Habituation refers to the __________.
a. awareness that things continue to exist even when not perceived.
b. decreasing responsiveness to a stimulus to which one is repeatedly exposed.
c. adjustment of current thinking to make sense of new information.
d. the tendency to gaze longer at face-like images.

Answers

Answer 1

Answer:

Habituation refers to the  adjustment of current thinking to make sense of new information.

Explanation:

Answer 2

Final answer:

Habituation is the process where there is a decrease in response to a repeatedly presented stimulus, with no rewards or punishments associated with it, and is a form of learning that is long-lasting.

Explanation:

Habituation refers to the decreasing responsiveness to a stimulus to which one is repeatedly exposed. Therefore, the correct answer is (b). This form of learning is seen across various species and is not due to fatigue or sensory adaptation. An example of habituation can be observed when a dog stops responding to a repetitive sound after learning that it has no significant consequence. The process of habituation is long-lasting, and it is considered one of the simplest forms of learning, highlighting an organism's ability to filter out repetitive, inconsequential stimuli over time.


Related Questions

An accident victim receives a blood transfusion. Shortly thereafter, he begins to have difficulty breathing, develops a fever, and experiences nausea and vomiting. Which of the following is the most likely interpretation of these events?
a. the blood transfusion contained pyrogens.b. the blood transfusion was mismatched, and the recipient had previously been exposed to the blood group antigens of the blood transfusion.c. the blood transfusion was mismatched and contained pyrogens.d. the blood transfusion was mismatched.e. the recipient had previously been exposed to the blood group antigens of the blood transfusion.

Answers

Answer:

b. the blood transfusion was mismatched, and the recipient had previously been exposed to the blood group antigens of the blood transfusion.

Explanation:

Blood transfusion giving a patient blood or its equivalent product intravenously. Necessary tests are normally carried out to ensure the blood to be transfused matches and is compatible with the blood or body system of the recipient.

However when symptoms like difficulty in breathing, fever,nausea and vomiting is visible after ten transfusion then it’s obvious there was an error which involves blood transfusion being mismatched, and the recipient being previously been exposed to the blood group antigens of the blood transfusion

Answer:

b. the blood transfusion was mismatched, and the recipient had previously been exposed to the blood group antigens of the blood transfusion.

Explanation:

This incompatibility of blood groups, which leads to immune response of the recipient to recognise the donor's blood cells as antigens, and therefore attack the donor blood cells donated , causing lysis  of the blood cells, leading to low oxygen saturation in the blood and difficulty in breathing and  other complication.  

Genetic engineering is also known as ________

recombinant DNA technology
genetic modification
transgenic creation

Answers

Answer: Recombinant DNA technology

Explanation:

How do waterfalls form?

A. meander gets cut off.
B.Sediment builds up.
C.Soft rock erodes.
D.Flat areas flood.

Answers

Answer:

Soft rock erodes

Explanation:

Often, waterfalls form as streams flow from soft rock to hard rock. This happens both laterally (as a stream flows across the earth) and vertically (as the stream drops in a waterfall). In both cases, the soft rock erodes, leaving a hard ledge over which the stream falls.

Answer:

c

Explanation:

Science myth: Tigers and goldfish are not related.
Fact:
Evidence:

Answers

Answer:

Fact:  Tigers and goldfish are actually related.

Explanation:

Evidence:  They may seem different cause one is a warm blooded animal and the goldfish a cold blooded animal. They share the same point in the phylogenetic tree.

Final answer:

Lions and tigers are more closely related to each other than to bears, as they both evolved from a common ancestor.

Explanation:

Scientists classify organisms not only by their physical features, but also by how closely related they are. Lions and tigers look like each other more than they look like bears, but are lions and tigers related? Evolutionarily speaking, yes. Evolution is the change in a species over time. Lions and tigers both evolved from a common ancestor. So it turns out that the two cats are actually more closely related to each other than to bears. How an organism looks and how it is related to other organisms determines how it is classified.

Hydrochloric acid from the stomach is neutralized in the small intestine by

Answers

The pancreas secretes bicarbonate, which neutralizes the hydrochloric acid from the stomach in the small intestine, providing an alkaline environment necessary for intestinal enzymes to function.

Hydrochloric acid (HCl) from the stomach, which creates a highly acidic environment necessary for the enzyme pepsin to break down proteins, must be neutralized when the stomach contents move into the small intestine. This is because the enzymes in the small intestine, such as trypsin and chymotrypsin, require a more alkaline environment to function effectively. Therefore, an organ called the pancreas secretes a base named bicarbonate (HCO3-) into the small intestine, which neutralizes the hydrochloric acid, maintaining a suitable pH for digestive enzymes to operate.

Hellllpppp ASAP it’s due in a few min

Answers

Answer:

C. Asexual reproduction requires one parent and offspring have identical DNA

What is the period of revolution of mercury

Answers

The orbital period of Mercury is 88 days.

Mercury's period of revolution is 88 Earth days while its rotation period is 59 Earth days, with a past misconception of tidal locking with the Sun.

Mercury's period of revolution is approximately 88 Earth days, meaning it takes that long to orbit the Sun. On the other hand, its period of rotation is 59 Earth days, which is about 2/3rds of its revolution period.

It was once believed that Mercury had a tidal locking with the Sun, keeping one face perpetually hot and the other cold, but observational evidence has shown otherwise.

A P E X
?What is an index fossil?
A. A fossil this is found all over the world
B. A fossil this is from an animal that did not evolve
C. A fossil that is more than 60,000 years old
D. A fossil found in rocks from one time period

Answers

Maybe D?? Let me know if it is correct.

A fossil found in rocks from one time period are called as an index fossil. Hence option D is correct.

What are fossils?

Fossils are defined as the ancient life's vestiges or traces that have been saved by natural processes. The majority of fossils are created when a living thing (such as an animal or plant) dies and is swiftly buried by sediment (such as mud, sand or volcanic ash). An organism must not devour itself or decay in order to become a fossil. If the creature either resides in or is relocated to a location where it may be buried and prevented from decomposing, this may occur.

Index fossils are defined as any plant or animal that has been preserved in the Earth's rock record and is unique to a certain geologic period or environment. A suitable index fossil needs to be unique or easily identifiable, plentiful, have a broad geographic distribution, and have a limited time range.

Thus, a fossil found in rocks from one time period are called as an index fossil. Hence option D is correct.

To learn more about fossils, refer to the link below:
https://brainly.com/question/6867325

#SPJ2

Global climate change is the result of increasing levels of carbon dioxide, methane, and other greenhouse gases in Earth's atmosphere. How are the causes of ocean acidification and climate change related to one another?
a) Acids in the ocean decompose to form carbon dioxide, which then diffuses into the atmosphere.
b) Warmer ocean temperatures increase the stability of carbonic acid and other acids in the water.
c) Carbon dioxide diffuses from the atmosphere to the ocean where it reacts to form carbonic acid.

Answers

Answer:

c

Explanation:

Ocean acidification is occurring because excess carbon dioxide (CO2) in the atmosphere is being absorbed at the surface of the ocean at an increasing rate. This excess CO2 results in more hydrogen ions, which increases the acidity of the ocean.

An increase in greenhouse gases majorly due to human activities is causing Global warming. Deforestation and increase pollutants in water, land and air altogether are the reason for global warming.

The correct answer is:

Option c) Carbon dioxide diffuses from the atmosphere to the ocean where it reacts to form carbonic acid.

The explanation for the statement is:

Global warming has increased the carbon dioxide, methane and other harmful chemicals in the environment.

The use of chemicals like CFCs, the release of smoke from factories, nuclear wastes have caused the heat to be trapped on the Earth surface, therefore increasing the planet's temperature.

Due to excess carbon dioxide present in the environment and on the surface of the ocean, it gets absorbed and causes acidification of the oceans.

Therefore, carbon dioxide diffuses in the ocean and forms carbonic acid.

To learn more about ocean acidification and climate change follow the given link:

https://brainly.com/question/19978601

TASK: Describe and explain the many stages involved in the development of a human embryo and fetus, as well as the
need for proper pregnancy care, nutrition, and overall healthy choices during pregnancy.

Answers

The very first stage of the development is the fertilization of an egg .It takes about 24 hours for a sperm cell to fertilize an egg. When the sperm  punctures the egg, the surface of the egg changes so that no other sperm can enter. At the moment of fertilization, the baby's genetic makeup is complete. The second stage is the two cells; this  stage occurs approximately 30 hours after fertilization and results in a 2-cell embryo. The next stage  is the 4 cell embryo is the result of a second cleavage event  and occurs at approximately 40 hours after fertilization. The individual cells are called blastomeres. At this stage the process of embryonic genome activation is started  in human embryos. Next is the 8 cell stage actually consisting of 6-12 cells develops by day 3 of human embryonic development now there is now an morula  or early-stage embryo consisting of 16 cells (called blastomeres) in a solid ball contained within the zona pellucida . 5 to 6 days there is a blastocyst or embryo that will develop into a baby .The fourth week ball of cells is splitting into the embryo  and placenta .The neural tube the building block of the spine brain and backbone is already formed.The amniotic sac and fluid are forming. This would be a good time for the mother to get good exercise  as well as to stop drinking and  smoking .The mother should also see a doctor and start taking prenatals. This is important because it helps with the development and growth of the baby . The next stage is 10 weeks. The baby is as big as a strawberry. At stage 16 the baby is the size of an avocado. 16 weeks of pregnancy the mother may notice an increase in  energy .Sleep is  important because lack of sleep can result in growth problems in the unborn baby. 20 weeks the baby is nearly formed this is the second trimester the mother should avoid raw meat,eggs,and fish. By 24 weeks your baby's organs are fully developed .

Explanation:

ps  I tried to make it as short as possible

_____________ is an ongoing process in which counselors gather information about clients from several different sources and use the information to make decisions for treatment planning. a. Assessment b. Diagnosis c. Appraisal d. Case conceptualization

Answers

The answer is a. Assessment

Parathyroid hormone: a. increases osteoblast activity to release more calcium ions into the bloodstream b. increases osteoclast activity to release more calcium ions into the bloodstream c. increases osteocytes activity to release more calcium ions into the bloodstream d. none of the above

Answers

Answer:

B

Explanation:

The parathyroid releases hormone that breaks down the bone to raise blood calcium level. Osteoclasts are responsible for breaking down the bone tissue.

Final answer:

Parathyroid hormone increases the blood calcium level by stimulating osteoclast activity, enhancing calcium absorption in the intestines, and reducing calcium loss through urine. It plays a crucial role in maintaining calcium homeostasis in the body.

Explanation:

The correct option is b. increases osteoclast activity to release more calcium ions into the bloodstream. Parathyroid Hormone (PTH) is primarily responsible for increasing the blood calcium level. It achieves this by stimulating the activity of osteoclasts, which are cells that degrade bone to release calcium. Additionally, PTH indirectly increases calcium absorption in the intestines by enhancing the synthesis and secretion of calcitriol (an active form of Vitamin D) in the kidneys. This hormone also facilitates the reabsorption of calcium in the kidney tubules, thus reducing the loss of calcium through urine, further maintaining calcium homeostasis in the body.

Learn more about Parathyroid Hormone here:

https://brainly.com/question/32197278

#SPJ12

Does the appearance of the cavefish and minnow suggest common ancestry?explain

Answers

Answer:

There are many unrelated species of cave fish and many unrelated species of minnow. 'Cavefish' and 'minnow' are colloquial words with no formal meaning. A fish that lives in a cave is a cavefish, no matter what its ancestors were like.

Explanation:

Are polar bears sexual or asexual

Answers

Answer:

polar bears are sexual

Once paired, the male and female stay together for a week or more. Females are induced ovulators - the act of mating causes a female to release an egg for fertilization. Several days of mating interactions may be required to stimulate ovulation and guarantee fertilization of the egg.

Populations of aspen trees in the western united states are being destroyed by an unexpected illness. The altered landscape is affecting the animals that live there. Populations of deer mice are increasing greatly in these areas. Unfortunately, these mice carry a disease which can be fatal in humans. This scenario best illustrates... a. The stability of the ecosystem is limited by the amount of water available b. Every population in an ecosystem is linked with other populations c. Ecosystems do not need a constant source of energy d. The altered landscape will always result in a disease due to biotic factors

Answers

Answer:

B. Every population in an ecosystem is linked with other populations

Explanation:

An ecosystem is a biological term which refers to all the biotic and abiotic factors present in a particular area which interacts with each other directly or indirectly and affect each other.

In the given case, the interactions and the direct or indirect dependency of the population to each other have been shown as the Aspen trees population which are destroyed by the illness leads to the increase in the population of deer mice. The increase in the population of deer mice can lead to the destruction of the human population as they carry a disease for humans.

Since one population is linked to others directly or indirectly, therefore, the selected option is correct.

An unidentified species of animal displays the following characteristics: bilateral symmetry, a complete digestive system, an open circulatory system, distinct body segmentation, and it molts when it grows. To which of the following animal phyla does this species most likely belong?

A) Annelida

B) Arthropoda

C) Nematoda

D) Platyhelminthes

E) Cnidaria

Answers

The unidentified species most likely belongs to phylum Arthropoda, as it exhibits key characteristics such as bilateral symmetry, segmented body, and molting, which are distinctive to this phylum.

An unidentified species showing characteristics such as bilateral symmetry, a complete digestive system, an open circulatory system, distinct body segmentation, and the behavior of molting when it grows is most likely to belong to the phylum Arthropoda. These features especially molting, which is referred to as ecdysis, are characteristic of ecdysozoans, and arthropods are a prominent group within the Ecdysozoa clade. Arthropods include well-known organisms such as insects, spiders, and crustaceans. Phylum Annelida, while also segmented, usually have a closed circulatory system, and they do not molt. Nematoda possesses an unsegmented body and does not display distinct body segmentation as the unidentified species does. Platyhelminthes and Cnidaria do not exhibit all of the characteristics listed; for example, Platyhelminthes do not have a segmented body, and cnidarians have radial symmetry, not bilateral.


The graph shows the populations of wolves and mountain lions in five different counties in Montana. Wolves and mountain lions compete for the same kinds of food resources. What conclusion could be stated regarding the relationship between the two predators within Clay county?

Answers

Answer:

The answer is B trust me if you want its your dicision

Explanation:

the fusing of an egg and sperm form a

Answers

Answer:

Zygote

Explanation:

ANSWER: form a diploid cell, known as zygote.

Joseph Smith is looking for a summer job as a bookkeeper or accounting assistant. Look at his resume. Then answer the
question.
What changes should Joseph make to this resume? Select three options.
Use a font that is easier to read and less ornate.
Fix the formatting so it is consistent throughout.
Change “graduating this year" to show the date.
Remove "Jackson Accountants" from "Experience" since it is an unpaid job.
Remove "Ma's Pizza" from "Experience" since it is not related to this summer job.

Answers

Answer:

Use a font that is easier to read

Fix the formatting to make it the same throughout

Change the graduation date

Explanation:

Make use of an easier-to-read typeface. Make the formatting consistent throughout by fixing it. Change the commencement date.

What is formatting?

Formatting is defined as the essay's appearance or presentation. Layout is another term for formatting. Headings, regular paragraphs, quotations, and bibliographic references are the four text types that the majority of essays use. The goal of formatting is to alter the font's style, size, color, and overall appearance.

Choose the text that needs formatting. The style is applied to the entire paragraph if your cursor is placed within one. To sample a style on the Home tab, point to it. Click the More option if you don't see the style you're looking for. Choose a look.

Thus, make use of an easier-to-read typeface. Make the formatting consistent throughout by fixing it. Change the commencement date.

To learn more about formatting, refer to the link below:

https://brainly.com/question/21934838

#SPJ5

Your uncle wants to create a dog small enough to fit into a purse. Of the hundreds of dogs on his farm, he breeds only the smallest 10% of them. He then breeds only the smallest 10% of their offspring, and continues to breed only the smallest 10% of each generation. Over 20 years, his group of dogs did become smaller (though not small enough to fit into a purse). Did he witness evolution?

Answers

Answer:

Yes, he witnessed a little bit of evolution.

Explanation:

Evolution is based upon the change in the heritable characteristic features of a species over time. This change does not happen suddenly, it happens gradually over generation after generations. The change in characteristic expression of genes are passed through from parents to their offspring during reproduction.  

He kept on breeding only the smallest one's generation after generation for long 20 years. His end result was having the smallest puppies though they are not too small to fit in the purse but still, evolution happened.

The process of selecting animals with desirable traits across successive generations represents a type of evolution through artificial selection.

The genotype of an organism is the combination of alleles observed in that organism. Moreover, a phenotype is the sum of all observable characteristics of the organism.

In artificial selection, animals or plants with desirable phenotypic traits are selected by humans to reproduce.

The process of artificial selection changes allele frequencies across generations, thereby leading to the evolution of desirable traits in offspring since the phenotype is influenced by the genotype.

In conclusion, the process of selecting animals with desirable traits across successive generations represents a type of evolution through artificial selection.

Learn more in:

https://brainly.com/question/1516624?referrer=searchResults

What are the three heads of the flexor digitorum superficialis?

Answers

Types of Flexor digitorum

Explanation:

The Flexor digitorum superficialis is set underneath the past muscle; it is the biggest of the muscles of the shallow gathering, and emerges by three heads such as humeral, ulnar, and radialInception: Medial epicondyle of the humerus Antagonist: Extensor digitorum muscle Insertion: Phalanges Test flexor digitorum superficialis, one finger is flexed at the proximal interphalangeal joint against opposition, while the staying three fingers are held completely reached out (to inactivate flexor digitorum profundus)

From the information presented in the movie, what can you conclude about dark matter ??

Answers

Answer: First propounded in 1960 by United States scientists Nelson Hairston, Frederick Smith and Lawrence Slobodkin, the hypothesis states that predators more than plant defences are responsible for limiting herbivore spread which would, in turn, lead to large scale destruction of plant life

Explanation:

The _____ _______, which is in the units mg/100 mL plasma, is the maximum concentration of a substrate that the kidneys can reabsorb. This depends on the transport maximum and the flow rate of the fluid in the nephrons.

Answers

Answer:

renal threshold

Explanation:

The concentration of a particular substance that is dissolved in the blood above which the substance is removed from the body in the form of urine is known as renal threshold. The renal threshold of different substances varies as the ability to hold diferent substances varies by the kidney. Along with the substance, the physiological conditions and the species also influence the renal threshold. If the renal threshold for a substance is lowered then lower blood levels compounds will be excreted out and if the threshold is higher then opposite will occur.

(a)
Which of the following is the best definition of a species?
Tick () one box.
Organisms with many features in common
Organisms that live in the same habitat and eat the same
food
Organisms that reproduce together to form fertile offspring​

Answers

Answer:

Organisms that reproduce together to form fertile offspring​

Explanation:

The best definition of species is the organisms that reproduce together to form fertile offsprings. Therefore, the correct option is D.

What are species?

Species refers to the related organisms that are similar in form and function and are capable of interbreeding to form fertile offsprings.

The concept of species is the fundamental unit of classification in biology and is used to organize the diversity of the life into a manageable and scientifically useable system.

Species are typically defined based on their genetic, morphological and behavioral characteristics.

For example- Two organisms are said to be of the same species if they have a similar DNA sequence, look alike and can interbreed to produce offspring of that are also capable of reproducing.

In conclusion, species are the key unit of classification in biology. Therefore, the correct option is D.

For more details regarding species, visit:

https://brainly.com/question/1165742

#SPJ6

Cardiovascular effects of the sympathetic division include all except ________. cardiovascular effects of the sympathetic division include all except ________. constriction of most blood vessels increase of heart rate and force dilation of the blood vessels serving the skin and digestive viscera dilation of the vessels serving the skeletal muscles

Answers

Answer:

The preferable option for the fill in the blanks will be - C.

C.  dilation of the blood vessels serving the skin and digestive viscera

Explanation:

6) Cardiovascular effects of the sympathetic division include all of the following except the dilation of the blood vessels serving the skin and digestive viscera.

The given options were -

A) constriction of most blood vessels

B) increase in heart rate and force

C) dilation of the blood vessels serving the skin and digestive viscera

D)weak dilation of the blood vessels of skeletal muscles during exercise

The sympathetic division includes all except dilation of the blood vessels serving the skin and digestive viscera. Thus, option C is correct.

The sympathetic division causes vasoconstriction of blood vessels, particularly in areas such as the digestive system and skin. This helps to divert blood flow to more critical areas such as skeletal muscles and organs involved in the stress response.

It causes vasodilation of blood vessels that supply skeletal muscles. This allows for increased blood flow to these muscles, ensuring they receive adequate oxygen and nutrients to support physical activity. Thus, option C is correct.

Learn more about dilation, here:

https://brainly.com/question/13171673

#SPJ6

In 4 o’clock flowers the alleles for red and white flower color are incompletely dominant to one another and both affect the phenotype of the plant. If you cross a red flowered plant with a pink flowered plant, what are the possibilities of the offspring?
R-Red flowers
r-White flowers

Answers

Do you still need help?!?!

Crossing a red 4 o'clock flower (RR) with a pink one (Rr) results in a 1:1 ratio of red (RR) to pink (Rr) flowered offspring due to incomplete dominance, where neither red nor white alleles are fully dominant.

In the case of the 4 o'clock flowers, where red (R) and white (r) flower color alleles exhibit incomplete dominance, crossing a red flowered plant (RR) with a pink flowered plant (Rr) would produce offspring with the following possible genotypes and phenotypes:

RR (red flowered)Rr (pink flowered)

Since the red flower is homozygous (RR), and the pink flower is heterozygous (Rr), we would expect the following genotype ratio from the offspring: 1 RR (red) : 1 Rr (pink), which translates into a 1:1 phenotypic ratio for red to pink flowers. This is because the allele for red flowers (R) is not completely dominant over the white allele (r), resulting in the pink phenotype when a plant has one of each allele (Rr).

The chloroplasts of flowering land plants typically contain at least two photosynthetic pigments

Answers

Answer:

Chlorophyll A, and B.

Explanation:

Chlorophyll is known as the green pigment which is present in plants. Through the process of photosynthesis, It helps to convert solar light into useful energy. They have light absorption properties, so they are known as photoreceptors. Mainly two types of Chlorophyll are present in plants:

Chlorophyll A: It Is known as the primary photosynthetic pigment and has the ability to absorbs red, blue, and violet lights. Chlorophyll A is the location of the photochemical processes and can absorb light which is needed for the process of photosynthesis.

Chlorophyll B: It mainly helps to absorb blue light which is utilized to fill out the absorption of chlorophyll A it means it helps to supply additional light energy to chlorophyll A. It is known as the accessory pigment.

Use the drop-down menus to complete each statement.
Scientists discovered that new molten materials from inside Earth create new___
Rocks closest to the center of a mid-ocean ridge are____
than those that are farther away

Answers

Answer:

crust and younger

Explanation:

Trust me i just did it and got it correct:)

Which property would best distinguish sediment deposited by a river from sediment deposited by a glacier?

A) thickness of sediment layers
B) age of fossils found in the sediment
C) amount of sediment sorting
D) mineral composition of the sediment

Answers

Answer:

Which property would best distinguish sediment deposited by a river from sediment deposited by a glacier?

thickness of sediment layers

Explanation:

Glaciers deposit rocks unlike river sediment that are less thicker than glacier's own

Final answer:

The amount of sediment sorting is the best property to distinguish river-deposited sediment, which is well-sorted and stratified, from glacier-deposited sediment, which is unsorted and known as till.

Explanation:

The best property to distinguish sediment deposited by a river from sediment deposited by a glacier is the amount of sediment sorting. Sediment deposited by running water, such as rivers, will exhibit a good degree of sorting because water's flow differentiates sediment particles by size, depositing them accordingly. This leads to stratified drift, with grains size and sorting differential layers indicative of water deposition. In contrast, sediment deposited by glaciers, known as till, is typically unsorted and consists of a chaotic mix of material of various sizes, reflecting the indiscriminate carrying and depositing power of glacial ice.

Suppose a study finds a negative correlation between levels of a particular enzyme in the brain and the severity of mania in people suffering from bipolar disorder. Which of the following is the most accurate conclusion to make based on this evidence

A. Low levels of the enzyme cause bipolar disorder.
B. There is no relationship between the enzyme and mania.
C. Having low levels of the enzyme is associated with high mania.
D. Having high levels of the enzyme is associated with mania.

Answers

Answer:

its b

Explanation:

hope im right

Other Questions
Read the following paragraph and answer the question below.1Wuthering Heights is in the midst of the desolate English moors. 2Outside the gates of this solitary dwelling, the landscape expands into dreary shades of brown and gray, with only the craggy cliffs on the distant horizon to break the monotony. 3Wildlife and foliage are scarce. 4The few trees that do live must eke out their existence: the north wind blows constantly. 5The house itself, built to withstand the tumults of wind and rain, is cold and forbidding. 6The stone walls and earthen floors offer no relief from the bone-chilling dampness of northern England. 7In sharp contrast to Wuthering Heights is Thrushcross Grange. 8Situated in a sheltered valley, Thrushcross Grange is calm and peaceful, and is surrounded by lush flower gardens. 9The refined elegance of Thrushcross Grange differs as much from Wuthering Heights as the rose differs from the thorn. 10The contrast between these two settings is symbolic of the ultimate conflicts in Emily Bronte's novel Wuthering Heights.Name the shape of the paragraph. __________ .A)regular triangle B)inverted triangle C) diamond D) rectangle Below is the double-stranded DNA sequence of part of a hypothetical yeast genome. Within this sequence is a small gene, PICO8, that codes for an 8 amino-acid peptide (assume traditional start codon). Transcription of PICO8 starts at the Transcription Start Site (TSS) after the promoter and proceeds in the direction of the arrow. Transcription stops at the end of the transcription terminator. 5' - CTATAAAGAGCCATGCATATCTAGATAGTAGGCTCTGAGAATTTATCTCACT - 3 3 - GATATTTCTCGGTACGTATAGATCTATCATCCGAGACTCTTAA ATAGAGTGA - 5 promoter terminator Which strand of DNA is the CODING strand? (TOP OF BOTTOM?) Select only ONE answer choice. A. Top B. Bottom C. Either can serve as the codong strand D. There isn't enough information to determine which is the coding strand The Confederacy held captured Union soldiers in a military prison located in As a result of mitosis, in a human body cell, the nucleus of each daughter cell contains _________ chromosomes. Ethan and Chloe shared 50 in the ratio 1:4 Which are evidence of seafloor spreading? Select three options. There are 14 books on a shelf. 6 of these books are new.(a) What is the ratio of used books to all books?(b) What is the ratio of new books to used books?? an elevator at a construction site has a maximum capacity of 2500 pounds. if the elevator operator weights 160 pounds and each cement bag weighs 60 pounds, how many bags of cement can be safely lifted on the elevator in one trip? What is the image point of (6,-1) after a translation left 4 units and down 5 units? What is the value of a? Word bank:borrarchrtercorreo basuraen lneaesnobestrsGUSTAVO Voy a leer el correo electrnico.REBECA Bah, yo slo recibo ____________. Lo nico que hago con la computadora es ________________ mensajes.GUSTAVO Mira, cario, hay un anuncio en Internet: un viaje barato a Punta del Este. Es un vuelo ___________________.REBECA ltimamente tengo tanto ____________________. Sera buena idea que furamos de vacaciones. Pero busca un hotel muy bueno.GUSTAVO Rebeca, no seas ___________________, lo importante es ir y disfrutar. Voy a comprar los boletos ahora mismo ______________________. IM giving 15 points please help!a 42 meter lighthouse is observed by a ships officer at a 65 degree anlge to a path of the ship. At the next sighting, the lighthouse is observed at a 42 degree angle. To the nearest meter what is the distance between the 2 sightings? What made Jake suspicious about the man with the camera?he was wearing dark glasseshe took a photo of themhe was the same man who sold Jake the maphe had followed them all dayIts C A researcher has developed a measure of a person's ability to detect colors. He finds the measure is not related to a person's spelling ability, which is a different type of measure. This finding is an example of _______ validity.a. convergentb. discriminantc. faced. concurrent Put in the counts under the notesPlease me help me The impact of the foot-in-the-door phenomenon is most clearly illustrated by What is the area of a rectangle 15 feet by 2 feet's rectangle. The shape of a flag is a rectangle. The length is 15 ft. And the width is 2 feet. What is the total area of the rectangle? Under what condition were Roman women allowed to run businesses? In the future, passengers will board a spaceship for the first interstellar flight.Which does interstellar most likely mean?A. between the starsB. beyond the starsC. into the stars A car was purchased for $25,000. Research shows that the car has an average yearly depreciation rate of 18.5%. Create a function that will determine the value V(t), of the car t years after purchase. Determine to the nearest cent, how much the car will depreciate from year 3 to year 4