Question 17 The Earth's average density is 5.5 g/cm" Yet the density of rocks at the surface are typically 2-4 g/cm". What does that tell you about what the density must be closer to the center of the Earth? you about what the density

Answers

Answer 1

Answer with explanation:

Since the density of the rocks at the surface of earth equals [tex]2-4gm/cm^{3}[/tex] which is much lesser than the average density of the earth equaling [tex]5.5gm/cm^{3}[/tex] thus we conclude the density of material closer is greater than [tex]5.5gm/cm^{3}[/tex].This can be mathematically shown as under:

[tex]\rho _{earth}=\frac{\rho _{surface}+\rho _{core}}{2}\\\\5.5gm/cm^{3}=\frac{(2-4)gm/cm^{3}+\rho _{core}}{2}\\\\\therefore \rho_{core}=[2\times 5.5-(2-4)]gm/cm^{3}\\\\\therefore \rho_{core}=(7-9)gm/cm^{3}[/tex]

Thus we conclude that the density of the matter closer to the center ranges between [tex]7-9gm/cm^{3}[/tex]

Answer 2
Final answer:

The density closer to the center of the Earth must be higher than the surface due to compression and the composition of concentric shells with increasing density.

Explanation:

The average density of the Earth is 5.5 g/cm³, while the density of rocks at the surface is typically 2-4 g/cm³. This tells us that the density must be higher closer to the center of the Earth.

The Earth is not uniform and is composed of concentric shells with different densities. The density increases as we move closer to the center. The inner core of the Earth is the densest part, with a density of nearly 14 g/cm³.

The increase in density closer to the center is due to compression caused by the weight of overlying material.


Related Questions

1. What do we mean when we say the Universe is expanding? Is the space between planets in our solar system, or the space between stars in our galaxy expanding, or is something else meant entirely? How does the concept of the expansion of the Universe give us its current age?

2. Carl Sagan famously said that we are "star stuff." In what sense is this true?

3. What is meant by observable Universe? What is the difference between the observable Universe and the entire Universe?

Answers

Final answer:

The Universe's expansion refers to the increasing distance between galaxies, supporting an estimate of its age being 13.8 billion years. 'We are star stuff' means life's elements came from stellar phenomena. The observable Universe is all that we can see from Earth, limited by the speed of light and the Universe's age.

Explanation:

When we say the Universe is expanding, we mean that the distance between galaxies is increasing over time. This doesn't mean that the space between planets in our solar system or the space between stars in our galaxy is expanding, but rather the vast space between galaxies.

This concept helps us determine the age of the Universe as we can trace the expansion rate backwards in time to get an estimate, currently about 13.8 billion years.

Carl Sagan's quote, "we are star stuff," means that the elements that make up life on Earth originated from stellar phenomena. Stars, during their life and at death, produce and distribute many of the heavy elements found in nature, including the ones necessary for life.

The term observable Universe refers to the portion of the Universe that we can theoretically observe from Earth. It's bounded by the distance light has been able to travel since the Big Bang. The entire Universe is likely much larger, potentially infinite, but due to the speed of light and the age of the Universe, we can't observe it in its entirety.

Learn more about Universe here:

https://brainly.com/question/34222987

#SPJ6

Final answer:

The Universe is expanding due to the space between galaxies enlarging, not the space within them. We are made of 'star stuff', as elements composing our bodies originated in stars. The observable Universe is parts of the Universe we can observe from Earth.

Explanation:

1. When we say that the Universe is expanding, we're referring to the fact that the space between galaxies is getting larger. This does not, however, mean that the space within galaxies (like those between stars or planets) is expanding. Instead, galaxies are moving away from each other in space. This concept helps us estimate the age of the Universe, as we can measure the rate of expansion (the Hubble Constant) and calculate backwards to when everything would have been a single point - the Big Bang.

2. Carl Sagan's statement that we are 'star stuff' is in reference to the fact that many elements that make up our bodies, such as carbon and nitrogen, originated in stars. When stars die, sometimes through a supernova explosion, these elements are scattered through space and can be incorporated into other structures, such as planets and living organisms.

3. The observable Universe is the part of the Universe which we can technically observe from Earth, restricted by the speed of light. There may be parts of the Universe beyond this boundary which exists, but we can't perceive or measure them because light from there hasn't reached us yet. Therefore the observable Universe may be only a part of the entire Universe.

Learn more about Universe here:

https://brainly.com/question/34222987

#SPJ6

A.7.2. Apply (APPENDIX A pp. 878).

A1. Convert the values on the left to the units at right, using a table of conversions. a. 50 miles =? km b. 15 knots = ? m s–1 c. 30 lb in–2 =? kPa d. 5000 kW =? horsepower e. 150 lbMass =? kg f. 150 lbForce =? N g. 12 ft = ? m h. 50 km h–1 = ? m s–1

Answers

Answer:

a) 80 km

b) 7.65 m/s

c) 206.7 kPa

d) 6700 horsepower

e) 67.3 kg

f) 666 N

g) 3.6 m

h) 13.88 m/s

Explanation:

a. we know that 1 mile = 1.6 km

    [tex]50 miles = (50 \times 1.6) km = 80 km[/tex]

b. we know that 1 knot = 0.51 m/s

    [tex]15 knots = (15 \times 0.51) m/s = 7.65 m/s[/tex]

c. we knwo that 1 lb/inch^2 = 6.89 kPa

    [tex]30 lb/inch2 = (30 \times 6.89) kPa = 206.7 kPa

[/tex]

d. we know that 1 kilowatt = 1.34 horsepower

[tex]5000 kW = (5000 \times 1.34) horsepower = 6700 horsepower[/tex]

e. we know that 1 lbMass = 0.45 kg

[tex]150 lb = (150 \times 0.45) kg = 67.3 kg[/tex]

f. we know that 1 lbForce = 4.44 N

 [tex]150 lbf = (150 \times 4.44) N = 666 N[/tex]

g.  we know that 1 ft = 0.3 m

 [tex]12 ft = (12\times 0.3) m = 3.6 m[/tex]

h. we know that 1 km/h = 0.27 m/s

[tex]50 km/h = (50\times 0.27) m/s = 13.88 m/s[/tex]

Explain where the magma for volcanoes at divergent plate boundaries comes from and how it rises to the surface. In this explanation describe how mantle convection is related to the motion of the tectonic plates.

Answers

Answer:

The earth's crust is comprised of lithospheric plates and they are divided into the continental crust (plates) and the oceanic crust (plates). These plates are constantly in motion over the Asthenosphere layer. This motion takes place due to the convection current that initiates in the mantle. This initiation of convection current is because of the heat radiated from the core of the earth. This plate motion takes place in three different ways, such as-

(a) Divergent plate motion

(b) Convergent plate motion

(c) Transform plate motion

In a divergent plate motion, the two plates move in the opposite direction. As a result of which the hot, less dense magma rises up and comes out towards the surface. This magma originates from the deeper mantle due to the convection current.

Hence, the convection current is the main mechanism behind the plate motion.

Jillian is concerned about the number of aluminum cans she throws away each week. Suggest a reduce, a reuse, and a recycle strategy to help Jillian decrease the amount of aluminum waste she produces. Of the three strategies you suggest, which do you think will most decrease Jillian’s aluminum waste? Explain your answer. (7 points)

Answers

Answer:

She needs to waste awareness.

Explanation:

She needs to start a special program and put recycling baskets around the neighborhood. She can also go around house to house and tell people about the consequences. She can use the school and create a club to clean around neighborhoods looking for recycled items. That way she can raise awareness and earn service hours. She can put brochures around with advices and tips.

Sedimentary, igneous, and metamorphic rocks can each have a distinctive appearance in the landscape, often allowing us to recognize these rocks from a distance. Classify the following description of a landscape to the rock type exposed at the surface. Sandstone or Shale, or Limestone or Igneous rocks or Metamorphic rocks

Answers

Final answer:

The description of a landscape can help us determine the type of rocks that are exposed at the surface, such as sedimentary, igneous, or metamorphic rocks.

Explanation:

The description of a landscape can help us determine the type of rocks that are exposed at the surface.

Sedimentary rocks, such as sandstone, shale, and limestone, can often be recognized by their distinct appearance in the landscape.

ous rocks, such as basalt and granite, form from the cooling and solidification of molten magma.

Metamorphic rocks are formed when existing rocks are altered by heat and pressure.

"The correct classification for the landscape described below is Sandstone.

The landscape described below has a characteristic appearance that can be associated with a particular type of rock. Let's analyze the description and classify the rock type:

 - The description mentions layered outcrops with visible cross-bedding. Cross-bedding is a sedimentary structure where the layers of sediment are deposited at an angle to the main bedding plane. This feature is commonly found in sandstone, which is a type of sedimentary rock composed mainly of sand-sized mineral particles or rock fragments.

 - The presence of fossilized ripples also indicates a sedimentary origin. Fossilized ripples are the remains of ancient ripples that were preserved in the sediment, suggesting that the rock formed in a water environment where ripples could develop.

 - Cliffs with varying shades of red, brown, and yellow can be associated with sandstone, as the color variations are often due to the presence of iron oxides and other minerals within the sandstone layers.

 - Evidence of weathering into rounded boulders can occur with many types of rock, but when combined with the other clues, it supports the classification as sandstone. Sandstone can weather into rounded shapes due to processes like wind erosion.

 Based on these observations, the landscape is most consistent with an exposure of sandstone at the surface. Shale is another sedimentary rock that can form layered outcrops, but it is generally finer-grained and less likely to show cross-bedding or weather into large boulders.

Limestone can also form cliffs and may contain fossils, but it is typically composed of calcium carbonate and is less likely to exhibit the range of colors described. Igneous and metamorphic rocks are usually not layered in the same way as sedimentary rocks and do not typically show cross-bedding or fossilized ripples. Therefore, the landscape is best classified as being underlain by sandstone."

Question 5(Multiple Choice Worth 3 points) Which of the following contributes to the movement of tectonic plates? I. deposition of sediment on the ocean floor II. push of newly formed crust III. mantle convection I only Ill only I and II ll and IIl I, II, and llI

Answers

Answer:

Option (2)

Explanation:

Earth's crust is comprised of lithospheric plates. This lithospheric plates are divided into two types, namely  

(1) Oceanic plate

(2)Continental plate

These plates continuously move over the layer of the Asthenosphere, due to the convection current in the mantle. These currents are generated due to the heat energy radiated from the interior of the earth. The magma at the lower mantle near the core-mantle boundary gets heated up and becomes less dense. As a result of which it comes up to the upper mantle, and during this process, it forces the crust to move from place to another forming either of the three plate tectonic boundaries.

This plate motion takes place in three ways and they are as follows-

(a) Divergent plate motion

(b) Convergent plate motion

(c) Transform plate motion

Hence, the correct answer is option (2) i.e III only.

Final answer:

The movement of tectonic plates is primarily driven by mantle convection, where warmer and lighter material rises, and denser, cooler material sinks. This process also contributes to the formation of new crust, which pushes existing plates. However, the deposition of sediment on the ocean floor doesn't significantly contribute to plate movement.

Explanation:

The movement of tectonic plates is driven primarily by the convection currents in the mantle below them. In this process, the mantle's heat causes the uplift of warmer and lighter material, whereas cooler and denser material sinks. This circulation is a major force behind the tectonic plates' movement.

Mantle convection also influences the creation of new crust, which contributes to plate tectonics by providing a push to existing crust. This happens at places like the mid-ocean ridges where plates are moving apart.

However, while the deposition of sediment on the ocean floor can cause local changes in the seafloor's shape over geological timescales, it doesn't significantly contribute to tectonic plate movement on a global scale. Its impact is minimal compared to the influence of mantle convection and crust formation.

So the options that contribute to the movement of tectonic plates are II (push of newly formed crust) and III (mantle convection).

Learn more about Plate Tectonics

https://brainly.com/question/13267093

#SPJ3

The distance-size ratio for the Sun-Nearest other Star system is of an order of magnitude of

Answers

Answer:

Proxima Centauri is the closest star to that of the sun and being 4.22 light years away from the earth having an apparent magnitude of 12.95.

Explanation:

Being a small and low mass star locate away from the sun in southern constellation being discovered in 1915 by Robert innings. Having an apparent magnitude of 11.3 having an Astronomical number of 12,950 from the orbital period of 550,000 years. Proxima Centauri is a red dwarf star with a mass of eight times that of sun, and an average density that of sun, more than 85%of the radiation is infrared and has the regular activity of starspots. Being closes to the sun around 32,000 years away. It thass an orbital period of 3.6 to 14 days.

Question 13 Where (in relation to the Sun) are the four densest planets? a) Farthest from the Sun b) Nearest to the Sun c) Distance from the Sun is not related to density d) Distance and density are in exact agreement

Answers

Answer:

b) Nearest to the Sun

Explanation:

The four densest planet in our solar system are Earth, Venus, Mercury and Mars. Rest all planets are gas giants.

All the dense planets are near the Sun. The dense planets lie in vicinity of the Sun, whereas the less dense planets lie far  from the Sun. hence the correct answer to the question is option b) Nearest to the Sun

4. Which of the following would change if the Earth had no tilt relative to the ecliptic?

A. Each season would last longer

B. The year would be longer

C. There would be no seasons

D. There would be more days per year

Answers

Answer:

Option (C)

Explanation:

The earth's axis of rotation is tilted at an angle of 23.5 degrees. This tilting has taken place due to the impact between earth and another earth-like planet. The moon resulted from this impact. This tilt plays an important role in the occurrence of seasons on earth.

If the earth was not tilted and remained the same, then it would have not experience any type of season. The conditions would have been very consistent. The equatorial region would have received maximum sunlight, as a result of which only one kind of season would be experienced throughout the year. Due to this, life would be very difficult to survive.

Thus, the tilt of the earth creates four types of seasons, such as summer, autumn, winter and spring, relative to its elliptical path where it moves around the sun.

Hence, the correct answer is option (C).

Which is accurate about the Earth? Group of answer choices The lithosphere is a layer containing both the uppermost part of the mantle and the crust, where flowing is more common than breaking. The lithosphere is the soft part of the mantle below the asthenosphere. The asthenosphere is a layer containing both the uppermost part of the mantle and the crust, where flowing is more common than breaking. The lithosphere is a layer containing both the uppermost part of the mantle and the crust, where breaking is more common than flowing. The lithosphere is the very center of the Earth. The lithosphere is the soft part of the mantle below the asthenosphere. The asthenosphere is a layer containing both the hottest part of the mantle and the crust, where flowing is more common than breaking.

Answers

Answer:

Option (4)

Explanation:

The lithosphere represents the outermost hard layer of the earth. This layer provides all the necessary elements for life to exist and these are available to all the living creatures in the form of soils. The lithosphere is comprised of the crust and the upper part of the mantle. The lithospheric crust on earth is divided into 2 types, namely the continental crust and the oceanic crust. These crusts move over the less dense layer of the asthenosphere, which covers a small portion of the upper portion of the mantle. This motion of plates is due to the convection current that generates in the mantle.

The rocks in the lithosphere are hard and it breaks during deformation.

Thus, the correct answer is option (4).

Asesthnosphere consist of the uppermost part of the mantel.

What forms the upper layer of planet earth ?

Earth is a planet in the solar system that supports life and has layered the earth is a dominant planet that is capable of supporting life. The earth is thus the rocky planet and is layers that support the earth are called the crust, core, and mantel.

As the asthenosphere is a sphere that divides the earth from the crust and core the layer has various properties.

The asthenosphere is a major layer and consists of more than 60% of the earth's mass. This layer holds the crust as crust freely floats on this layer.

Thus the answer is B.

Find out more information about the Earth,

brainly.com/question/13015829.

Why is there is only a small difference in temperature between day and night, while the land experiences a much greater variation?

Answers

Answer:

The temperature in the day time is comparatively higher than the temperature at night time. It is because during the day time, there is the presence of the clouds and the atmosphere is comprised of water vapor, that gets heated up when sunlight falls on earth. So the temperature increases. Whereas, during the night time, there occurs no cloud and no sunlight that can warm up the atmosphere. So the heat energy that was trapped in the day time is easily released into the outer atmosphere (space), thereby decreasing the temperature.

Due to this reason, there occurs a certain amount of temperature difference between the day and night.

Answer:

The temperature in the day time is comparatively higher than the temperature at night time. It is because during the day time, there is the presence of the clouds and the atmosphere is comprised of water vapor, that gets heated up when sunlight falls on earth. So the temperature increases. Whereas, during the night time, there occurs no cloud and no sunlight that can warm up the atmosphere. So the heat energy that was trapped in the day time is easily released into the outer atmosphere (space), thereby decreasing the temperature.

Due to this reason, there occurs a certain amount of temperature difference between the day and night.

When is the Sun highest in the sky at noon for people living in Sydney, Australia? (A) Spring equinox (March 21)(B) Summer solstice (June 21)(C) Winter solstice (Dec. 21)(D) Fall equinox (Sep. 21)

Answers

Answer:

(C) Winter solstice

Explanation:

Sydney, and all of Australia, are located in the Southern Hemisphere. This means that the changes in the seasons and the position of the sun on the sky for that matter are the opposite of the ones in the Northern Hemisphere. The summer period in the Southern Hemisphere starts on December 21st, unlike the Northern Hemisphere where it starts on June 21. The reason why the summer starts n this date is because in this period the Southern Hemisphere is more exposed to the sun, as the Earth is tilted with its southern half towards it. This resulted in higher exposure to the sun, increased temperatures because of it, and the sun being the highest on the sky during the winter solstice. On the other hand, the sun will be the lowest on the sky during the summer solstice, as the Southern Hemisphere is tilted away from the sun during that period.

List 4 everyday products that are made from seafloor deposits

Answers

Answer:

1. Salts. 2. Oil reserves. 3. Gold deposits.  4. Minerals

Explanation:

As oceans are the lifeblood of the planet they give all the natural resources that we need to live a healthy and economic life. Seafloor contains various features like volcanic vents and trenches. These vents contain massive seafloor sulfur contents. Also, they consist of high-value items like gold, silver deposits as these have been constantly been drilled for such precious metals. Similarly, various minerals and salt content ate known to have been found in these deposits. The presence of active deposits is found near the continental plate boundary. Certain SEZ special economic zones have neb thus made to help preserve the mineral and oil wealth of nations.

4. How does sediment in an alluvial fan compare with sediment in a deep marine basin, and how did they come to be so different?

Answers

Answer:

Oceans are an accumulation feature and alluvial fan are depositional feature

Explanation:

An alluvial fan is a triangular-shaped deposit that is often referred to as alluvium. Are an example of unconsolidated sedimentary deposits, and thus tend to be larger and more predominant in arid and semi-arid regions. They are typically found in mountainous regions where there is a rapid change in slope. Various types of fan are a proximal fan, medial fan, and the distal fan. An oceanic basin is a hydrologically formed and covers about 70% of the earth's surface, they collect sediments that are eroded by the continents known as clastic sediments, as well as precipitous sediments. As alluvial fans feature is associated with elevated highlands the upliftment is necessary as compared to the oceanic basins there exist mid-oceanic ridges and abyssal hills and plains.

Relative to the stars, through how many arc seconds does the Moon move in 14 s?

Answers

Answer:

Moon move in 14 s = 7 arc second.

Explanation:

we know that moon mover 0.5 degree in 1 hour

In 1 hour the Moon move 0.5 degrees = 1800 arc second.

So, in 1 sec the Moon move[tex]s =\frac{1800}{3600} = 0.5\ arc\ second.[/tex]

therefore in 14 second the Moon moves

[tex] = (0.5\times 14) [/tex]

 In 14 second = 7 arc second.

Albedo is a term describing the Earth's ____.

Question 46 options:

Use of energy in biomass production

Refraction of energy

Reflection of solar radiation

Production of radiant heat

Answers

Answer:

Albedo is a term describing the Earth's reflection of solar radiation

Explanation:

The definition of albedo is the measurement of the reflection of solar radiation received by a planet, for instance. The problem describes the Eart. Therefore, it is the diffuse reflection of solar radiation. Since it is a reflection, it cannot be a production of radiant heat, nor it is the refraction of energy. Since it is reflected back, albedo cannot be the use of energy in biomass production either.

Now that we know of thousands of dinosaur eggs and nests, what are these fossils teaching us? What sort of behaviors and evolutionary relationships are being extrapolated from the diversity of nest types, eggshell microstructures, and overall shape of dinosaur eggs? Do not feel like you need to produce a thesis in this thread. Make it a community effort and build on what each of you find to share about what dinosaur eggs have to teach us.

Answers

Answer and Explanation:

Fossilized proof of dinosaurs have been found in various areas and have helped in thinking about there settling styles .Pale ontological looks into have demonstrated a few dinosaurs eggs covered under dried leaves and vegetation like numerous crocodiles do.But dinosaurs were additionally found to expose eggs in homes similarly as fowls.

t was discovered that the dinosaurs which where not very much grew principally laid there eggs on ground covered under certain articles to keep them warm.This insights towards a conceivable developmental connection among crocodile and birds.It was discovered that those eggs which were covered under vegetation so as to keep them warm were increasingly permeable that those which were exposed in like feathered creatures and this expanded porosity of the eggshells to encourage the trading of gases since they were covered and oxygen supply was expanded in light of the porosity of the eggshells.

Dinosaur egg fossils were found in a wide range of shapes and sizes and furthermore hues which shows assorted variety of these animals.

Which of the following gases is mainly from incomplete combustion of fossil fuel?

Question 41 options:

CO

SO2

CO2

NO

Answers

Answer:

Option (1)

Explanation:

The incomplete combustion of fossil generally occurs when there is less amount of air or oxygen. This incomplete combustion leads to the production of carbon monoxide and carbon along with water. It does not release any carbon dioxide.

The reaction that represents an incomplete combustion is-

Hydrocarbon (fossil) + oxygen (O₂) → Carbon Monoxide (CO) + carbon (C) + water (H₂O) .

This reaction releases this Carbon monoxide which is a very poisonous gas. This gases are trapped in the lungs and it creates difficulty for the blood to carry oxygen. This is the reason why the complete combustion of fossil is more preferred compared to the incomplete combustion.

Hence, the correct answer is option (1).

Answer:

CO (carbon Dioxide)

Explanation:

Fossil fuels such as coal and petroleum products contain carbon (C) and hydrogen (H). When they burn completely, carbon and hydrogen react with oxygen gas to produce carbon dioxide (CO₂) and water (H₂O).

But in incomplete burning, a portion of carbon that contained in fossil fuel is not completely oxidized. As a result carbon monoxide (CO) is produced.

The carbon monoxide is a poisonous gas that affects health. The maximum limit of carbon monoxide production allowed in flue products is 400 ppm (parts per million) and the gas flame produces 0 and 50 ppm of carbon monoxide.

Incomplete combustion results in the production of above 7,000 ppm of carbon monoxide. Such a high concentration of carbon monoxide is a health risk and can be fatal.

What is the ozone layer, how was it threatened, and what have we done to fix it? Be as precise and accurate as possible.

Answers

Answer:

Ozone is a stratospheric layer of three oxygen atoms, this acts as a blanket to earth.

Explanation:

The depletion of ice caps and the release of harmful gases like methane and CFCs in the environment from vehicle exhausts and Air Conditioners produce the same greenhouse environment that hinders the development of this layer and as result, the impact is seen in the form an ozone hole over Antarctica and Arctic circle. The global data released from LANDSAT and MSS satellites show the catastrophic amount of damage that had been done to the ozone by a mix of these gases that break the atomic structures and hence deplete the life on earth. An example of this is coral bleaching and drastic impact t has on marine life as the Ultraviolet rays hat enter the surface damage skin cells and tissues of these small organisms.  Also, associated with the warming of ocean temperature and an increase in salinity, etc.

Consider the natural resources that transcend the borders; e.g. air, water and wildlife. Who do you think should provide and implement the legislature surrounding these important issues?

Answers

Answer:

The United Nations

Explanation:

The UN is a global assembly of different countries in the world. To a significant extent, the UN hosts the largest membership of nations in the world today.

The proper use of resources without borders should be under the auspices of the group of nations, UN. Here, nations can easily collaborate on the best way to utilize these border-less resources.

__________ ozone is harmful, damaging plants and human health while ozone at the _________ level screens out mutagenic ultraviolet radiation.

Question 43 options:

Stratospheric; troposphere

Thermospheric; mesosphere

Tropospheric; stratosphere

Mesospheric; thermosphere

Answers

Answer:

Tropospheric ozone is harmful, damaging plants and human health while ozone at the stratophere level screens out mutagenic ultraviolet radiation.

Explanation:

Ozone is dangerous and harmful in the lowest layer of the Earth's atmosphere. This layer is called troposphere. The reason why it causes damage to plants and human health it is because ozone is a reactive gas that affects plant synthesis and causes smog (a form of air pollution that is particularly dangerous to sensitive respiratory diseases such as asthma). However, ozone is helpful in the second layer of the Earth's atmosphere: the stratosphere.  It prevents and blocks dangerous ultraviolet radiation.

why is south africa, sub shara one of the poorest regions while they have minerals that you can not find any where else in the world

Answers

Answer and Explanation:

South Africa is said to be the place rich in minerals. Regardless of its rich mineral resources and valuable minerals wealth, it is a land denied of sustenance. Destitution wins in this nation, People are denied from numerous different backgrounds. Some essential reasons are:-  

Lack of administration: The most genuine explanation behind such a condition. This prompts the working of a confused government.   Corruption: African locals are a prey to broad debasement. This debilitates the organization and acknowledges preference.    Tribalism: Africa is a place that is known for tribal. Individuals distinguish themselves as clans, which decreases their job opportunities  Lack of skilled workers: The Government can't pay to talented laborers. Consequently they secure positions in Western Countries.   Neocolonialism: It tends to be characterized as the continuation of the monetary model of expansionism after a colonized region has accomplished formal political freedom.

Define Elment Atom and Compound in paragraph form

Answers

Atoms are extremely small particles that constitute a specific type of chemical element and that gives elements their property like color, density, melting point, boiling point, and thermal and electrical conductivity. Elements are substances made from one type of atom that cannot be separated into simpler substances, like sodium, hydrogen, oxygen, and chloride. Lastly, Compounds are substances consisting of two or more elements, whose atoms are chemically joined together; water and salt are examples of compounds because the first is made of hydrogen and oxygen, while the latter is made up of sodium and chloride.

agree or disagree:

Tectonic plates is the term to how faults and landmasses are created. The mantle of the earth contains two components which are Asthenosphere and Lithosphere. The Asthenosphere is a plastic like material which underlies the Lithosphere which is solid and rigid rock materials. The concept of Continental drift is thought of that the continents were once formed together which explains how the landmasses appear to resemble as puzzle pieces. This one huge landmass that was predicted to have once existed is named Pangea. However, the term Continental Drift determines that through tectonic plates enacting seafloor-spreading was the reason for Pangea to have separated. Through seafloor-spreading, the formation of oceanic ridges occur with the separating of landmasses which results in a larger seafloor. The opposite can also happen, when landmasses are being pushed together creates mountain ranges. Faults are what underlies beneath continents which makes seafloor-spreading and the formation of mountain ranges to occu

Answers

Answer:

Agreed

Explanation:

Plate tectonics is a term used to describe how the plates or slabs are formed as a result of faults and folds created within the earth surface and this term also used in describing how the earth was formed due to the impact of large solid objects from the outer space and the removal of gas due to the SolarWinds.  The mantel that is composed of three layers and the top of them being the asthenosphere on which Alfred Wegener gave evidence that the terrestrial plate floats freely on these with less resistance offered by SIMA. The puzzle evidence also suggested by him was about the same theory that made the large supercontinents in existence and from which the later land masses broke off to form Pangea and Gondwanaland. Later on much-studied were conducted in this tic to test its validity and found that the continents were truly displaced due to the spreading of the oceanic floors due to the mid-oceanic ridges and these accounts for 99% of the oceanic crustal masses. It was only possible through the deep exploration of the paleomagnetism and chain of rocks of various ages.

Standard form for "No Norwegians are Slavs" (assume true).

Answers

Answer:

True

Explanation:

Salvas is Indo European people who speak Slavic languages. And Balto - salvanic group native to central Eurasia and southeastern Europe. From the early 6th century, they have spread to inhabit the majority of central-eastern and southeastern Europe. As today there is a large salvanic population of the North Americans and the and particularly Canada as a result of migration. As salvas can be grouped into orthodox Christianity. There an estimated 360 million Slaves worldwide. such as Russia i.e 130-150, Poland 57-60, Ukraine has 46-51, Serbia has 11-12, Chez republic 10-12, Belarus 10, Slovakia 6. (In terms of 000,000).

Final answer:

The statement "No Norwegians are Slavs" refers to the relationship between the Norwegian and Slavic ethnic groups.

Explanation:

The statement "No Norwegians are Slavs" refers to the relationship between the Norwegian and Slavic ethnic groups. In social studies, we study the connections and interactions between different cultures, societies, and ethnic groups. Norway is a Nordic country with its own distinct language (Norwegian) and culture, whereas the Slavs are a diverse group of people with shared historic culture and similar languages, including Bulgarian, Russian, Croatian, and more. Therefore, the statement suggests that there is no overlap or commonality between these two specific ethnic groups.

In which aspects do the nanotechnology improves enhanced oil recovery(EOR)?

Answers

Answer:

Nanotechnology helps to improve viscous fingering and the nano-particles can transmit through nanopores of sandstone which helps to increase the recovery by decreasing the surface tension between oil and water. The pore spaces are very fine so water molecules cannot penetrate through all of them in order to push the oil. This is why the nano-particles such as iron (Fe) and Silicon (Si) are used with distilled water. These particles can easily move through the interconnected pores and thereby pushes the oil to move out of it. It is a widely accepted concept in Enhanced Oil Recovery (EOR).

Final answer:

Nanotechnology enhances enhanced oil recovery (EOR) by improving oil's properties for easier extraction, increasing porosity and permeability of reservoir rocks, and targeting specific reservoir zones more efficiently. This technological advancement supports more sustainable oil extraction techniques, such as carbon dioxide injection, and helps to extend the life of oil fields.

Explanation:

Nanotechnology significantly improves aspects of enhanced oil recovery (EOR) through innovative methods that increase the efficiency and effectiveness of oil extraction. Primary recovery methods only extract about 30% of crude oil, while EOR techniques, aided by nanotechnology, can significantly increase this percentage. One notable application of nanotechnology in EOR is the injection of nanoparticles to change the properties of oil, making it easier to extract from rock pores. These nanoparticles can alter the oil's viscosity and surface tension, facilitating its flow towards the production wells. Furthermore, nanotechnology applications in EOR include improving porosity and permeability of the reservoir rocks, targeting specific oil reservoir zones for increased precision in oil extraction, and enhancing the recovery rates from previously uneconomical or depleted fields. This technological advancement aligns with the sustainable technique of carbon dioxide injection for removing more oil, thereby not only extending the life of oil fields but also improving the control of unintended emissions associated with fossil fuel extraction. The integration of nanotechnology in EOR presents a promising avenue for accessing the remaining oil in reservoirs, which current technology accesses only about one-third of.

Suppose Halley's comet orbits the sun every 79 years with an eccentricity of 0.87. What is it's aphelion distance in

au's

Answers

Answer:

it's aphelion distance  is 18.41 AU

Explanation:

Given data:

eccentricity 0.87

P is period of orbiting   = 79

from Kepler's third  Law.

P^2 = d^3

where P is the period of orbiting in years, and

d  it is orbit  semi-major axis in Astronomical Units

1 AU is the average distance between  earth and sun

so if P =79, we have

79^2 = d^3

6241 = d^3

d = (6241)^(1/3) = 18.41 AU

In the last question, I measured 1000 atoms of U-235 (parent) and 3000 atoms of Pb-207 (daughter) in a mineral. If the half life of U-235 is 700 million years, then how old is the mineral? If the mineral came from an igneous rock, then how old is the rock?

Answers

Answer:

1400 millon years, it is probable that if the mineral came from igneous rock, ithe rock age would be the same. There were active volcanoes 1400 year ago in proterozoic era.

Explanation:

Lifetime of radiactive compound is calculated with

[tex]ln(\frac{N_t}{N_0})=-kt[/tex] with [tex]N_t:[/tex] mass at time t, [tex]N_0:[/tex] original mass, [tex]k:[/tex]  decay constant.  

So we know that when 700 millon years pass, the half of original material decays ([tex]\frac{N_t}{N_0})=0.5[/tex]. With that information we can know k.

[tex]ln(0.5)=-k*700[/tex]  so, [tex]k=-ln(0.5)/700=0.00099[/tex]

With k, the actual and original quantity of material we can know how old is the rock:

[tex]t=-ln(\frac{N_t}{N_0})/k[/tex]  so, [tex]t=-ln(\frac{1000}{4000})/0.00099=1400 millon years[/tex]

([text]N_0=1000+3000[/text] is the actual quantity plus the quantity that decays to Pb-207)    

Which of the following places is more likely to have the coldest winter?

Question 62 options:

A place with 30°N latitude in East Asia

A place with 30°S latitude in Africa

A place with 45°N latitude in central Asia

A place with 47°S latitude in South America

Answers

Answer:

A place with 45°N latitude in central Asia

Explanation:

Central Asia consists of a 4,003,451 km square area and has a population of  71,982,775. Being an extremely wide region with well-defined geography with vast desert land and mountainous terrain. Most of this area is too rugged for farming. It also has some geographic extremes like the Eurasian pole of inaccessibility. Worlds shorted distance between the non-frozen desert and permafrost: 770 km. The world's northernmost desert located in Mongolia. and southernmost permafrost, also at Mongolia. It's not buffed with a large body of water as the areas are the dry and continental type of climate thus it has coldest winters like Kazakhstan -4 °C and -19 °C.

What very successful Miocene period primate is most likely ancestral to the living apes? (Hint: this genus had at least four distinct species).

Proconsul

Ramapithecus

Aegyptopithecus

Zinjanthropus

Sivapithecus

Answers

Answer:

Proconsul

Explanation:

Proconsul is an extinct genus of primate. It is widely considered to be the ancestor of all the primates that we know at present, such as the chimpanzee, gorilla, gibbons, orangutans, and of course us, the humans.

This genus of primate had mixed characteristics, something like a cross between the monkeys of the Old World and the primates. Simply it can be said that the four species of this genus were transitional species from monkeys toward primates.

The four known species of Proconsul all lived in Africa, and the main difference between them was the size. The period in which the Proconsul existed was the Miocene, between 25 and 23 million years ago.

Other Questions
What are the three main types of money?A) credit, commodity, representativeB) fiat, commodity, creditC) representative, credit, fiatD) commodity, representative, fiat How much exercise should teens do daily Fiona shares an office with her exminushusband. Her share of the rent and utilities is $625 per month. She is considering moving to a home office which she will not have to share with anyone. The home office will not cost her anything as far as extra rent or utilities. Recently, you ran into Fiona at the gym and she tells you that she has moved into her home office. Fiona is as rational as any other person. As an economics major, you rightly conclude that ______ Can someone help me with this problem? It has to be in PEMDAS order. 16+(4*2/2)-4 I think it's 18 but I'm not sure The bases of one of the strands of DNA in a region where DNA replication begins are shown here. What is the sequence of the primer that is synthesized complementary to the bases in bold? (Indicate the 5' and 3' ends of the sequence.) 5' AGGCCTCGAATTCGTATAGCTTTCAGAAA 3' what is 3.149 rounded to the nearest hundredth What did the Gestapo and SS do? What is different about the number of course options kids get in virtual schools compared to typical schools? I don't know how to solve this: In a pair of complementary angles, one angle measures 18* less than three times the other angle. Find the measure of each angle. Explainthe benefits a recursive algorithm can provide. Usean example from a process in your organization or with which you are familiar. The square of the product of 4 and a number is the sum of the number and 15 Deshawn fuels 2 yachts and 6 barges. Each boat gets 126 gallons of fuel. To find out how much fuel he needs for all boats, deshawn first finds the number of boats, then he uses an algorithm to multiply. Which are the three partial products deshawn could add to find the final product? a valueable preserved biological specimen is weighed by suspeding it from a spring scale. it weighs 0.45 N when it is suspendedin air and 0.081 N when it is suspended in a bottle of alchol what is its dencity? Mantle convection is a process of that creates circular currents in the asthenosphere. As a result, the plates slowly move. Which of the following statements about DNA structure is true? View Available Hint(s) Which of the following statements about DNA structure is true? The nucleic acid strands in a DNA molecule are oriented antiparallel to each other, meaning they run in opposite directions. Hydrogen bonds formed between the sugarphosphate backbones of the two DNA chains help to stabilize DNA structure. Nucleic acids are formed through phosphodiester bonds that link nucleosides together. The pentose sugar in DNA is ribose. You have been assigned to make a recommendation about whether to build a factory manufacturing facility in Arkansas or New Jersey. Average production is estimated at 60,000 units per year. Estimations for cost factors were observed by obtaining cost data over the past year. Fixed costs including the financing of building and equipment, property taxes and insurance as well as overhead staff. Variable costs include repair product development, direct labor, shipping in and out. Our analysis indicated the following costs: Arkansas New Jersey Fixed $3,753,000 $2,221,000 Variable $52.73 $74.99 The difference in cost for production between New Jersey and Arkansas when manufacturing 75000 units is "Which of the following assumptions means that money is the common denominator of economic activity and provides an appropriate basis for accounting measurement and analysis?a. Monetary unit.b. Periodicity.c..Economic entity.d. Going concern." Horton Co. was organized on January 2, 2014, with 500,000 authorized shares of $10 par value common stock. During 2014, Horton had the following capital transactions: January 5-issued 375,000 shares at $14 per share. July 27-purchased 25,000 shares at $11 per share. November 25-sold 18,000 shares of treasury stock at $13 per share. Horton used the cost method to record the purchase of the treasury shares. What would be the balance in the Paid-in Capital from Treasury Stock account at December 31, 2014? Layla works during her meeting to pull together the ideas of her committee members into a coherent whole. Layla is performing a ___________ role.a.Maintenanceb.Relationship-orientedc.Taskd.Social The National Honor Society is an example of a CTSO.True or False?