like Georgia, had significant numbers of both slaves and slaveholders. The largest slave market existed in New Orleans. Virginia was also known for its extensive use of slave labor.

Explanation:

The question addresses which of the 13 colonies had the most slaves. As evident from the historical data, the colonies in the South held a larger population of enslaved people due to the economic structure that heavily relied on plantation agriculture, which had a high demand for labor. Some northern colonies like New York and New Jersey also had a significant number of enslaved people, but the numbers continued to decrease due to a series of laws and court decisions.

Among the Southern colonies, Virginia was notorious for its extensive use of slave labor, which played a significant role in its economic activities. Moreover, New Orleans had the largest slave market in the United States, with enslaved people brought from various states to be sold for labor in the Mississippi Valley. Classic examples are the farms in states like Maryland, the Carolinas, and Virginia which relied on coerced labor from enslaved Africans. Deep South states like Georgia held larger numbers of both slaves and slaveholders, making them perhaps the most deeply entrenched in the system.

Learn more about Slavery in the 13 colonies here:

https://brainly.com/question/19511895

#SPJ2

Who were the Ottoman Turks?

1. A warrior people in Asia Minor
2. Nomadic herders from Central Asia
3. Balkan people who migrated south
4. A camel-riding, desert tribe from Arabia

Answers

Answer:

1 a warrior people in asia minor

The Ottoman Turks are warrior people in Asia Minor. Thus, the correct answer is option A.

Who are Ottoman Turks?

The Ottoman Turks were the Ottoman Empire's Turkish-speaking people. The "Ottomans" first became known to the West in the 13th century, when they migrated westward from Central Asia to Anatolia. The Ottoman Turks blocked all major land routes between Asia and Europe after crossing into Europe in the 1350s, coming to dominate the Mediterranean Sea, and invading Constantinople in 1453.

The Ottoman Empire, founded by Turkish tribes in Anatolia (Asia Minor), rose to become one of the world's most powerful states during the 15th and 16th centuries. The Ottoman Empire lasted more than 600 years and was replaced by the Turkish Republic and various successor states in southeastern Europe and the Middle East in 1922.

Therefore, Ottoman Turks are warriors belonging to Asia Minor.

To learn more about Ottoman Turks, click here:

https://brainly.com/question/2932768

#SPJ2

3.Why did business leaders begin the practice of vertical integration?

A.
Big companies could grow by merging with other companies or acquiring them.

B.
Factory workers could start in low positions and work their way up to management.

C.
Large corporations could control the cycle of a product from creation to sale.

D.
Small companies could grow so that they could compete with the larger companies.

11. Why did the Exodusters leave the South?

A.
to get jobs working on the railroad

B.
to start ranches for raising cattle

C.
to escape racism and violence

D.
to leave rural areas for eastern cities
13. How were people of Chinese and Hispanic backgrounds treated differently from each other in America in the late 1800s?

A.
The Chinese people could easily get high-paying jobs while Hispanics had some of the lowest paying jobs.

B.
Hispanics were allowed to become American citizens, but the Chinese people were not able to become U.S. citizens.

C.
Hispanics were not considered to be equal by most white settlers, while the Chinese were regarded as equal.

D.
The Chinese were forced to integrate into American society while Hispanics were allowed to maintain their culture.

Answers

Answer:

1. Correct answer is C) Large corporations could control the cycle of a product from creation to sale..

2. The correct answer is C) to escape racism and violence

3. The correct answer is B) Hispanics were allowed to become American citizens, but the Chinese people were not able to become U.S. citizens.

Explanation:

1. Andrew Carnegie was the first person who implemented the practice of Vertical integration through his company, Carnegie Steel. Due to this, he was able to monopolize the industry and control the whole value chain.

Today, this practice would be considered illegal.

2. During the reconstruction era and the implementation of Jim Crow laws, life for African-Americans was getting extremely difficult. To escape persecution and violence, there was a mass immigration towards Northern States and these people were called Exodusters,

3. After the end of the American-Mexican war, over 75,000 Hispanics living in American annexed land were offered citizenship. A majority of of them accepted and stayed in the US. This was in stark contrast to the Chinese immigrants who were not given this right.

How does the author describe the impact of the convention?

Answers

The International Convention on the Rights of Persons with Disabilities stands as the inaugural international document of the 21st century.

The reason for the convention

Formulated with input from politicians, non-governmental representatives, and individuals with disabilities, its primary objective is to secure equitable rights and a fulfilling life for individuals with disabilities within their communities.

This convention prioritizes equality as a fundamental tenet of democratic societies. Its architects aim to eradicate all forms of discrimination faced by persons with disabilities, striving for a society where every individual is recognized and valued without prejudice.

Question

In the convention bosses How does the author describe the impact of the convention?


What were the Enforcement Acts?
A.
Acts proposed by Grant but opposed by Congress to enforce the provisions of the Thirteenth Amendment
B.
Acts recommended by Grant and imposed by Congress to try to enforce the provisions of the Thirteenth, Fourteenth, and Fifteenth Amendments
C.
Acts recommended by Grant and imposed by Congress to try to protect black voters from intimidation and violence
D.
Acts imposed by Congress over Johnson's objections to ensure that blacks were afforded equal opportunities in education
E.
Acts imposed by President Johnson to enforce the provisions of the Wade-Davis Bill

Answers

Answer:

C. Acts recommended by Grant and imposed by Congress to try to protect black voters from intimidation and violence

Explanation:

The Enforcement Acts were three bills passed by the United States Congress between 1870 and 1871 under the presidency of Ulysses S. Grant. They were to protect African-Americans’ right to vote, to hold office, to serve on juries, and to receive equal protection of laws.

Which branch of the federal government did John Jay participate in?

Answers

Answer:

Executive as Secratary of State (foriegn affairs at that time) and Judicial as the chief justice of the supreme court.

Explanation:

Answer:

The Judicial branch.

Explanation:

John Jay was one of the Founding Fathers of American and an influential stateman. Although he was offered the position of Secretary of State in 1789, which is part of the Executive Branch, Jay never served as one because he declined the offer, but he then was offered to be the first Chief Justice of the United States, which is the highest-ranking position of the Judicial Branch, and he accepted it. In this position, he served from 1789 to 1795.

when did feudilism begin?

a) before the Viking, Magyar, and Muslim invasions.
b) during the period of Viking, Magyar, and Muslim invasions.
c) shortly after the period of Viking, Magyar, and Muslim invasions.
d) long after the period of Viking, Magyar, and Muslim invasions.​

Answers

Feudalism began during the period of Viking, Magyar, and Muslim invasions.

The answer is B) during the period of Viking, Magyar, and Muslim invasions.

(5 questions-50 points;only answer if u KNOW ALL 5 plz! Thanks in advance:)
Question 1-
One of several elements taken from the Northwest ordinance that would eventually be implemented in the U. S. Constitution was a requirement of state governments. What kind of government were states required to have?
A- dictatorship
B- federalist
C- republican
D- confederacy
Question 2-
In the American declaration of independence, which of the following is true?
A- independence is declared using violation of the social contract as one of the justifications
B- loyalty to great Britain is supported through the document
C- contract are legalized for new commercial contracts with the far east
D- colonists lay out plans for a revolt against Spain
Question 3-
Enlightenment philosophers believed that the power of goverment should lie in the hands of the people, not with an all powerful ruler like a dictator or a monarch. these new ideas inspired citizens of that time period to do which of the following?
A- revolt against democracies to form governments
B- revolt against absolute rulers to form governments
C- ask for religious dictatorships in place of kings and queens
D- remain firm in their support of monarch
Question 4-
Which of the following documents would be a primary source you could use to research the first government of the united states?
A- declaration of independence
B- U. S. History book
C- articles of confederation
D- Magna carta
Question 5-
Under the articles of confederation, the greatest amount of government decision making power was given to:
The national/federal government?
The president?
Regular citizens?
The states?

Answers

Answer:

First one is A

Second one is A

Third one is B

Fourth one is A

Hope this helps :)

Explanation:


In the late 1800s, where did most European immigrants live in the United States?
on large farms
just outside obes
in small towns
C

Answers

Answer:

in small towns

Explanation:

its the 1800's  most likely small towns im only basing this off movies ive seen unless large cities is a choice id go with that one

Answer: B. In large cities

Explanation:

Nativism is the political position of demanding a favored status for certain established inhabitants of a nation as compared to claims of newcomers or immigrants.

Based on their beliefs, which legislation would have been supported by Nativists of the late 1800s?
A)the Dawes Act of 1887
B)the Chinese Exclusion Act of 1882
C)the Southern Homestead Act of 1866
D)the Sherman Anti-Trust Act of 1890

Answers

Answer:B) Chinese Exclusion Act of 1882

Explanation:

The Chinese Exclusion Act of 1882 is the legislation would have been supported by Nativists of the late 1800s. Hence, option B is correct.

What is Chinese Exclusion Act of 1882?

The Chinese Exclusion Act was a federal statute that President Chester A. Arthur signed on May 6, 1882, prohibiting the immigration of any Chinese labourers for ten years. The law did not apply to traders, teachers, students, tourists, or diplomats.

In the spring of 1882, President Chester A. Arthur signed the Chinese Exclusion Act after it had been enacted by Congress. This law placed a ten-year absolute ban on Chinese labourers entering the nation.

The Chinese Exclusion Act of 1882 prohibited Chinese immigrants from obtaining citizenship and stopped Chinese immigration for ten years in an effort to reduce the number of Chinese immigrants entering the United States, notably in California.

Thus, option B is correct.

For more details about Chinese Exclusion Act of 1882, click here:

https://brainly.com/question/513896

#SPJ6

What was the main reason railroad lines expanded in the south during the late 1800s

Answers

Answer:

natural resources

Explanation:

Mainly Natural resources to help out the Nothern part of america and they transferred things such as metals, coal, and other materials, also was a good source of transportation. The rail roads were also used by the south and north to transport ammunition and resources such as food clothing tents and barricades in the Civil War Era.

1.Which was an impact of the United States acquiring the Oregon Territory?

A.It created more territory that allowed slavery.
B.It opened trade routes to the Pacific.
C. It strengthened Democrats' control of the presidency.
D.It led to war with Mexico.
2.What was a problem antebellum education reformers were trying to solve?
A.School days were long and interfered with agriculture work.
B.Curriculum was limited and outdated.
C.Free public schools were outlawed and unconstitutional.
D. Schools were segregated and unequal.



3.Identify transcendentalist beliefs. Drag the correct items into the box. Items may be used once or not at all.

1.It is important to follow the crowd.

2. Emotions are more important than rationality.

3. Nature should be celebrated.

4.Understanding of the world should be based on facts.

which ones goes with transcendentalist beliefs (has more than one answer)


5.How did the Supreme Court’s decision in Scott v. Sandford affect the issue of slavery in the United States? Select the two correct answers.

A. It decided the issue in favor of slavery permanently.
B.It invalidated the Missouri Compromise.
C.It put the issue of slavery into the hands of voters in each new territory.
D.It provided protections for enslaved people who were brought to free states.
E. It ruled that African Americans could not be considered citizens of the U.S.



5.The Republican Party was formed in 1854 as a response to what?
A.the Dred Scott Supreme Court decision
B.the Kansas-Nebraska Act
C.the Lincoln-Douglas debates
D. the raid on Harpers Ferry

Answers

Answer:

i cant asnwer all of this but i can answer some and if your from Conexus ima tell you go to the LL recording from today

1 is B

2 is B

3 i cant asnwer

5 is c and e

5 is B

Explanation:

the LL explains all

Final answer:

The acquisition of the Oregon Territory opened more trade routes to the Pacific. Transcendentalists believed in the importance of emotions and the celebration of nature. The Supreme Court decision in Scott v. Sandford invalidated the Missouri Compromise and ruled that African Americans could not be citizens. The Republican Party was formed in response to the Kansas-Nebraska Act.

Explanation:

In regard to the impact of the United States acquiring the Oregon Territory, option B is correct. The acquisition of this territory opened additional trade routes to the Pacific. For question 2, the principal issue antebellum education reformers were trying to address was the limited and outdated curriculum, so answer B is accurate.

For question 3, the transcendentalist beliefs are represented by points 2 and 3: emotions being more important than rationality and the celebration of nature. Moving on to question 4, the Supreme Court's decision in Scott v. Sandford negatively affected the slavery issue in the United States by not only invalidating the Missouri Compromise but also ruling that African Americans could not be considered U.S. citizens. The correct answers for this question are therefore B and E.

Lastly, for question 5, the formation of the Republican Party in 1854 was a response to the Kansas-Nebraska Act, so the correct option is B.

Learn more about U.S. History

https://brainly.com/question/13223724

#SPJ1

Which of the following statements best defines federalism?
O Astate government has little power compared to that of the central government.
O State and national governments have certain powers but share no powers.
OTwo or more governments have power over the same people in the same territory.
0 A state government can make laws that conflict with those of the central government.
Question 2

Answers

The answer is C, two or more governments have power over the same people in the same territory.

Final answer:

Federalism is a system of government where a central government shares certain powers with different lower level governments. The statement that best defines this is: Two or more governments have power over the same people in the same territory.

Explanation:

The statement that best defines federalism is: Two or more governments have power over the same people in the same territory. Federalism is a concept in political science where a central government shares certain powers with different lower level governments, such as state or local governments. It is a system of government where the same territory is controlled by two levels of government. The national government is responsible for some policies, laws, and matters that affect the whole country, while the state governments manage more localized issues.

For instance, the U.S. federal government has the power to regulate trade between states and with other countries, declare war, and establish post offices. On the other hand, state level governments, such as those in California or Texas, have the power to regulate education within their states, issue licenses (such as driver's and marriage licenses), and regulate intrastate commerce.

Learn more about Federalism here:

https://brainly.com/question/38529260

#SPJ2

Which of the following state capitals is east of arkansas

Answers

Answer:

Nashville, Tennessee is east of Arkansas

Explanation:

Answer:

Nashville, Tennessee

Explanation:

At the height of its power, which government controlled the shaded area?
A
the Delhi Sultanate

B
the Great Yuan

C
the Gupta Empire

D
the Maurya Empire

Answers

Answer:

the Delhi Sultanate

Explanation:

i just had the same problem

Answer:

C. the Gupta Empire

Explanation:

The Gupta Empire is the empire that is shown in the grey area in the map shown, the Gupta Empire in its maximum power covered that whole area and was around the 450 CE it was the main empire in the indian sub-continent in those years, the Gupta empire eventhough had those borders the main concentration of population was located at the eastern part of the empire.

What were the differences and similarities between between the two u.s. immigration centers

Answers

Answer:

The largest similarity is that both immigrants in the 1900's and today come to the United States for economic improvement. The largest difference between immigrants of the 1900's and today is the countries they come from.

In comparison to immigrants who arrived between 1865 and 1895, more immigrants in the 1840s and 1850s arrived with cultural habits that were comparable to those of Americans.

What are the differences in u.s. immigration centers?

Between 1940 and 1970, 4.3 million African Americans left the southern United States; this exodus is referred to as the Second Great Migration.

African Americans' migration to the north during the early 1900s marked the beginning of the first Great Migration.

Older immigrants from southern and Eastern Europe frequently came to the country well-off, educated, and skilled. Most recent immigrants were low skilled and typically from Northern and Western Europe.

The biggest resemblance between immigrants in the 1900s and today is that they both come to America to advance their economic situation.

Therefore, The countries that immigrants now and those of the 1900s come from differ greatly.

Learn more about immigration centers here:

https://brainly.com/question/13926814

#SPJ2

An example of a pull factor would be

Answers

A pull factor is a positive attribute that entices people to move to a new area, such as the availability of jobs, higher wages, and better services.

An example of a pull factor would be the greater availability of jobs, which entices people to move to a specific area. Pull factors play a significant role in migration decisions, as they are the positive aspects that attract individuals to relocate. Other examples of pull factors include higher wages, better life opportunities such as upward economic mobility, superior government services, and lifestyle enhancements. For instance, someone might be drawn to a city with a booming tech industry for the potential career opportunities, which is a classic pull factor.

What profession did Catherine Beecher believe women should enter?

A. Teaching
B. Business
C. Politics
D. Nursing

Answers

Catherine Beecher believed that women should enter the teaching profession. She played a pivotal role in the feminization and professionalization of teaching during the 19th and early 20th centuries. Beecher's views contributed to the perception of teaching as a missionary calling for women, with limited pay and advancement.

Catherine Beecher believed that women should enter the profession of teaching. As an advocate for women's education and their role as educators, Beecher became an instructor at a normal school, which was a precursor to modern-day colleges and schools of education. Her work emphasized the importance of women in shaping the moral and intellectual character of children, as she saw the family and especially the home as central to maintaining the moral compass of society.

The teaching profession expanded significantly in the early 20th century, with women outnumbering men in terms of high school graduation and nearly achieving parity in college education. Despite the growth of professionalization in teaching, it remained largely feminized and was viewed by many as a missionary calling rather than an academic pursuit, which rationalized lower pay and fewer advancement opportunities for female educators.

Which are acceptable reasons for studying history?
Select all correct answers.


A It shows us what it means to be human.

B It promotes a single culture for the world.

C It shows that our civilization is better than others.

D It makes us better thinkers

Answers

Answer:

A and D

Explanation:

B and C are more opinionated

The Erie Canal was built primarily by which immigrant groups?​

Answers

they Irish immigrants

The Erie Canal was primarily built by Irish immigrants and also involved Italian and German immigrants in its construction.

The Erie Canal was primarily built by Irish immigrants who played a significant role in its construction. They provided labor for tasks such as digging, building locks, and creating an essential waterway.

Italian immigrants also contributed to its construction, taking on various roles in agriculture, mining, and the building trades along the canal route.

German immigrants were part of the later wave of immigrants who played a role in its expansion into the late 19th and early 20th centuries.

Why isn’t there just one history.?

Answers

Answer:

Cause, it most likely started by making root histories. Example in like world history they only highlighted the history from Europe and surrounding countries. In American history they highlighted the history from the ones that came over from Europe.What they failed to do is recognize other culures, like African-American history, Mexican American history, or Asian history. (Sorry if I missed anyone) And now all of these histories are available.

It would be almost impossible but it would be wonderful if someone would put all those different histories into the world and or American history. That way you get a broad idea of what people had to do, what they lived through, their accomplishments in society, or to the world. This would stop the stereotypes, and lies we are told regarding other races, and or cultures. It would certainly bridge many gaps that we see in the world today. It would also help all of us to know each other better.

Explanation:

Why do you think Western historians designate the ENTIRE historical period "The Dark Ages" when Regions in Asia, the Americas, and Africa continued to flourish?

Answers

Medieval age lasted for more than thousand years. The medieval age is formerly proclaimed to be Dark Age not because it was dark but because nothing was known.

After the collapse of Greek and Roman civilizations, the whole of Europe came under the supremacy of the churches at that which gained control. It was called as nothing was known or studied about the political structure that prevailed during that period.

Dark Age does not actually refer to the time when people spent much of their time in darkness. It simply means that nothing came into light from the period when great civilizations came to an end.

Other Questions
Molteni Motors Inc. recently reported $3.25 million of net income. Its EBIT was $6.25 million, and its tax rate was 35%. What was its interest expense? (Hint: Write out the headings for an income statement and then fill in the known values. Then divide $3.25 million net income by 1 T = 0.65 to find the pre-tax income. The difference between EBIT and taxable income must be the interest expense.) Enter your answer in dollars. For example, an answer of $1.2 million should be entered as 1,200,000. Round your answer to the nearest dollar. What are the three main types of money?A) credit, commodity, representativeB) fiat, commodity, creditC) representative, credit, fiatD) commodity, representative, fiat How much exercise should teens do daily Fiona shares an office with her exminushusband. Her share of the rent and utilities is $625 per month. She is considering moving to a home office which she will not have to share with anyone. The home office will not cost her anything as far as extra rent or utilities. Recently, you ran into Fiona at the gym and she tells you that she has moved into her home office. Fiona is as rational as any other person. As an economics major, you rightly conclude that ______ Can someone help me with this problem? It has to be in PEMDAS order. 16+(4*2/2)-4 I think it's 18 but I'm not sure The bases of one of the strands of DNA in a region where DNA replication begins are shown here. What is the sequence of the primer that is synthesized complementary to the bases in bold? (Indicate the 5' and 3' ends of the sequence.) 5' AGGCCTCGAATTCGTATAGCTTTCAGAAA 3' what is 3.149 rounded to the nearest hundredth What did the Gestapo and SS do? What is different about the number of course options kids get in virtual schools compared to typical schools? I don't know how to solve this: In a pair of complementary angles, one angle measures 18* less than three times the other angle. Find the measure of each angle. Explainthe benefits a recursive algorithm can provide. Usean example from a process in your organization or with which you are familiar. The square of the product of 4 and a number is the sum of the number and 15 Deshawn fuels 2 yachts and 6 barges. Each boat gets 126 gallons of fuel. To find out how much fuel he needs for all boats, deshawn first finds the number of boats, then he uses an algorithm to multiply. Which are the three partial products deshawn could add to find the final product? a valueable preserved biological specimen is weighed by suspeding it from a spring scale. it weighs 0.45 N when it is suspendedin air and 0.081 N when it is suspended in a bottle of alchol what is its dencity? Mantle convection is a process of that creates circular currents in the asthenosphere. As a result, the plates slowly move. Which of the following statements about DNA structure is true? View Available Hint(s) Which of the following statements about DNA structure is true? The nucleic acid strands in a DNA molecule are oriented antiparallel to each other, meaning they run in opposite directions. Hydrogen bonds formed between the sugarphosphate backbones of the two DNA chains help to stabilize DNA structure. Nucleic acids are formed through phosphodiester bonds that link nucleosides together. The pentose sugar in DNA is ribose. You have been assigned to make a recommendation about whether to build a factory manufacturing facility in Arkansas or New Jersey. Average production is estimated at 60,000 units per year. Estimations for cost factors were observed by obtaining cost data over the past year. Fixed costs including the financing of building and equipment, property taxes and insurance as well as overhead staff. Variable costs include repair product development, direct labor, shipping in and out. Our analysis indicated the following costs: Arkansas New Jersey Fixed $3,753,000 $2,221,000 Variable $52.73 $74.99 The difference in cost for production between New Jersey and Arkansas when manufacturing 75000 units is "Which of the following assumptions means that money is the common denominator of economic activity and provides an appropriate basis for accounting measurement and analysis?a. Monetary unit.b. Periodicity.c..Economic entity.d. Going concern." Horton Co. was organized on January 2, 2014, with 500,000 authorized shares of $10 par value common stock. During 2014, Horton had the following capital transactions: January 5-issued 375,000 shares at $14 per share. July 27-purchased 25,000 shares at $11 per share. November 25-sold 18,000 shares of treasury stock at $13 per share. Horton used the cost method to record the purchase of the treasury shares. What would be the balance in the Paid-in Capital from Treasury Stock account at December 31, 2014? Layla works during her meeting to pull together the ideas of her committee members into a coherent whole. Layla is performing a ___________ role.a.Maintenanceb.Relationship-orientedc.Taskd.Social