Answer:
The fishes that can thrive in both freshwater and saline environments can be witnessed in estuaries. The locations like inter-tidal zones and estuaries exhibit different levels of salinity, on the basis of season, tide, and weather. This signifies that fish, which thrives in the mentioned region should exhibit the properties to survive in different levels of salinity.
The coral reefs refer to the ecosystem that is found in shallow, warm parts of the ocean. The coral reefs are the underwater forests, which are full of life. They seem to survive in warm and shallow waters.
Which state would best be suited to harness wind energy?
The correct answer is North Dakota.
The best state which is suited to harness wind energy is North Dakota.
Harvesting of wind energy has some advantages. For example,
1 .Wind energy is one of the leanest and most effective forms of harnessing a renewable form of energy.
2. Wind energy is cleaner, more renewable and cheaper than many of the current sources of energy.
We use harnessing wind energy because,
1. It produces no pollution.
2. It produces more jobs per watt.
3.It is renewable and lasts for long
WILL MARK BRAINLIEST! HURRY!! a student wants to study the effect of removing
Thermal energy from a system. Which of the following experiments should the student perform?
Close a circuit by adding a penny and record if the bulb glows
Close a circuit by adding a nail and record if the bulb glows
Gradually warm a liquid and record it’s change in state
Gradually cool a gas and record it’s change in state
Answer:
Gradually cool a gas and record it's change in state
Explanation:
you are removing thermal energy
Answer:
c is answer
Explanation:
Choose all the answers that apply. Jupiter: rotates upside-down is the largest planet is the most massive planet is the least dense planet has retrograde rotation
Answer:
Jupiter is the largest planet.
Jupiter is the most massive planet.
Explanation:
There are 8 planets in the solar system. Jupiter lies beyond the asteroid belt. It is the largest and most massive planet of the solar system. It does not have retrograde motion. Saturn is the second largest planet and is the least dense planet. Jupiter is composed of mostly hydrogen and helium. Jupiter's axis of rotation is tilted to about 3.13 degrees. It does not rotate upside down.
Does meiosis and mitosis (or both) end with unreplicated chromosomes? Which begins with replicated chromosomes?
Yes, both meiosis and mitosis end with unreplicated chromosomes.
Both meiosis and mitosis end with unreplicated chromosomes because mitosis has diploid chromosomes and meiosis has haploid chromosomes. We know that in mitosis, two daughter cells are produced that has double number of chromosomes each.
While on the other hand, in meiosis, four daughter cells are produced, each has half number of chromosomes. Mitosis is a type of cell division that start with replication of DNA in which exact copy of DNA formed which is distributed equally among the two daughter cells so we can conclude that both mitosis and meiosis end with unreplicated chromosomes.
Learn more: https://brainly.com/question/9074834
which structures are not found in prokaryotic cells
The answer is cilia. It actually means "motile" or moving.
From which type of organism did the ancestor of land plants likely evolve
Which region of skin hosts the largest bacterial population?
Which head glands secrete sucrase, lipase, amylase, and invertase?
What gene does aacgaagaggacatagagtatctaccgaaaaacaatcccgaaggaccgttacaacactcgatcaaccgcaagaaagtacgatggcaacatccattgtgtatgcatccatatctcatccagcattctgaaagggtaatgaataattattccgctgagttcatgaggtatccgaaggaggagcaacacttaggctataagagtatcatgcacatagatcgggataaatcgcctatcatatgtgacaacaatttcatgattaaaagt code for?
the graph shows the percentage of dog breeds affected by elbow dysplasia, which causes dogs to limp. What???s the most likely explanation for the mixed breed???s disease incidence?
Answer:
The most likely explanation is that the mixed race has a low diversity in genes.
Explanation:
Elbow dysplasia is a condition that causes a bad development in the elbows of dogs, causing a bad formation of cartilage in that region of the paw, or a bad structure of the surrounding bones.
This condition is common in mixed breeds, because these breeds have little diversity of genes, allowing this disease to be passed to the offspring during crossbreeding between dogs that already have the disease.
A neuron that carries impulses away from the central nervous system is a:
In sickle-cell disease, variation in one gene causes red blood cells to bend, or sickle. This means the sickled cells _____.
carry toxic levels of oxygen through the body
attract larger numbers of the malaria parasite
are better at destroying the malaria parasite
cannot carry normal levels of oxygen to cells
In sickle-cell disease, variation in one gene causes red blood cells to bend, or sickle. This means the sickled cells cannot carry normal levels of oxygen to cells. Thus, the correct option is D.
What is sickle-cell disease?Sickle-cell disease may be defined as a cluster of inherited red blood cell disorders.
Due to this disease, the shape of the red blood cells has an abnormal crescent, blocks small blood vessels, and does not last as long as normal red blood cells.
Due to the alterations in the shape of red blood cells, the affinity of oxygen binding decreases, and hence they cannot carry normal levels of oxygen to cells.
Therefore, the correct option for this question is D.
To learn more about the sickle-cell disease, refer to the link:
https://brainly.com/question/17063471
#SPJ5
Which of the following genotypes is homogeneous recessive? ss, Bb, TT, or XY
Heat exhaustion is a deadly heat stress illness that occurs when the body's heat production significantly exceeds its cooling capacities and core body temperature rises to dangerous levels. heat exhaustion is a deadly heat stress illness that occurs when the body's heat production significantly exceeds its cooling capacities and core body temperature rises to dangerous levels.
a. True
b. False
What is a strategic mineral?
Question 3 options:
A)one that is exported from the United States
B)a nonmetallic resource
C)one that must be imported to the United States
D)one that is easily removed from the ground
A strategic mineral is a nonmetallic resource which are the commodities which are essential for the national defense during the situation of war. Thus, the correct option is B.
What is Strategic minerals?Strategic minerals are the commodities which are essential to the national defense for which the supply during war is wholly, or partially dependent upon the sources outside the boundaries of the United States. These resources would be difficult to obtain as strict measures are used for controlling the conservation and distribution of resources.
Strategic minerals are imported from those countries where these are abundant and when the domestic production is unable to meet up with the demands of the country such as the during the situation of war. Nonmetallic Minerals like Petroleum, Aluminium, Copper, Uranium, etc are the examples of Strategic Minerals.
Therefore, the correct option is B.
Learn more about Strategic minerals here:
https://brainly.com/question/1263149
#SPJ2
The leading preventable cause of cancer is _____.
A.tobacco B.UV exposure C.HPV D.bacterial infection
Answer:
The answer is A: Tobbaco
Explanation:
Health officials estimate that almost 40 percent of cancers can be prevented by a healthy diet, physical activity, and avoidance of tobacco. In fact, tobacco use is the single most preventable cause of cancer in the world.
Do you think that humans and humpback whales share a common evolutionary lineage?
Yes, humans and humpback whales share a common evolutionary lineage. Both humans and humpback whales are mammals, which means they have many biological similarities.
Additionally, research has shown that all mammals share a common ancestor that lived approximately 200 million years ago, so humans and humpback whales would have diverged from this common ancestor and evolved along separate paths.
Genetic studies have also provided evidence for the relatedness of humans and other mammals, including whales.
The last common ancestor of humans and whales lived over 95 million years ago and was a small, insect-eating mammal that lived on land.
Learn more about mammals at:
https://brainly.com/question/15326492
#SPJ2
The major problem with hydrogen as an alternative source of energy is that none exists on the surface of the earth.
a. True
b. False
WILL GIVE MEDELS AND RATE!!!
Translation is a process by which the sequence:
a) a bases of mRNA is converted into a sequence of amineo acids of a protien
b) a basis of tRNA is converted into cytoplasm before attaching itself to a polypeptide
c) of basis of tRNA is converted into a sqeunce of amino acids of a protien
d) of basis of an mRNA is converted into cytoplasm before attaching itself to polypeptide.
If you've taken this quick check then plz post the other questions. I would like the help! I think its c,
How does producing plastics benefit the economy?
Plastic has economic benefits and can save resources. It increases food shelf life and reduces fuel usage by being lightweight.
Why is plastic industry important?The use of plastic has been shown to have a number of direct financial benefits as well as the potential to improve resource efficiency. It lengthens the time that food can be stored without going bad, which cuts down on food waste, and its relatively low weight cuts down on the amount of fuel needed to transport items.
The invention of computers, mobile phones, and the majority of the life-saving advancements in modern medicine would not have been conceivable without plastics. Plastics, thanks to their low weight and superior insulating properties, contribute to the reduction of fossil fuel consumption in heating and transportation.
The usage of plastics not only enables us to lead more fulfilling lives but also makes a positive contribution to the preservation of the environment. Plastics are actually beneficial to the protection of the environment since they help cut down on trash, which in turn helps save energy in our houses, cuts down on the weight of vehicles, which results in fewer greenhouse gas emissions from the burning of gasoline, and so much more.
Learn more about plastics, here:
https://brainly.com/question/11452652
#SPJ2
"cold and dry" temperature and precipitation patterns are characteristic of
"cold and dry" temperature and precipitation patterns are characteristic of polar climates.
What are polar climates?
The polar climate regions are characterized by a lack of warm summers but with varying winters. Every month in a polar climate has an average temperature of less than 10 °C. Regions with polar climate cover more than 20% of the Earth's area.
Moreover, a polar climate is a place where the climate usually has a temperature below freezing, icy, and covered in snow. These areas do not get direct heat and sunlight from the sun. Polar climates are located at the North Pole of the Arctic, and at the South Pole on the continent of Antarctica.
Therefore, the polar regions surround Earth's North and South Poles. The area around the North Pole is called the Arctic. The area around the South Pole is called Antarctica.
Learn more about polar climates:
https://brainly.com/question/26116310
#SPJ6
How does an ecosystem approach to conservation differ from a single-species approach? the ecosystem approach has been more successful at attracting the public's attention to conservation needs. the ecosystem approach focuses on a single "charismatic" species―large, furry, and photogenic. an ecosystem approach involves restoring and protecting an entire habitat and all the species within it. all of the above?
Solar energy is renewable. What could be an economic factor that prevents the maximum exploitation of this resource?
Answer:
Solar energy is not always available and needs to be stored.
Explanation:
Though solar energy is a renewable, clean source of energy, it is not available at all times and needs to be stored. This is an economic factor that could prevent the maximum exploitation of this resource.
Solar energy is not always available and needs to be stored that prevents the maximum exploitation of the resource.
What are the uses of solar energy?Solar energy is radiant light and heat from the Sun that is harnessed using a range of technologies such as solar power to generate electricity, solar thermal energy, and solar architecture.
The most commonly used solar technologies for homes and businesses are solar photovoltaics for electricity, passive solar design for space heating and cooling, and solar water heating.
When the sun shines onto a solar panel, energy from the sunlight is absorbed by the PV cells in the panel. This energy creates electrical charges that move in response to an internal electrical field in the cell, causing electricity to flow.
Learn more about solar energy:
https://brainly.com/question/9704099
#SPJ6
What advantage might chromosome banding patterns have in the analysis and diagnosis of chromosomal problems or abnormalities?
The protoplasm and cytoplasm of a plant are interchangeable terms.
a. True
b. False
SOS:
The answer is FALSE!!!
The cytoplasm is protoplasm that surrounds the nucleus. All the organic substances of the cell are referred to as the protoplasm. The cytoplasm and the nucleus make up the protoplasm.
Hope this helps!!
Which theory of emotion includes a simultaneous arousal and interpretation of emotion?
A) James -Lange theory
B) canon bard theory
C) common sense theory
D) confirmed arousal theory
The correct answer is option B, that is, Cannon-Bard theory.
The Cannon-Bard theory of emotion also called the Thalamic theory of emotion. It is a physiological illustration of emotion created by Walter Cannon and Philip Bard. The theory states that one feels emotions and encounter physiological responses like trembling, sweating, and muscle-tension at the same time.
The Cannon-Bard theory suggests that one encounters physiological arousal and emotion at the similar time. The theory offers more attention to the role of outward behavior or thought that than was done by James-Lange.
What evolutionary development allowed plants to grow tall? see concept 29.3 (page 626)?
Final answer:
The development of a vascular system with xylem and phloem enabled plants to grow tall, while the adaptations of seed and pollen facilitated reproduction independent of water and promoted wide dispersion, respectively.
Explanation:
The evolutionary development that allowed plants to grow tall was the development of a vascular system. This system includes xylem and phloem, which are tubes that transport water, minerals, and nutrients throughout the plant. The xylem is responsible for the upward transportation of water and minerals from the roots, while the phloem distributes sugars and other organic nutrients from the leaves to the rest of the plant.
Seed and pollen adaptations were crucial for the development and expansion of seed plants. Seeds allow plants to reproduce without being dependent on water, thus enabling them to survive in a variety of environments, including arid zones. Pollen, with its hardy structure, could be dispersed by wind or animals, reaching far distances and promoting gene flow between plant populations.
These developments provided plants with structural support to grow tall and compete for sunlight, while also being able to spread across vast territories.
Describe the process by which coral polyps and algae create a coral reef.
Which of the following is malleable?Question 6 options:
pottery
gold
glass
ice
Why is it said that natural selection acts on pheno- types rather than on the genetic material of organisms?