During which decade did transcontinental rail service begin in the United States?
A.1850–1860
B.1860–1870
C.1870–1880
D.1880–1890

Answers

Answer 1
The answer would be B) 1860-1870.
Answer 2

Answer:

B

Explanation:

Edge 2021

Have a nice day lovelies!! <3


Related Questions

The first wave of immigrants to the United States was largely leave from the northern and central Europe where did most of the second wave of immigrants come from

Answers

Most came from Ireland and Germany

Answer:

southern and eastern Europe

Explanation:

Which is an example of an expressed power Congress holds?
a:creating a national banking system
b: taking away the right of habeas corpus
c: declaring war and maintaining a military
d: adding and removing constitutional amendments

Answers

declaring war and maintaining a military

the correct answered its c

What organization helped 19th century farmers in the same way that unions helped industrial workers?
A. The Department of Agriculture
B. The Department of Husbandry
C. The Grange
D. The Open Range What organization helped 19th century farmers in the same way that unions helped industrial workers?
A. The Department of Agriculture
B. The Department of Husbandry
C. The Grange
D. The Open Range

Answers

 A. The Department of Agriculture

The correct answer for this question would be option A. The organization that helped 19th century farmers in the same way that unions helped industrial workers is the United States Department of Agriculture. Hope this is the answer that you are looking for. 

Beginning about 1890, approximately twenty states enacted segregation laws. What effect did they have? Select all that apply.Beginning about 1890, approximately twenty states enacted segregation laws. What effect did they have?

A. People of Oriental descent could immigrate freely, but not people of Mexican descent
B. They enforced compulsory segregation of people along racial lines so African Americans couldn't swim in the same swimming pools as whites.
C. People of Native American descent were denied a public education and in many cases forced to attend boarding schools to wipe out any trace of Native American heritage.
D. It meant that people of Mexican descent could not eat with people from other ethnic backgrounds.
E. It resulted in the "separate but equal" policy that was eventually ruled unconstitutional.

Answers

B. They enforced compulsory segregation of people along racial lines so African Americans couldn't swim in the same swimming pools as whites.

C. People of Native American descent were denied a public education and in many cases forced to attend boarding schools to wipe out any trace of Native American heritage.

E. It resulted in the "separate but equal" policy that was eventually ruled unconstitutional.

The policies aimed at African Americans are probably more well known.  But the policies aimed at Native Americans should not be overlooked either.  The  the U.S. government pushed many thousands of Native American children to attend “assimilation” boarding schools in the late 19th century.  Boarding schools followed early history of attempts to kill or remove Native Americans. The new method was to try to teach them to be more like white people.  So these were "segregation" laws in sort of a reverse direction, trying to make it impossible to remain a Native American and become like a "proper" American.

(B.),(C.) and (E.)

On Odyssey :)

The earth is spherical in shape.

True
or
False

Answers

The earth is a sphere, true

Which of the following geographic features affected the Battle of Yorktown during the American Revolution?
Yorktown’s location on a ridge
Yorktown’s location in the Adirondack Mountains
Yorktown’s location near the Pacific Ocean
Yorktown’s location on a peninsula

Answers

Yorktown’s location on a peninsula

Answer:

The correct answer is "Yorktown’s location on a peninsula".

Explanation:

On 1781, as part of the American Revolution, General George Washington commanded a force of 17,000 French and Continental troops at Yorktown, in what is known as the Battle of Yorktown. The siege that George Washington achieved was achieved greatly because of Yorktown's location on a peninsula, because most of  Washington's forces entered by ships and flotillas.

A production method in which workers repeatedly perform one task in the manufacturing processs is called

Answers

That's called an assembly line. 

How did helping the Taliban defeat Russia during the Afghanistan War help the Taliban in their efforts to resist United Nations forces today?

Answers

In order to help them defeat Russia, the US supplied the Taliban with weapons and training. That training and better weapons allows them to resist the forces of the UN today.

Thank you for posting your question here at brainly. I hope the answer will help you. Feel free to ask more questions.

Helping the Taliban defeat Russia during the Afghanistan War provided them with combat experience, tactical knowledge, and access to weapons, which they use to resist United Nations forces today.

During the Soviet-Afghan War (1979-1989), the mujahideen, which included the precursors to the Taliban, received substantial support from the United States, Pakistan, and other countries that sought to counter Soviet influence.

This support included training, weapons, and funding. The mujahideen employed guerrilla tactics effectively against the Soviet military, which was larger and better equipped. The tactics and strategies developed during this period, such as the use of hit-and-run attacks, improvised explosive devices (IEDs), and the exploitation of difficult terrain, have been instrumental in the Taliban's ability to wage a prolonged insurgency. Additionally, the networks and relationships established during the anti-Soviet resistance have been crucial for the Taliban in terms of logistics, recruitment, and financial support.Moreover, the Taliban have been able to draw on the narrative of having successfully expelled a foreign superpower from Afghanistan, which bolsters their legitimacy and appeal among certain segments of the population. This narrative of resistance against foreign occupation resonates with their current efforts to expel international forces, including those sanctioned by the United Nations.The Taliban's decentralized command structure and their deep roots in local communities also contribute to their ability to sustain their resistance. They have adapted to changing circumstances and have proven to be a formidable force, despite the presence of international troops and United Nations peacekeeping efforts.

In summary, the Taliban's success in resisting the Soviet Union provided them with valuable experience, tactics, and networks that have been instrumental in their ongoing resistance against foreign forces, including those of the United Nations.

How did Southern states’ laws under Reconstruction affect freed enslaved persons?

Answers

They had very little rights, such as not being allowed to own land

Answer:

During Reconstruction, Southern states passed the Jim Crow laws, with the aim of restricting African American rights in their territories.

Explanation:

The Jim Crow Laws were a series of ordinances and bylaws promulgated generally in the southern states of the United States between 1876 and 1965. These laws, which constituted one of the major elements of racial segregation in the United States, distinguished citizens according to their race and, while admitting their equality of rights, they imposed segregation of rights in all public places and services.

The largest ones introduced segregation into schools and most public services, including trains and buses.  School segregation was declared unconstitutional by the United States Supreme Court in 1954 in the ruling in Brown v. Board of Education. The other Jim Crow Laws were abolished by the Civil Rights Act of 1964.

who played an important role in writing and interpreting the history and traditions of the Ethiopian kingdom?
A) artisans
B) Mansa Musa
C) monks
D) merchants

Answers

The answer is C) monks. 

I would say C.

Really hope this helps!

Translating hieroglyphs is the most accurate way to understand the political and economic system of the Mayans?
True or false

Answers

It is false. I did it right now and I got it correct.

which of the following marked the end of the Spanish American war

Answers

The Treaty of Paris which was signed in Paris in 1898 officially ended the Spanish-American War. As part of the agreement the United States also gained control of former Spanish colonies in the Philippines, Guam, and Puerto Rico.

Treaty of Paris marked the end of the Spanish-American War.

Further Explanation:

The Treaty of Paris was the solution to the war and many clauses were favoring the United States as they got control of Cuba temporarily and also got full authorities of Puerto Rico and Guam along with Philippine Island. This setback was considered a big beating for Spain as the citizens of Spain started a revolution against the government which was also known as Generation of 98.  

The Spanish-American war was an armed battle between Spain and the United States during the year 1898. The main cause for this war was related to Cuban Independence. Revolutions were taking place from many years by Cubans against Spanish rule and after some time these revolts received the aid of the United States and it resulted in Spanish-American War. The war lasted for around ten weeks and was battled in the Caribbean and Pacific. After the interference of the  Naval forces in the battle, Madrid ordered for his modern fleet back to guard Spanish borders after the attack on two Spanish Naval ships by the US Navy.  

Learn More

1. how did alexander hamilton and James madison view the constitution?https://brainly.com/question/1320793

2. In their tv and radio advertisements, many car companies of the 1950s promoted?

https://brainly.com/question/4987782

3. in a parliamentary system of representative democracy, the prime minister is appointed by the monarch. is elected by representatives chosen by the people. is the leader of the party that won the most seats in parliament. is elected directly by the people?https://brainly.com/question/477236

Answer Details

Grade: High School

Subject: History

Chapter: Spanish-American War

Keywords: United States, Spain, Spanish-American War, Navy, Puerto Rico, Guam, Philippine Island, US Marine, Cuba, Treaty of Paris, Philippine Island, Generation of 98

Which statement explains how McCarthyism affected domestic policy in the 1950s?
a. Immigration restrictions were expanded as fears of communist infiltration from Soviet bloc nations spread.
b. Republicans were unable to balance the budget because of McCarthy's costly investigative methods.
c. New Deal reforms were rolled back as liberal supporters of these reforms were attacked as communists.
d. Individual rights were expanded as politicians sought to show how the United States differed from the communist world.

Answers

its A because McCarthy was afraid of the up rise in communism during the 50's 


Answer:

its a

Explanation:

Why did slavery continue after the Revolution?

A. Slave labor was important to the New England economy.
B. British, Loyalists, and Patriots all agreed that liberty did not extend to slaves.
C. The colonial government encouraged manumission.
D. The Southern plantation economy depended on slavery.

Answers

After the Revolution, slavery continued due to the large economic incentives associated with this institution.

In the north, slavery was an important part of the economy in New England and the North. By the late 18th century, slavery had become a major part of New England’s economy, with many families generating income by trading slaves. In the south, slavery was just as central to the economy. Many of the plantation economies relied heavily on slavery to produce high yields of crops, such as cotton and tobacco.

Additionally, the majority of the British and American population agreed that the concept of liberty did not extend to slaves. The colonial government encouraged manumission, but it was not a priority until the end of the Revolution. By this time, slavery had become so deeply entrenched that it was hard to eliminate it. Therefore, despite the fact that the Revolution brought with it a new era of freedom and liberty, many Americans continued to support and exploit the institution of slavery.

To know more about Revolution, click here:

https://brainly.com/question/29158976

#SPJ6

Final answer:

Slavery continued after the Revolution mainly because the Southern plantation economy was heavily reliant on slave labor, especially for cotton production. Despite ideas of liberty and equality, economic interests and societal justifications maintained the system of slavery, particularly in the South.

Explanation:

Slavery continued after the Revolution primarily because the Southern plantation economy depended on slavery. The lucrative cotton crop and other labor-intensive agricultural practices required a significant labor force, which was provided by enslaved people. While the rhetoric of the American Revolution included ideals of liberty and equality, these did not extend to African Americans, enslaved or free. The economic benefits of slavery for the Southern states, and to some extent the Northern shipping industry, outweighed the emerging abolitionist sentiments of the time. Additionally, many Southern white individuals used paternalistic justifications to maintain and defend the institution of slavery as a benevolent and necessary system.

Despite some Northern states adopting gradual emancipation after the Revolution, Southern states renewed their commitment to race-based slavery, driven by economic dependence on slave labor. This was exacerbated after the invention of the cotton gin in the 1790s, which significantly boosted the demand for slave labor in cotton production. The pivotal role of slavery in the American economy, particularly in the South, cannot be overstated—slavery and cotton were central to the economic success of the nineteenth-century United States.

Moreover, as the new federal government expanded democratic rights for white men, the preservation of slavery underscored the contradiction within the nascent republic. Some individual manumissions followed the Revolution, but widespread emancipation did not occur, especially not in the South where economic reliance on slavery continued to grow.

Help Me Plz!!!!!!!!!!!
Two prominent groups that came to America from Asia were the Chinese and the _____.

Japanese
Vietnamese
Mongols
Laotians

Answers

The correct answer is the ''Japanese''.

The two prominent groups from Asia that immigrated to America are the Chinese and Japanese, both of which faced substantial discrimination, including the Chinese Exclusion Act and the internment of Japanese Americans during World War II.

The two prominent groups that came to America from Asia are the Chinese and the Japanese. Asian Americans, including Chinese and Japanese immigrants, have made significant contributions to the United States, despite facing racial prejudice and legislative discrimination like the Chinese Exclusion Act of 1882. This act was prompted by white workers blaming Chinese immigrants for taking their jobs, leading to severe restrictions on Chinese migration and the rights of those already in America. Moreover, during World War II, Japanese Americans faced internment solely based on their heritage, highlighting the discriminatory challenges faced by Asian communities in America.

The Preamble of the United States is one of the most important introductions ever written in United States history, however it can be difficult for some citizens to fully understand. Rewrite the Preamble in your own words so that all citizens are able to understand the six functions of the United States government. How would you present your version of the Preamble to other students your age to get them interested in the US Constitution

Answers

We, as the people of the United States, establish the Constitution in order to achieve Justice, insure domestic Tranquility, provide for the common defence, promote the general Welfare, and secure the Blessings of Liberty to ourselves and our Posterity. 

The Preamble of the United States in my own words will be: We the people of the United States have a role to play in ensuring harmony, establishing justice, promotion of welfare, safeguarding the nation, enhancing freedom and prosperity.

The Preamble of the Constitution is a brief introduction of the fundamental purpose of the Constitution and the principles that guide the citizens of the United States.

The purpose of the Preamble is to ensure that Americans follow the rule of law and it's the philosophy on which the Constitution was built upon.

In conclusion, the Preamble provides a standard that's vital in examining any action of the government in order to know if it's good or bad.

Read related link on:

https://brainly.com/question/23867078

The us annexation of hawaii is an example of

Answers

Final answer:

The annexation of Hawaii by the United States during the Spanish-American War is an example of American imperialism and the protection of economic interests.

Explanation:

The annexation of Hawaii by the United States is an example of American imperialism. It took place in 1898 during the Spanish-American War. At the time, Hawaii was a sovereign kingdom, but American businessmen and sugar plantation owners influenced the government of Hawaii to annex it as a US territory to protect their economic interests.

Which of the following groups oppossed washington's point of view
address

Answers

Democratic-Republicans opposed his point of view. Hope this helps :)

salutary neglect is best defined as

Answers

Answer:

In american History, it is defined as: "The 17th and 18th century British Crown policy of avoiding strict enforcement of parliamentary laws meant to keep British colonies obedient to England."

Explanation:

Prime Minister Robert Walpole stated that "If no restrictions were placed on the colonies, they would flourish". In the end, it was all a play made by Britain to keep the colonies in check and under the power of the Crown.

Salutary neglect refers to the policy of Great Britain adopting a laid back attitude in terms of enforcing control over the American colonies.

Further Explanation:

Before the French and Indian War, the British government used the policy of salutary neglect when controlling the colonies. Even though the colonies were only supposed to trade with Great Britain and follow British laws, the British government did not strictly enforce these ideas. As long as the colonists were providing raw materials to Great Britain so that they could create and sell manufactured goods, they did not really care about how the colonies were run.

This would result in the American colonies developing a unique identity independent from British rule. The colonists created their own laws, systems of government, etc. Ultimately, this policy would be abandon after the French and Indian War due to the debt incurred during this time. The abandonment of the policy of salutary neglect would be one of the many factors that lead to the American Revolution.

Learn More:

Implementation of taxes after the French and Indian War- https://brainly.com/question/512584

Key Details:

Topic: American History, American Revolution

Grade Level: 7-12

Keywords: Salutary neglect, British control, American colonies, American Revolution

Private property can help to _____. encourage people to keep the their property clean and neat discourage people from conserving resources incentivize the property owner to steal resources incentivize the property owner to buy more

Answers

The correct answer that would best complete the given statement above would be the first option. Private property can help to encourage people to keep the their property clean and neat. In a private property, there is no one allowed to be in charge of it but the owner itself so this would encourage people to keep their own property organized. Hope this answer helps.

The first one is right

how did the proclamation of 1763 attempt to protect native American rights and land

Answers

The Proclamation of 1763 forbade English settlement past the Appalachian Mountains.

Which statement accurately describes a similarity between the emperors Constantine I and Basil I? A. Both broke away from larger empires to form their own independent states. B. Both started dynasties that tolerated previously persecuted Christian groups. C. Both extended Byzantine territory to cover most of the former Roman Empire. D. Both were weak leaders who left the Byzantine Empire vulnerable to invasions.

Answers

The correct answer is B

A statement of similarity between the emperors Constantine I and Basil I is that both the emperors started dynasties that tolerated previously persecuted Christian groups. Hence, option B holds true.

What is the significance of Constantine I and Basil I?

Constantine I was an emperor of the Ancient Roman Empire. Basil I, on the other hand, held the position as the emperor of the Byzantine Empire. He was also known as Macedonian.

Constantine I was the first emperor to declare Christianity as the main religion of the Ancient Roman Empire. Some similar rulings were done by Basil I, and Christianity was promoted under both the emperor's rules.  

Hence, option B holds true regarding Constantine I and Basil I.

Learn more about Constantine I and Basil I here:

https://brainly.com/question/1953651

#SPJ2

Who one president in 2016?

Answers

That would be Donald Trump.
Donald Trump won the 2016 election.

_____________ was an outspoken Anti- Federalist who believed the Constitution gave too much power to the Federal government.
a.
George Mason

b.
Alexander Hamilton

c.
John Jay

d.
James Madison

Answers

A. George mason was an antifederalist.

Answer:

A. George mason was an antifederalist

Explanation:

I got it right on my test

What goal did President Roosevelt hope to achieve when he enacted the embargo on naval and aviation supplies in 1940?

Answers

He wanted to stop Japanese expantion.

The goal that President Roosevelt hope to achieve when he enacted the embargo on naval and aviation supplies in 1940 was to stop Japanese expansion.

Franklin Delano Roosevelt was an American statesman and political leader who became the 32nd president of the United States and served from 1933 until his death in 1945. His third and fourth terms in office were dominated by World War II.

What are the benefits and challenges of increased immigration?

Answers

Benefits: Immigration increases economic efficiency
Challenges: Immigration decreases wages of US citizens

confucius said this is the prime ingredient of the authentic individual?

Answers

Confucius believed that obedience is the prime ingredient of the authentic individual. 

Answer:

According to Confucius, a gentleman is a person who respects others and people follow him.He is the person who is who is aware of morality and benevolence. The person having courage but lacking morality will be troublesome. A gentleman does things according to morality. He said a person should always try to moral because of it is the morality which differs him from others. Morality turns a common man into a gentleman, benevolence is his  second quality.

Most of earth's land masses are closer to the south pole.

True
or
False

Answers

Answer:

false.

Explanation:

i had a test on this, and it was actually false.

Answer: False (B)

Explanation:  Most of the land in the world is closer to the North Pole than to the South Pole, which is one of the major advantages of this type of the 'Polar Projection'.

I took this quiz and this was the correct answer.

Which text is valuable for gaining context about a historical event but is unreliable as "evidence"?

A. anthology

B. encyclopedia

C. historical novel

D, monograph

E. textbook

Answers

I think the answer for this one is Historical Novel.

Answer:

C. historical novel

Explanation:

A historical novel is set in a period of history and tries to capture the essence and culture of that moment. However, different from a historian book that has a duty with the "true evidence", and must to summarize the events in a correct manner, a historical novel uses the History just as a set, and even if should be true about the features of the portrayed period, a historical novel no need to focus on this point.

What made Standard Oil a horizontal integration monopoly?

Answers

Standard Oil became a horizontal integration monopoly because it owned ninety percent of US oil refineries.

In 1870, John D. Rockefeller and Henry Flagler established the well known American oil producing, transporting and refining company which eventually became a monopoly in Ohio. It became a monopoly because it bought almost all of the competitors so that it managed to control almost all oil production, processing, marketing, and transportation in the United States.

Answer:

A. It owned ninety percent of US oil refineries.

Other Questions
a landscaper estimates that a set of plants can be installed in six hours by 12 workers the landscaper wants to finish a set of plants in 4 hours assuming that the variables are inversely related how many workers should the landscaper bring to the job How did airports encourage city growth ?a. they promoted the building of hotels, restaurants,services and rapid transit to accommodate travelers b. they are so big and require so much land that they need a larger population to be sustained c. they limit the effects of gridlock and make travel more pleasantd. they were responsible for transporting over 13 billion tons of materials Second grade homework easy!!!! Plz answer 15 pointsThx "lucy owns a bakery in 2006 she sold pies for $9.50 each in 2010 she sold pies for $17.50. Find the rate of change for the price of a pie from 2006 to 2010" Si te gusta estudiar, leer y escribir cuentos eres write 2.18 as a mixed number in simplest form Find the Nth term of the following sequence...7, 27, 47, 67, ..... Marvin is trying to finish 1/2 of his test every 2/3 hour. How many hours will it take Marvin to complete his whole test List the integers between the square root of 15 and the square root of 48 ? Why is radium valuable what is 3400 as a decimal answer asap Solve the given differential equation dN/dt=kN, (k=constant) ...? The trash, located by the sink, is always taken out at least once a week to keep the kitchen from smelling. What is the dangling modifier in this sentence? Given the ip address 192.168.112.0. each network requires between 35 and 60 hosts. what is the broadcast address of the first available subnet? 30 POINTS DONT ANSWER IF YOU DONT KNOW THE ANSWER FOR SUREIn the gene TATTCATTGTTATGATTTATTCG, CATTGTTA encodes for pepsin, a digestive enzyme. The rest of the sequence doesnt code for any protein. Which sequence contains a mutation that will affect the formation of pepsin?A. TATTCATTCATTATGATTTATTCGB. TATTCATTGTTATGACTTTATTCGC. TATTCATTGTTATGATTTATTGGCGD. TATTCATTGTTATGATATTCGE. TGCATTCATTGTTATGATTTATTCG A box is given a push so that it slides across the floor. How far will it go, given that the coefficient of kinetic friction is 0.15 and the push imparts an initial speed of 3.5m/s? When was the u.s. constitution written? what is bulimia? can someone explain it to me. Which items describe people's interactions with their environment?Technology does not affect the earth's environment.People adapt to their environment.People adapt their environment.Population growth and the environment are unrelated.Changes to the earth's environment rarely matter.Changes to the earth's environment can be harmful.Changes to the earth's environment can be beneficial. Choose the sentence that has the correct form of the verb ser. Ellas es muy inteligentes. Clara no es cubana. Nosotros son amigos. Yo eres serio.