Find the area of the shaded sector below. Use 3.14 for

Find The Area Of The Shaded Sector Below. Use 3.14 For

Answers

Answer 1

Answer:

816.4

Step-by-step explanation:

i multiplied 65,4 and 3.14 to get 816.4


Related Questions

Assume that y varies inversely with x. If y= 16 when x = 0.5, find y when x = 32.

y=[ ? ]

Answers

Final answer:

The constant of variation k for the inverse variation is found to be 8. When x = 32 is substituted into the formula y * x = k, we find that y = 0.25.

Explanation:

In problems where y varies inversely with x, it means that their product is constant. This can be represented as y * x = k, where k is the constant of variation. Given that y = 16 when x = 0.5, we can find the constant by plugging these values into the formula. Hence, 16 * 0.5 = k, so k = 8.

Now to find y when x = 32, we substitute these values into the formula. We know that y * 32 = 8, so y = 8 / 32. This simplifies to y = 0.25.

Learn more about Inverse Variation here:

https://brainly.com/question/26149612

#SPJ12

TV emporium had a huge sale in the morning 5/12 of the flat screens were sold in the afternoon 1/3 of the flat screens were sold how many TV's were sold altogether

Answers

Answer:9/12

Step-by-step explanation:

1/3 is the same as 4/12

4/12 +5/12=9/12

You paid $600 for a new guitar. Your guitar costs $40 more than twice the cost of your friend's guitar. How much did your friend's guitar cost?

Answers

Answer :

Cost of your guitar = $ 600

Let your friend's guitar's cost be = n

According to the question =

Your guitar costs $ 40 more than twice the cost of your friend's guitar which is n ,but your guitar's cost is $ 600.

So ,the linear equation for this will be =

= 2n+$40 = $600

= 2n = $600-$40

= 2n = $ 560

= n = $ 560/2

= n = $ 280

Thus ,the cost of your friend's guitar is $ 280.

The cost of your friend's guitar is $280 by creating an equation based on the cost comparison to your own guitar, and then solving for the variable representing your friend's guitar's cost.

You paid $600 for a new guitar, which costs $40 more than twice the cost of your friend's guitar. To find the cost of your friend's guitar, let's denote the cost of your friend's guitar as x. According to the information given, your guitar's cost can be represented by the equation 2x + $40 = $600. Solving for x will give us the following steps:

Subtract $40 from both sides of the equation: 2x = $600 - $40.

This simplifies to 2x = $560.

Divide both sides by 2: x = $560 / 2.

Therefore, x equals $280.

The cost of your friend's guitar is $280.

Work out the value of x.
Need answer soon :) ​

Answers

Answer:

x+20

Step-by-step explanation:

As we can see n the diagram, there are parallel traversals and one line, and the two angles given are same-side interior angles. We know that when there is parallel traversal, and we have same side interiors, the sum of the measure of the two angles are supplementary. Supplementary means 180 degrees, or a straight line.

So we plug everything in and we have  4x+5x=180 degrees

4x+5x=9x, so 9x=180

We divide by 9 on both sides to get the value of x, which is 20

Hope it helps!

Gabriel wants to send a parcel to Italy.
His parcel is a cuboid with dimensions 10 cm, 20cm and 40 cm.
He looks at the prices of two companies,
We Deliver and GoParcels.
Not drawn
to scale
We Deliver
Total cost: Sum, in cm, of the 3 dimensions * £0.80 Find the cost or sending th
parcel with each company.
GoParcels
Give each of your answers
Total cost: Total area, in cm, of all 6 faces x £0.02 pounds (2).




The answer: both £56

Answers

Answer: Both £56

Step-by-step explanation:

We deliver: 10 x 20 x 40 = 8000

8000 x 0.80/cm = £56

£56

Go Parcels: 2(10 x 20) + 2(10 x 40) + 2(20 x 40) = 2800

2800 x 0.02/cm = £56

£56

What is the volume of the following rectangular prism?
4 units
Volume =
I units

Answers

Answer:

sorry i dont quite understand, were you given more information

Step-by-step explanation:

The required volume of the rectangular prism is unknown and cannot be determined based on the given information.

What is volume?

Volume is defined as the mass of the object per unit density while for geometry it is calculated as profile area multiplied by the length at which that profile is extruded.

Here,
The volume of a rectangular prism is given by the formula:

Volume = length x width x height

In this case, we are given that the length and width of the rectangular prism are 4 units, but we don't have any information about the height. So, we cannot determine the volume of the rectangular prism without knowing its height.

Therefore, the volume of the rectangular prism is unknown and cannot be determined based on the given information.

Learn more about Volume here:
https://brainly.com/question/1578538

#SPJ1

There is a bag filled with 3 blue and 5 red marbles.
A marble is taken at random from the bag, the colour is noted and then it is not replaced.
Another marble is taken at random.
What is the probability of getting at least 1 red?

Answers

Answer:

1/7

Step-by-step explanation:

i learned this arealdy

The probability of drawing at least one red marble from a bag containing 3 blue and 5 red marbles in two draws without replacement is 19/28.

To find the probability of drawing at least one red marble from a bag with 3 blue and 5 red marbles, with one draw already taken, we calculate the probability of not drawing a red marble and subtract that from 1. Since there are more red than blue marbles, the probability of drawing a red one on the first draw is higher. However, the problem states that the marbles are not replaced after drawing, so the probabilities change with every draw.

There are two ways to not draw a red marble in two draws:

First draw: blue, Second draw: blue.

First draw: red, Second draw: blue.

Let's calculate these probabilities. For the first case, there's a 3/8 chance of drawing blue first, and then 2/7 chance of drawing blue again, since one blue marble has been removed, which equals to 3/8 * 2/7 = 6/56 or 3/28. For the second case, there is a 5/8 chance of drawing red first, and then a 3/7 chance of drawing blue, equalling 5/8 * 3/7 = 15/56. The sum of these probabilities is 3/28 + 15/56 = 9/28.

Therefore, to find the probability of at least one red, we subtract the summed probabilities from 1: 1 - 9/28 = 19/28.

Thus, the probability of drawing at least one red marble is 19/28.

Can someone pls help w both of them for 20 pts

Answers

The first answers:
(3.50 x 5) + (4.00 x 4) + (1.00 x 10)
$43.50
The second answers:
(8.25 x 5) + (5.50 x 4) + (1.25 x 10)
$75.75


Ajar contains "x" black and "y" white balls. What is the probability that a random draw is black?
ху
x/x + y)
ylx
NEXT QUESTION
©
ASK FOR HELP
TURN IT LE

Answers

Answer:

Step-by-step explanation:

favorable events=x

total number of events=x+y

P=(favorable events)/(total number of events)=x/(x+y)

If there are ‘x’ black balls and ‘y’ white balls, then the total number in the jar must be x + y.
Therefore, the probability of picking a black ball is the amount of black balls there are divided by the total, which is x/(x+y)

I hope this helps!

Randy buys a pair of shoes that were originally
priced at $147. He receives a 35% discount and
pays 8.5% sales tax. How much does Randy pay?

Answers

Randy will play $103.67

Express 22,575 square millimeters as square meters

Answers

Answer:

0.02257500m²

Step-by-step explanation:

what is the surface area of a right rectangular prism with a width of 12 inches, a length of 6 inches, and a height of 8 inches?

a) 144 in2

b) 288 in2

c) 432 in2

d) 576 in2

Answers

The answer would be d) 576

in polar coordinates, the axis determined by theta =0 is called the ____ axis.

Answers

X axis is what it is I think

Answer:

The answer is polar.

Step-by-step explanation:

I just finished the quiz

Can someone please help? I need help ASAP

Answers

Answer:

A) x +  y =  - .7

B) -3x + y = 11.7

We'll multiply A) by 3

A) 3x + 3y = -2.1  the add it to B)

B) -3x + y = 11.7

4 Y = 9.6

Y = 9.6 / 4 = 2.4

-3x  + (9.6 / 4) = 11.7

-3x = 9.3

x = -3.1  

Step-by-step explanation:

To solve the trigonometric inequality sin?(x) -0.85, Carl graphed the equations y=sin(x) and y=-0.85. Shelly, on the other
hand, took the cube root of both sides of the inequality so that it became sin(x) = -0.85, and she then graphed the equations
y = sin(x) and y -0.85. Which of the following statements is true regarding the points of intersection of Carl's graph and
Shelly's graph?

A The points of intersection of Carl's graph have different x-coordinates than the points of intersection of Shelly's graph and
different y-coordinates.

B The points of intersection of Carl's graph have different x-coordinates than the points of intersection of Shelly's graph but the
same y-coordinates.

C The points of intersection of Carl's graph have the same x-coordinates as the points of intersection of Shelly's graph but
different y-coordinates.

D The points of intersection of Carl's graph have the same x-coordinates as the points of intersection of Shelly's graph and the
same y-coordinates.

Answers

Answer: C

Step-by-step explanation:

The points of intersection of Carl’s graph have the same x-coordinates as the points of intersection of Shelly’s graph but different y-coordinates.

Trigonometric expressions can be represented using inequalities

The true statement is (c) the points of intersection of Carl’s graph have the same x-coordinates as the points of intersection of Shelly’s graph but different y-coordinates.

The inequality is given as:

[tex]\mathbf{sin^3(x) < -0.85}[/tex]

The steps Carl took will give the following coordinates (x, y^3)

The steps Shelly took will give the following coordinates (x, y)

This means that, their results will have the same x-coordinates but different y-coordinates.

Hence, the true option is (c)

Read more about trigonometry at:

https://brainly.com/question/11016599

Consider the expression 10 to the 3rd power time 0.006.

What is the exponent in the power of 10?

Answers

10^3 x 0.006

Answer: 3

What is the difference between joint, marginal, and conditional relative frequencies?

Answers

Answer:

The middle cells are the joint frequency numbers. When analyzing data in a two-way frequency table, you will be looking for joint relative frequency, which is the ratio of the frequency in a particular category and the total number of data values. The purple cells on this table are all joint frequency numbers.

The numbers in the column on the very right and on the row on the very bottom are the marginal frequency numbers. When analyzing data in a two-way frequency table, you will be looking for marginal relative frequency, which is the ratio of the sum of the joint relative frequency in a row or column and the total number of data values.

Conditional relative frequency numbers are the ratio of a joint relative frequency and related marginal relative frequency.

Step-by-step explanation:

Jim’s family is choosing whether to go to a restaurant for lunch or for dinner. The cost of a salad is $7 at lunch and $9 at dinner. The cost of a steak is $10 at lunch and $12 at dinner. Each person will choose either a salad or a steak regardless of the mealtime. Jim calculates the food bill to be $41 if they go during lunch and $51 if they go during dinner. How many people will choose a salad?
2
3
4
5

Answers

Answer:

To answer the problem above we let x be the number of people who prefers salad and y be the number of people who chose steak. For lunch they will be spending $41. That is,

                                  7x + 10y = 41

Now, for dinner they will be spending $51. That is,

                                9x + 12y = 51

The values of x and y from both equations are 3 and 2, respectively. Therefore, 3 people will choose a salad

Answer:

3

Step-by-step explanation:

:) It's 3.

PLEASE HELP WITH MY KHAN HOMEWORK BECAUSE IT’S DUE MONDAY!

Answers

Answer:

7/12 + 2/3q

Step-by-step explanation:

combining like terms

11/12 - 1/3 =

7/12

-1/6q + 5/6q = 4/6q which is also 2/3q

Ryan went into town and bought some chicken feed that would last for the next 60 days. If he buys two 50 lbs bags for 5 chickens, how much does each chicken eat a day.

Answers

Answer:

3 pounds

Step-by-step explanation:

1. 50 + 50 = 100

2. 100 / 5 = 20

3. 60 / 20 = 3

Each chicken eats approximately 0.3333 pounds of feed per day, which is calculated by dividing the total feed (100 lbs) by the number of days (60) and then by the number of chickens (5).

To calculate how much chicken feed each chicken eats a day, we need to start by understanding the total amount of feed Ryan bought. He bought two 50 lbs bags, which is a total of 100 lbs of chicken feed. Since the feed needs to last 60 days for 5 chickens, we will divide the total feed by the number of days and then by the number of chickens.

First, we convert the weight of the feed into pounds (if it is not already in pounds). We know there are 100 lbs of feed in total.

Next, we divide the total weight of the feed by the number of days to find out how much feed is used per day:
100 lbs / 60 days = 1.6667 lbs per day (for all 5 chickens together).

Finally, we divide the daily feed consumption by the number of chickens to find out how much each chicken eats per day:
1.6667 lbs per day / 5 chickens = 0.3333 lbs per chicken per day.

Therefore, each chicken eats approximately 0.3333 pounds of feed a day.

From 2010 to 2015, a group of researchers conducted an experiment using two types of pain medication: pill A and pill B. The researchers gave the doctors the pills in unidentified packages so they would not know which package was pill A and which package was pill B. The patients participating did not know which pill they received either. What is this an example of?

a Group of answer choices

b The effect of a treatment unit

c The placebo effect

d A control group study

e A double-blind study

f Voluntary response bias

Answers

Answer:

My best choice would be e

Step-by-step explanation:

The given example is of double blind study.

The correct option is (e).

What is double blind study?

A type of clinical trial in which neither the participants nor the researcher knows which treatment or intervention participants are receiving until the clinical trial is over. This makes results of the study less likely to be biased. This means that the results are less likely to be affected by factors that are not related to the treatment or intervention being tested.

Given,

Two medicines A and B.

Both are without label, neither the doctor knows nor the patient can identify the pills.

As per definition above, It is an example of double blind study .

Hence, option (e) is correct.

Learn more about double blind study here:

https://brainly.com/question/10889782?referrer=searchResults

#SPJ3

Double time pay is twice the regular time pay rate. If Rita, a nurse, earns $24 per hour for her regular pay rate and she is paid double-time for a holiday, what would the equation look like if Rita worked 36 regular hours plus 8 hours holiday?

Answers

Answer:24r+48h= $1248

Step-by-step explanation:

24*36+48*8

864 + 384 = 1248

Not sure if it's correct I'm not brilliant with equations xx

Answer:

Correct

24(36) + 24(2) x 8 =

Step-by-step explanation:

Given ΔSTU and ΔDEF, what is m∠U ?

Answers

Answer:

In this context:

[tex]\boxed{m\angle U=40^{\circ}}[/tex]

Explanation:

Hello! Remember you have to write complete questions in order to get good and exact answers. Here you haven't provided any diagram, so I'll assume ΔSTU and ΔDEF are similar. Two triangles are similar if and only if their corresponding angles are congruent and their corresponding sides are in proportion.

So:

[tex]\angle S=\angle D \ldots eq1 \\ \\ \angle T=\angle E \ldots eq2 \\ \\ \angle U=\angle F \ldots eq3[/tex]

We also know:

[tex]\angle S+\angle T+\angle U=180^{\circ} \ldots eq4 \\ \\ \angle D+\angle E+\angle F=180^{\circ} \ldots eq5[/tex]

Suppose we know:

[tex]\angle S=30^{\circ} \\ \\ \angle E=110^{\circ}[/tex]

Then, by eq2:

[tex]\angle T=\angle E =110^{\circ}[/tex]

By substituting ∠S and ∠T into eq4:

[tex]\angle S+\angle T+\angle U=180^{\circ} \\ \\ 30^{\circ}+110^{\circ}+\angle U=180^{\circ} \\ \\ \\ Isolating \ \angle U: \\ \\ \angle U=180^{\circ}-(30^{\circ}+110^{\circ}) \\ \\ \angle U=180^{\circ}-140^{\circ} \\ \\ \angle U=40^{\circ}[/tex]

Finally:

[tex]\boxed{m\angle U=40^{\circ}}[/tex]

x − 7 = 46 − 9(x + 7)
x =

Answers

Answer:

x=-1

Step-by-step explanation:

x − 7 = 46 − 9(x + 7)

distribute

x-7 = 46 - 9x -63

Combine like terms

x-7 = -9x-17

Add 9x to each sid

x-7+9x = -9x+9x -17

10x-7 = -17

Add 7 to each side

10x -7+7 = -17+7

10x = -10

10x/10 = -10/10

x = -1

Answer:

x = -1

Step-by-step explanation:

x − 7 = 46 − 9(x + 7)

x - 53 = -9x - 63

10x = -10

x = -1

If two pyramids have the same height, what must be true of the pyramids for them to also have the same volume?

The pyramids must have the same base shape.
The pyramids must have the same slant height.
The areas of the bases must be the same.
The pyramids must be identical in size and shape.

Answers

Answer:

areas of bases must be same as Vol=area of base×h/3

Answer:

The areas of the bases must be the same. yw

Step-by-step explanation:

Miguel, Sterling, and Kevin plan to split the cost of a round-trip car ride from
Los Angeles, California, to El Paso, Texas, equally. The total cost of the trip
from Los Angeles to El Paso was $1136.79, and they expect that the trip back
to will cost the same. How much will Kevin have to pay for the round-trip?
©
__
A. $505.21
B. $757.86
c. $82452
D. $623.54
O

Answers

It’s B because 1136.79 x 2 is 2273.58. 2273.58/3 because there’s three people splitting the ticket is 757.86

Kevin has to pay $757.86 for the round trip.

A cost function is a mathematical formula used to chart how production expenses will change at different output levels.

How find how much will Kevin have to pay for the round-trip?

Given Miguel, Sterling, and Kevin plan to split the cost of a round-trip car ride from Los Angeles, California, to El Paso, Texas, equally. The total cost of the trip from Los Angeles to El Paso was $1136.79, and they expect that the trip back will cost the same.

It’s B because 1136.79 x 2 is 2273.58.

2273.58/3 because there are three people splitting the ticket is 757.86.

Learn for more cost problems on: https://brainly.com/question/26778849

#SPJ2

Hi, I need some help with this question about the circumference of a circle. Help would be greatly appreciated :)

Answers

Answer:

C = 18.84 ft

Step-by-step explanation:

C = 2 * pi *r

The radius is 3 ft

C = 2 * 3.14 * 3

C = 18.84

Simplify the following polynomial and write the answer in standard form.
(-2x^2 +5x² - 4x+8) - (-2x^2 + 2x - 3)
A. 5x^2 - 6x +11
B. –2x+5+5x^2
C. 4x^3 + 5x^2 - 6x - 11
D. 5x^2 - 6x – 11+4x^3

Answers

Your answer would is A. Thats the standard form
A:5x^2 - 6x +11

you wrote it wrong on brainly so i did the work based off the picture you attached.

attached picture work:
(-2x^3+5x^2-4x+8)-(-2x^3+2x-3)
distribute the negative to the second equation and flip the signs inside the parentheses.
(-2x^3+5x^2-4x+8)+(2x^2-2x+3)
cancel out the -2x^3 and the 2x^3
(5x^2-4x+8)+(-2x+3)
add both together
5x^2-6x+11

your answer is A. 5x^2 -6x +11

A delivery company pays its drivers a fixed fee for each delivery made that day. The company deducts a daily fee for the use of the company's delivery truck. The drivers net pay in dollars, p, for one day is given by the equation p = 11d − 55, where d is the number of delivers made in one day. What does the number 11 most likely represent?

Answers

Answer:

11 must be the fee for each delivery made

Step-by-step explanation:

p = 11d − 55

The y deduct the daily fee

deduct means subtract which means the daily fee is 55

d is the number of deliveries in one day

delivery company pays its drivers a fixed fee for each delivery made

Since d is the number of delivers, 11 must be the fee for each delivery made

Answer:

fee paid per delivery

Step-by-step explanation:

The graph of an ellipse is shown.
Which equation represents this ellipse?PLEASE HELP IF RIGHT MARK BRAINIEST

Answers

Answer:

D. (y-4)^2/12^2 + (x-2)^2/6^2=1

Step-by-step explanation:

Took the quiz.

Answer:

d

Step-by-step explanation:

Other Questions
Read the following paragraph and answer the question below.1Wuthering Heights is in the midst of the desolate English moors. 2Outside the gates of this solitary dwelling, the landscape expands into dreary shades of brown and gray, with only the craggy cliffs on the distant horizon to break the monotony. 3Wildlife and foliage are scarce. 4The few trees that do live must eke out their existence: the north wind blows constantly. 5The house itself, built to withstand the tumults of wind and rain, is cold and forbidding. 6The stone walls and earthen floors offer no relief from the bone-chilling dampness of northern England. 7In sharp contrast to Wuthering Heights is Thrushcross Grange. 8Situated in a sheltered valley, Thrushcross Grange is calm and peaceful, and is surrounded by lush flower gardens. 9The refined elegance of Thrushcross Grange differs as much from Wuthering Heights as the rose differs from the thorn. 10The contrast between these two settings is symbolic of the ultimate conflicts in Emily Bronte's novel Wuthering Heights.Name the shape of the paragraph. __________ .A)regular triangle B)inverted triangle C) diamond D) rectangle Below is the double-stranded DNA sequence of part of a hypothetical yeast genome. Within this sequence is a small gene, PICO8, that codes for an 8 amino-acid peptide (assume traditional start codon). Transcription of PICO8 starts at the Transcription Start Site (TSS) after the promoter and proceeds in the direction of the arrow. Transcription stops at the end of the transcription terminator. 5' - CTATAAAGAGCCATGCATATCTAGATAGTAGGCTCTGAGAATTTATCTCACT - 3 3 - GATATTTCTCGGTACGTATAGATCTATCATCCGAGACTCTTAA ATAGAGTGA - 5 promoter terminator Which strand of DNA is the CODING strand? (TOP OF BOTTOM?) Select only ONE answer choice. A. Top B. Bottom C. Either can serve as the codong strand D. There isn't enough information to determine which is the coding strand The Confederacy held captured Union soldiers in a military prison located in As a result of mitosis, in a human body cell, the nucleus of each daughter cell contains _________ chromosomes. Ethan and Chloe shared 50 in the ratio 1:4 Which are evidence of seafloor spreading? Select three options. There are 14 books on a shelf. 6 of these books are new.(a) What is the ratio of used books to all books?(b) What is the ratio of new books to used books?? an elevator at a construction site has a maximum capacity of 2500 pounds. if the elevator operator weights 160 pounds and each cement bag weighs 60 pounds, how many bags of cement can be safely lifted on the elevator in one trip? What is the image point of (6,-1) after a translation left 4 units and down 5 units? What is the value of a? Word bank:borrarchrtercorreo basuraen lneaesnobestrsGUSTAVO Voy a leer el correo electrnico.REBECA Bah, yo slo recibo ____________. Lo nico que hago con la computadora es ________________ mensajes.GUSTAVO Mira, cario, hay un anuncio en Internet: un viaje barato a Punta del Este. Es un vuelo ___________________.REBECA ltimamente tengo tanto ____________________. Sera buena idea que furamos de vacaciones. Pero busca un hotel muy bueno.GUSTAVO Rebeca, no seas ___________________, lo importante es ir y disfrutar. Voy a comprar los boletos ahora mismo ______________________. IM giving 15 points please help!a 42 meter lighthouse is observed by a ships officer at a 65 degree anlge to a path of the ship. At the next sighting, the lighthouse is observed at a 42 degree angle. To the nearest meter what is the distance between the 2 sightings? What made Jake suspicious about the man with the camera?he was wearing dark glasseshe took a photo of themhe was the same man who sold Jake the maphe had followed them all dayIts C A researcher has developed a measure of a person's ability to detect colors. He finds the measure is not related to a person's spelling ability, which is a different type of measure. This finding is an example of _______ validity.a. convergentb. discriminantc. faced. concurrent Put in the counts under the notesPlease me help me The impact of the foot-in-the-door phenomenon is most clearly illustrated by What is the area of a rectangle 15 feet by 2 feet's rectangle. The shape of a flag is a rectangle. The length is 15 ft. And the width is 2 feet. What is the total area of the rectangle? Under what condition were Roman women allowed to run businesses? In the future, passengers will board a spaceship for the first interstellar flight.Which does interstellar most likely mean?A. between the starsB. beyond the starsC. into the stars A car was purchased for $25,000. Research shows that the car has an average yearly depreciation rate of 18.5%. Create a function that will determine the value V(t), of the car t years after purchase. Determine to the nearest cent, how much the car will depreciate from year 3 to year 4