how does o2 travel from your lungs to your muscles

Answers

Answer 1

it attaches to hemoglobin molecules in red blood cells and travels with the blood. It then detaches from it and enters muscle cells.


Related Questions

Why is carbon dioxide considered a greenhouse gas? (A) It is released when fossil fuels are burned. (B) It is part of the carbon cycle, which is also known as the greenhouse cycle. (C) It can absorb infrared radiation. (D) It is responsible for protecting organisms from UV radiation.

Answers

Answer:

C It can absorb infrared radiation

Explanation:

How does the biological species concept identify two different species?
A. reproductive isolation
B. asexual reproduction
C. interaction between two species
D. the difference in the way of life

Answers

Answer:

D or C

Explanation:

just for the heck of it

Answer:

i think the answer is C.

Hope it helps

Explanation:

A nerve impulse travels from one cell to another by passing
A- one axon to another axon
B- one dentrite to an axon
C- one axon to a dentrite
D- one dentrite to another dentrite

Answers

The answer is C.

The reason why is because when the nerve impulse reaches the axon then moves its way to the bottom where the dentrite is, chemical messengers called neurotransmitters are released.

Which process involves making glucose without energy from sunlight?
A. Photosynthesis
B. ATP formation
C. NADPH formation
D. Chemosynthesis

Answers

Answer:

Chemosynthesis

Explanation:

Its right trust me

the correct answer is chemosynthesis <3

How is an egg fertilized in flowering plants?


A.
with sperm


B.
by spores


C.
with an ovule


D.
with embryos

Answers

Answer: A. with sperm

Explanation:

How is a scientific law different from a scientific theory?

A. A theory becomes a law after a long period of time has passed.

B. theory is why something happens and a law is how something happens.

C. A theory cannot be disproved but a law can be disproved.

D. A theory is used for biology and chemistry and a law is used for physics.

Answers

Final answer:

A scientific law is a concise statement that describes a pattern or behavior in nature, while a scientific theory is a more complex and dynamic explanation of a group of related phenomena.

Explanation:

A scientific law is a concise statement that describes a pattern or behavior in nature that is supported by evidence and repeated experiments. Laws are often expressed in the form of a single mathematical equation. On the other hand, a scientific theory is a more complex and dynamic explanation of a group of related phenomena. Theories attempt to explain why nature behaves the way it does, while laws describe what happens.

Final answer:

A scientific law describes how something happens using a concise pattern in nature, often expressed as a mathematical equation, like F = ma for Newton's second law of motion. A scientific theory is a more complex explanation of why phenomena occur, such as the Theory of Evolution or the Theory of Relativity, and evolves over time as new evidence is found.

Explanation:

The question on how a scientific law is different from a scientific theory can be best answered by choice B: A theory explains why something happens and a law describes how something happens. A scientific law uses concise language to express a generalized pattern observed in nature, often supported by significant scientific evidence and can be demonstrated through repeated experiments. Laws can typically be distilled into mathematical equations or principles. An example is Newton's second law of motion, represented by the equation F = ma, which describes the relationship between force, mass, and acceleration.

On the other hand, a scientific theory is more complex and dynamic, providing an overarching explanation for a group of related phenomena based on a body of evidence. Theories, such as the Theory of Evolution or the Theory of Relativity, are comprehensive and explain why things occur as they do in nature. They are not concise enough to be summarized into a single equation or statement. Unlike a law, a theory does not transform into a law over time; they continue to evolve as new evidence emerges.

At which region of a state's geology would an earthquake be more likely?



Near a divergent boundary of two plates


At the site of geologic uplift where island chains form


At the site of a convergent boundary as plates move together


Around a transform boundary between two plates that slide past each other

Answers

Answer:

Around a transform boundary between two plates that slide past each other

Explanation:

There are several problems with classifying organisms into six kingdoms of life. One problem is that _______ aren't well defined and are very diverse. In addition, any eukaryotes that don't fit into other kingdoms are placed in this kingdom. A. fungi B. plants C. archaea D. protists

Answers

Answer:

D. Protists

Explanation:

Kingdom protista is composed of mostly unicellular organisms, but they do include some multicellular organisms. Like your problem says, eukaryotes that do not fit in other kingdoms are placed in this kingdom. As a result, even members of this kingdom do not share many similarities, as the organisms here are diverse.

The answer is D. Protists

The information contained in the table could be used _______________________.

Answers

Can you attach the table so I can see it??

Answer:

A

Explanation:

to establish the degree of relatedness among these organisms The more similar the DNA, the greater the degree of relatedness, or the more recent in time the two organisms diverged from a common ancestor. If there is a great difference in DNA sequencing, this suggests that the organisms shared a common ancestor a long time ago.

Anyone can help to explain this: Many people (even health professionals) tend to think that overweight people can never be malnourished because they are healthy.

Answers

Well, I don't believe that you can be overweight and healthy unless it is muscle mass that makes you "overweight". Many overweight people actually are malnourished because they are likely eating unhealthy processed food such as fast food. When you eat this constantly, you are depriving your body of essential vitamins and nutrients. These nutrients and vitamins are essential for building muscle mass, so is exercise. If you are overweight, you are probably not exercising like you should. Unhealthy food choices, low muscle mass, and lack of exercise can dramatically lower one's metabolism. If your metabolism is slow, it takes longer for your body to take in the needed nutrients and vitamins.

What happens to a virus involved in the lysogenic cycle?

Answers

Answer:

The lytic cycle involves the reproduction of viruses using a host cell to manufacture more viruses; the viruses then burst out of the cell. The lysogenic cycle involves the incorporation of the viral genome into the host cell genome, infecting it from within.

Why did Isaac Newton conclude the universe was static? Was he correct?

Answers

He thought the ‘stuff’ (celestial  bodies) in the universe that had mass attracted each other through the force of gravity. Therefore even the bodies at the edge of the universe would be attracted by gravity by the bodies inside the universe preventign them from moving further outward.

He was wrong, however, because it has been discovered, using Doppler shift effect, that the universe is actually expanding.

Sunlight-Rose-Honeybee-Skunk-Eagle
study the food chain above. if the population of homeybees had a major increase, which of the following would most likely happen.​

Answers

The rose population would decrease because the bees would need more food. Since the skunk has more food, it would increase and the eagle population would probably increase too because of more access to skunks. The eagle interpretation may be true unless the eagle is perceived as a scavenger. Then the population would most likely stay the same. The sun would stay the same because it is an abiotic factor in an ecosystem. your welcome fam

Sunlight is the same (obvs) then roses decrease because there are more honeybees to eat them. Skunks would probably increase bc there are lots more honeybees to eat but then honeybees decrease probably. Eagles increase cos skunks increased after honeybees increased. Basically sunlight stays same, roses dercrease and the rest increase.

The history of Taurus

Answers

Answer:

The zodiacal sign of Taurus does not coincide with the constellation of Taurus. It is a continuation of the sign of Aries and represents the second 30 degrees of the zodiacal circle. The sign of Aries represents the beginning of spring and with it the beginning of life, while Taurus is a fixed sign that continues what Aries has started. Life is in full bloom in the sign of Taurus.

The stars in Taurus constellation host two open clusters, the Pleiades and the Hyades and are mostly located at the end of the sign of Taurus and the beginning of the zodiacal sign of Gemini. In the Early Bronze Age it marked the location of the Sun during the spring equinox, just like the constellation of Aries represented the equinox over 2000 years ago. The constellation of Taurus was linked to it 5000 to 1700 BC, before the precession of the equinox moved our perspective to the sign of Aries.

Answer:

The zodiacal sign of Taurus does not coincide with the constellation of Taurus. It is a continuation of the sign of Aries and represents the second 30 degrees of the zodiacal circle.

Explanation:

How do invasive species disrupt an ecosystem? Describe at least one example of when invasive species have disrupted an ecosystem. Your example could be a plant, animal, fungus, ext. (please please please help!!)

Answers

Answer:

Explanation:

I think one of the most invasive species is perhaps the Dandelion. Who hasn't had a fit when we see them change from yellow to gray. The yellow is pretty, but the gray means it is ready to spread its seed to create more trouble.

Dandelions can be killed with herbicides, but I think you'd be as well off putting up with the dandelion. The herbicides have an unproven effect on our health.

The dandelion was introduced into the Americas in the mid 1600s and was used as food and had medical properties. Since then, because it has no common enemy in nature, it has spread the entire width of the continent. Rather amazing, I think.

When a new aggressive species is introduced into an ecosystem, it may not have any natural predators or controls. They can breed quickly and take over an area and native wildlife may not have evolved defenses against the invader. The invader also takes over the natural resources for the native species. Aggressive plant species like Kudzu can quickly replace a diverse ecosystem with a monoculture of just Kudzu. Additionally, some invasive species are capable of changing the conditions of an ecosystem, such as changing soil chemistry or the intensity of wildfires.

Solve this Sex-Linked traits practice problem

Answers

We know that hemophilia is a recessive trait, and the only way to express a recessive trait is to have a homozygous mixture. So, the genotypes probably look like this:

BB = normal blood clotting
Bb = carrier for hemophilia
bb = hemophiliac

Because the mother does NOT have hemophilia, we will be using BB x Bb to find out the alleles of their children. Because this is sex-linked traits practice, our alleles will be the following.

normal = X^BY
(uppercase B represents no hemophilia)

X^BX^b

Let’s cross them and see what we get!

X^B Y

X^B | X^BX^B X^BY

X^b | X^BX^b X^bY

As you can see, 0/4 of the females (represented by XX) will have hemophilia. Again, it is only present when there are two recessive alleles and none of them satisfy that.

2/4 of the females will be carriers (X^BX^b).

As for the boys, 1/4 will have normal clotting and 1/4 will have hemophilia. None of the males will simply be carriers.

I hope I helped!
Feel free to ask me for more assistance (if needed); I’ll gladly help! :)



Nitrogen oxide is released when _____. hydrocarbons combine with water plants make food through photosynthesis special bacteria break down nitrogen fuels are burned at high temperatures

Answers

Answer:

Nitrogen fuels are burned at high temperatures

Explanation:

When the nitrogen-based fuel is burned at high temperatures, the nitrogen in the fuel combines with oxygen to form nitrogen oxide. While this can occur n combustion engines in cars, leading to pollution, the same occurs naturally espically during lightning strikes that cause the nitrogen gas in the atmosphere combine with oxygen. NO is an airway irritant.

Answer:

it´s D I got it correct

Influenza, or the flu, is an infectious disease that affects mammals and birds. The flu cannot be treated with antibiotics because
A.
it is caused by two unique strains of bacteria.
B.
it is caused by a fungus, not a bacterium.
C.
it is caused by a virus, not a bacterium.
D.
it is caused by a highly resistant strain of bacteria.

Answers

Answer:

C. It is caused by a virus, not a bacterium

Explanation:

The answer is C influenza is caused by viruses not a bacterium

viruses invade your cells and the antibiotics can’t get to your cells through the blood they can only kill bacteria which harbours inside the blood


Which event would MOST LIKELY speed up the process shown in the diagram?
A) another ice age
B) continental drift
C) a reversal in Earth's magnetic field
D) an increase in atmospheric carbon dioxide

Answers

an increase in atmospheric carbon dioxide

Answer: D

Answer: D) an increase in atmospheric carbon dioxide

Explanation: usatestprep approved

Which part of a mushroom can you see above the ground?

Answers

Answer:

The correct answer is reproductive part.

Explanation:

The mushroom belongs to the family of fungus. It is composed of two parts one underground part called as mycellium and the other part which can be seen above the ground. This part is the reproductive part of mushroom which is often edible. The other parts of the mushroom includes stem, hypae, volva, spores, gill, ring cap. There are variety of mushrooms available but all the forms are not eatable some of them are poisonous to human health.

What evidence makes scientists think that land plants evolved from green algae

Answers

Answer:

Because the algea was not strong enough yet to live on its own and had to stay close a water source, where it could get water and sunlight without doing any work.

Explanation:

Final answer:

Scientists believe that land plants evolved from green algae due to shared physical traits, biochemical pathways, and their common monophyletic heritage. These include similar mechanisms of cell division, storage of starch, the presence of chlorophyll as a photosynthetic pigment, and being part of the same photosynthetic lineage, the Archaeplastida.

Explanation:

The evidence that leads scientists to believe that land plants evolved from green algae is rooted in various shared characteristics and evolutionary lineage. Green algae, especially the Charophytes, share several traits with land plants, such as having chlorophyll a and b as photosynthetic pigments, cellulose cell walls and starch as a storage molecule. Another crucial point to note is a common mechanism of cell division and significant biochemical pathways.

Furthermore, evolutionary thought indicates that all plants, including green algae and land plants, are monophyletic, meaning they descend from a common ancestor. The transition from water to land posed significant challenges to plants in the form of avoiding drying out, spreading reproductive cells in air, developing structural support, and capturing sunlight. Characteristics like these were developed during evolution by both green algae and land plants.

Lastly, the Archaeplastida, which includes green algae and land plants, became photosynthetic through an endosymbiotic relationship with a green, photosynthetic bacterium around 1.65 billion years ago. This lineage evolved into what we know today as red and green algae, and eventually land plants such as mosses, ferns, gymnosperms, and angiosperms. These shared traits and the evolutionary history demonstrate the strongly supported theory that land plants evolved from green algae.

Learn more about Evolution of Land Plants here:

https://brainly.com/question/12045339

#SPJ3

A pure substance has a/an _______ composition.
A/An _______ is composed of two or more types of matter that can be present in varying amounts.
A solution is a/an _______ mixture.
A mixture that is not uniform throughout is a/an _______ mixture.
A pure substance that cannot be broken down chemically is a/an _______.
A characteristic of matter that’s not associated with a change in its chemical composition is known as a/an _______ property.
Wax melting is an example of a/an _______ change in the state of matter.
A banana peel turning brown is an example of a/an _______ change in the state of matter.

Answers

Answer:

constant

mixture

homogeneous

heterogeneous

element

physical

physical

chemical

Explanation:

A good answer should contain the following:

got this from penn foster

A pure substance has a/an constant composition. A  pure substance is defined as the substance that has a fixed chemical composition throughout such as water, nitrogen and air.

A/An mixture  is composed of two or more types of matter that can be present in varying amounts. A mixture is composed of one or more pure substances in varying composition.

A solution is a/an homogeneous mixture.

A mixture that is not uniform throughout is a/an heterogeneous mixture.

A pure substance that cannot be broken down chemically is a/an element.

A characteristic of matter that’s not associated with a change in its chemical composition is known as a/an physical property.

Wax melting is an example of a/an physical change in the state of matter.

A banana peel turning brown is an example of a/an chemical change in the state of matter.

For more details regarding physical and chemical property of matter, visit:

https://brainly.com/question/13339068

#SPJ2

Linnaeus is considered the "Father of _____." Modern Taxonomy Botany Zoology

Answers

Answer:taxonomy

Explanation:

Modern Taxonomy

Carolus Linnaeus it credited with developing the scientific naming and classification system.

Hope this helps!!

Which part of a sperm cell is responsible for providing the cell's energy?

A.
round head

B.
mitochondria section

C.
flagellum

D.
cell wall

Answers

B. The mitochondria section stores all the cells energy

A population of 20 monarch butterflies colonizes a meadow. The meadow's carrying capacity for monarch butterflies is 5,000 individuals. What statement best describes the growth of the population of monarch butterflies after the meadow is colonized?
A.
The population grows at a constant rate until it approaches 5,000 individuals, and then its growth rate increases.
B.
The population grows exponentially until it approaches 5,000 individuals, and then the population size begins to decrease.
C.
The population grows exponentially until it approaches 5,000 individuals, and then its growth rate decreases.
D.
The population grows at a constant rate until it approaches 5,000 individuals, and then the population size remains stable.

Answers

Answer:

The only possible answer is D, which states that the population will reach 5000 and after that the growth will stabilise (exactly what would hapen in a logistic growth).

Hope This Helps!  Have A Nice Day!!

Answer:

The correct answer is option D, that is, the population grows at a constant rate until it approaches 5,000 individuals, and then the population size remains stable.

Explanation:

The maximum capacity of the monarch butterfly, which can thrive in the meadow is 5000, which signifies that the population of twenty butterflies will continue to grow unless and until it attains the population of 5000.  

In case if the growth of the population takes place exponentially, then there would be an end and the limit of 5000 would not have any significance. However, if the growth of the population takes place logistically, then the end of the growth would be the same as the limit that signifies that the 5000 limits would exhibit significance.  

Thus, the only probable answer would be option D, that is, the population will attain 5000 mark and post that the growth will become stable, which precisely takes place in a logistic growth.  

In order from less complex to more complex, which level of organization is directly after tissue?

Answers

Elements. Knowledge of basic science includes the distinction between atoms and molecules, and elements, mixtures and compounds. ...

Molecules. The size of molecules varies enormously depending on the type of molecule.

Organelles.

Cells.

Tissues.

Organs.

Organ Systems.

Organism.

Answer:

a

Explanation:

hope it helps

The Serengeti plains are part of the African savanna ecosystem and are home to a variety of different species of plants and animals. The Serengeti plains experience a seven-month period of seasonal drought each year, during which the ecosystem receives only four inches of rain and the availability of some resources becomes very scarce. Which type of limiting factors does the seasonal drought in the Serengeti plains affect?

Answers

Answer:

Water is the limiting factor that the Serengeti plains affect.

Explanation:

From the explanation, Serengeti plains experience a seven-month drought during which only 4 inches of rain is received.

This is a limiting factor that maimes the growth and spread of organisms across the plain.

Due to less amounts of rainfall, there shall be minimal growth of vegetation, this in turn shall lead to loess supply of food for organisms and hence higher mortality rate and low birth rate.

Answer:

density- independent factors

Explanation:

Frost wedging happens when__

Answers

Answer:

Frost wedging occurs as the result of expansion of water when it is converted to ice. Cracks filled with water are forced further apart when it freezes.

Answer: The correct option is water freezes inside a rock, causing it to break

Explanation:

(WILL MARK BRAINLIEST, I NEED HELP URGENTLY)

What is the DNA Sequence, Resulting mRNA sequence, Complementary tRNA
sequence, and Resulting Amino Acid sequence

Answers

Answer:

a.The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’

(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)\

b.The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’

c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’

(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)

d.The third codon is 5’ ACC 3’.  Therefore, the corresponding anti-codon is 5’ GGU 3’

Which of the following is not true of most sex-linked traits?

A. Located on the X chromosome
B. Located on the autosomes
C. Usually recessive
D. Usually seen in males

Answers

Answer:

a

Explanation:

Final answer:

Sex-linked traits refer to those associated with genes located on sex chromosomes. They are typically recessive and more common in males. The statement that these traits are located on autosomes, which are non-sex chromosomes, is incorrect.

Explanation:

In studying genetics, we learn that sex-linked traits are primarily associated with genes located on sex chromosomes. These traits, more often than not, are recessive and more common in males, as they carry only one X chromosome and, therefore, express all traits that are linked to this chromosome.

Yet, the statement that sex-linked traits are located on autosomes is not true. Autosomes are all the other chromosomes that are not sex chromosomes. Hence, the answer to your question is option B: Sex-linked traits are not located on the autosomes.

Learn more about Sex-linked Traits here:

https://brainly.com/question/1381309

#SPJ3

Other Questions
what tests were able to determine when continental crust was formed How did the war affect the migration of workers in the United States? People moved to rural areas to work on farms. People moved to warmer climates to enjoy increased leisure time. People moved to cities that had built up industries for war production. People moved to the North and Northeast to work in factories. when dealing with two rational expressions that have different denominators, how would you find a common denominator. What effect would that have on the numerators of the expression According to the fundamental theorem of algebra, how many roots does the polynomial f(x)=x4+3x2+7 have over the complex numbers, and counting roots with multiplicity greater than one as distinct? (i.e f(x)=x2 has two roots, both are zero). What is the amount that shareholders contribute PERGUNTA 6 A sociedade humana composta por organizaes que fornecem os meios para o atendimento das necessidades das pessoas. Servios de Sade, gua e energia, segurana, alimentao, diverso, ou seja, tudo depende de organizaes. As organizaes podem ser vistas como sistemas abertos, os quais tomam entradas do ambiente, e por meio de uma srie de atividades os convertem em produtos e servios (sadas). Todas as organizaes precisam de objetivos claros para determinar suas atividades e alcanar as sadas e a realizao de metas. Please help me out with this Which word describes an angle with a measure of 98"?A) Obtuse B) Right C)AcuteD) Complementary What is the cosine ratio for angle F? What is the value of x if 15 = 5x + 45 ? How to write repeating decimals as fractions During what types of weather should a flag not be flown? Why? The graph given above shows the following functiony= cos(x)What is the amplitude of the function?a. 2b. pi c. 2pi d. 1 Explain the advantages and disadvantages of watching a video compared to reading about the same topic. which format do you prefer and why? Given the following triangle, if c = 25 and 2 A= 20, find a. Which equation would best help solve the following problem?Maria releases a javelin 1.5 m above the ground with a initial vertical velocity of 22 m/s. How long will it take the javelin to hit the ground?(Possible answer in picture) The general term of an arithmetic sequence is tn = 32 + 3n, where n N and n 1. The sequence is A)32, 35, 38, 41, 44, 47,... B)32, 96, 288, 864, 2592, 7776,... C)34, 39, 44, 49, 54, 59,... D)35, 38, 41, 44, 47, 50,... What is 50 percent of 62? FILL IN HE BLANK in this paragraph about the Pacific Theater of World War II.Japan aimed at conquering the small islands in the Pacific Ocean one by one. This strategy of controlling one small island after another is called_______. The equation of a circle is given. What is the diameter of the circle? Round to the nearest tenth. (x-2)2 + (y+3)2 = 52