The biodiversity of cultivated crops is currently under threat from industrial
farming and climate change. The extinction of important crop plants could
cause mass starvation. Which cooperative behavior would best enable
humans to prevent this problem?

Answers

Answer 1

Answer:D

Explanation:Scientists Could study threaten varieties to find ways to replace them!!

Answer 2

A cooperative behavior which would best enable humans to prevent this problem is establishing a seed bank with a variety of seeds of different crop species.

What is a biodiversity?

A biodiversity is the short name for biological diversity and it can be defined as the variety of species of organisms such as plants and animals that are living within a particular habitat on planet Earth.

In this context, a cooperative behavior which would best enable humans to either mitigate or prevent this problem posed by industrial farming and climate change is by establishing a seed bank with a variety of seeds of different crop species.

Read more on biodiversity here: https://brainly.com/question/26110061

#SPJ5


Related Questions

If a population has MORE environmental resistance than biotic potential, it will ______


A. Increase

B. Decrease

C. Remain stable

D. Sharply rise and fall

Answers

Answer:

B. Decrease

Explanation:

If a population has MORE environmental resistance than biotic potential, it will  decrease.

If a population has more environmental resistance than biotic potential, it will decrease. So, the correct option is (B).

What is Environmental resistance?

Environmental resistance is defined as the process in which some different elements or factors prevent the growth of the species uncontrollably where as nature does something to control the growth of the species in order to reduce the excessive growth of population or over population.

"Environmental resistance" is related in a similar way to some factor that limits not only the growth of a species but also the rate of reproduction. Availability of certain necessary resources is the factor of environmental resistance which are as follows:

FoodWaterPredationDiseasesCollection of toxic metabolic wasteBehavioral change in species

Thus, if a population has more environmental resistance than biotic potential, it will decrease. So, the correct option is (B).

Learn more about Environmental resistance, here:

https://brainly.com/question/29347064

#SPJ2

Read the paragraph. Then answer the question that follows. Perhaps you wanted pizza for dinner, but were out voted by the rest of the family who wanted chili. This is similar to what happens in a community. One person has to give up a right for the good of the group. Sometimes citizens' duties and rights conflict with each other. A good example is a public protest. People have the right to meet in groups and share ideas. However, a protest can disrupt traffic or other normal activities. A city must provide extra police protection to keep people safe. Therefore, the city has the right to require permission in advance for a protest. Government must make laws to balance the rights of individuals and different groups of people. Which of the following statements best describes this paragraph? The paragraph contains categories of comparison. The paragraph contains a simile. The paragraph contains no text connections. The paragraph contains an analogy.

Answers

Answer:the last one

Explanation:

Answer:

The paragraph contains an analogy.

Explanation:

Based on the above provided excerpt, we can see that the passage is an analogy on the two sides of every action. Just like the need to sacrifice the minority opinion for the majority, so is the same case for any protests or dissensions in a society.

Analogies provide comparisons between things for the better explanation of the issues concerned. By comparing the majority and minority opinions through the examples of "family pizza", " protests"or even "community rights", the author makes it a point to show the two sides of any story. Of course both opinions matter but for the sake of a democratized and equal footing of the two parties, there had to be some compromises made. And this is exactly what the analogy does. The analogy makes it perfectly understandable for the readers.

what kind of matter is formed when atoms of 2 or more elements bond

Answers

A molecule is formed.

A molecule my dude or dudette

1.What is the function of a gene?








2.What do the letters you wrote on the graph paper stand for?








3.Which of the two strings of letters you used in this activity represent the gene?

Answers

Answer:

1. the function of a gene is what makes up the human (proteins,characteristics,traits), you can say genes are little chunks of the DNA and lots of chunks is what makes up what is called chromosomes break that up u get chromatins.

2. the letters you wrote on the graph paper stand for what i like to call "DNA script" written form of DNA

exp: ATATTATAGCCGTATACGGC

3. hmmm... i dont get this one but if you were talking about it like this:

A : adenine

G: guanine these two are nucleotides with two rings

~batmans wife dun dun dun....

wich of the following is an example of an epeirogenic process​

Answers

Answer:In geology, epeirogenic movement (from Greek epeiros, land, and genesis, birth) is upheavals or depressions of land exhibiting long wavelengths and little folding apart from broad undulations. The broad central parts of continents are called cratons, and are subject to epeirogeny. PLZ HELP ME FOR MATH!!! go to my profile and plz try answer my question, but if you dont get it plz dont answer!!!

Explanation:

The following is an example of an epeirogenic process is A large plateau forms in the interior of a continental plate when a large section of the plate rises evenly due to an even expansion of the underlying mantle.

The correct option is (C).

1. Epeirogenic processes involve broad-scale vertical movements of the Earth's crust, typically affecting large areas of continents rather than localized regions.

2. Unlike orogenic processes (which involve the formation of mountains through folding, faulting, and volcanic activity), epeirogenic processes result in more gradual changes in elevation over large regions.

3. The formation of large plateaus, such as the Colorado Plateau in the United States or the Deccan Plateau in India, is an example of epeirogenic uplift.

4. This uplift occurs when large sections of the continental crust rise evenly due to processes such as isostatic rebound or mantle convection.

5. Isostatic rebound refers to the adjustment of the Earth's crust in response to changes in surface loads, such as the melting of glaciers or the erosion of mountain ranges, leading to the uplift of previously depressed regions.

6. Mantle convection can also drive epeirogenic uplift by generating upward flow within the Earth's mantle, resulting in the buoyant uplift of continental crust.

7. Overall, epeirogenic processes contribute to the formation of large-scale topographic features such as plateaus, which play important roles in shaping the landscape and influencing regional climates and ecosystems.

complete question given below:

Which of the following is an example of an epeirogenic process? A. Mountains form along a convergent plate boundary when two plates collide, causing rock to bunch and buckle upward B. A rift valley forms at a divergent boundary where two plates are stretched apart. C. A large plateau forms in the interior of a continental plate when a large section of the plate rises eventy due to an even expansion of the undertyng mantle D. Mountains form along a convergent plate boundary when an oceanic plate slips beneath a continental plate, resuling in an upward force on the continental plate.

A major polysaccharide found in plants is ________ and in animals is ___________.
A. glycogen, cellulose
B. starch, glycogen
C. starch, cellulose
D. glycogen, starch

Answers

pretty sure the answer is d

A major polysaccharide found in plants is mainly starch and in animals it is glycogen. The correct option is B.

What is polysaccharide?

Polysaccharides, also known as polycarbohydrates, are the most common carbohydrates found in foods.

They are polymeric long-chain carbohydrates made up of monosaccharide units linked together by glycosidic linkages.

A major polysaccharide found in plants is mainly starch and in animals it is glycogen.

Thus, the correct option is B.

For more details regarding polysaccharides, visit:

https://brainly.com/question/780562

#SPJ2

Complete the phylogenetic tree by matching each characteristic that arose during the evolution of animals to its correct position. ( Start from top to bottom boxes)

OPTIONS:

Backbone

Tissues

Coelom

Segmentation

Endoskeleton

Answers

Answer:

The correct characteristics are - tissue, coelom, segmentation, endoskeleton, and backbone from top to bottom boxes.

Explanation:

This phylogenetic tree showing the evolution and relatedness of the different organisms on their shared characteristics. In the given phylogenetic tree there are some characters are missing and we can predict or state them on the basis of evolution and studying the characteristics.

After the Porifera phylum tissue-level organization is found in the organism hence Tissue would be placed in the first box.

The coelom is found organisms above the Nematoda level, which further include a character segmentation in Annelida and Arthropoda. Another lineage from arising with the coelom organism that included endoskelton and backbone.

Thus, The correct characteristics are - tissue, coelom, segmentation, endoskeleton, and backbone from top to bottom boxes.

Answer:

tissue, coelom, segmentation, endoskeleton, and backbone

Explanation:

A scientist makes an image of all of a person's chromosomes. What
technique is she using?
O
A. Use of restriction enzymes
B. Polymerase chain reaction (PCR)
O
O
C. Karyotyping
O
D. Gel electrophoresis

Answers

Answer:

She is using Karyotyping

Explanation:

A karyotype is the number and visual appearance of the chromosomes in the cell nuclei of an organism or species.

In order to make an image of all of a person's chromosomes, the scientist uses Karyotyping.

What are chromosomes?

Chromosomes are found in the nucleus of a cell. These chromosomes contain the units of inheritance called genes. The sequence of genes determines the characteristics of organisms.

Now, in order to make an image of all of a person's chromosomes, the scientist uses Karyotyping.

Learn more about chromosomes: https://brainly.com/question/1596925

#SPJ2

What are currents??????

Answers

A current is a rapid movement of ocean water. The wind also speeds up. Therefore, currents can be very dangerous. At the beach, you have to get out of the water at a certain time because currents can drag you under the water.

If you are referring to nature a current is...A BODY OF WATER OR AIR MOVING IN A DEFINITE DIRECTION

Marcy drops an antacid tablet in water and times how long it takes to dissolve. Which of the following will increase the reaction rate? increasing water temperature decreasing water temperature using less water

Answers

Answer:

increasing water temperature

Explanation:

Answer:increasing water temperature

_____ can produce their own food

Answers

Answer:

Autotrophs

Explanation:

Autotrophs can produce their own food.

Autotrophs are able to gather food from just their body and survive!

Autotrophs can produce their own food

Which of these foods contain the most of Vitamin C and Fiber


A: Oats

B: Bananas

C: Pomegranates

D: Rice

Answers

Answer: B: Bananas

Explanation:

Bananas are the fruits which is most commonly found in many regions of the world. These are rich source of potassium, fiber, vitamin C, vitamin B6,  manganese, protein, folate, riboflavin, niacin, and iron.

The bananas are useful for treatment of cancer, high blood pressure, cancer, diabetes, digestive problems and cardiovascular disease.

Vitamins are organic compounds that are essential for body growth and development.

Vitamins are obtained from vegetables and fruit. There are different types of vitamins present, Some of them are fat-soluble and some others are water-soluble.

Fat-soluble vitamins are as follows:-

Vitamin AVitamin EVitaminDVitamin K

Vitamin C is also known as ascorbic acid and can help in the development of body repair.

Each fruit and vegetable have vitamins in them. According to the question, Bananas and pomegranates have more vitamin C.

For more information, refer to the link:-

https://brainly.com/question/2084893

1 Point
Which statement describes the energy conversion that takes place during
photosynthesis?
O
A. Plants covert solar energy to kinetic energy.
O
B. Plants convert solar energy to chemical energy.
O
C. Plants convert kinetic energy to chemical energy.
O
D. Plants convert chemical energy to solar energy.
SUBMIT

Answers

Plants convert solar energy into chemical energy.
The plants take the sunlight and then convert it into things they can use such as glucose, and also put minerals back into the Earth and soil.

Answer:

Option (B).

Explanation:

Plants are known as autotrophic organism as they can prepare their own food. The plants need sunlight, carbon dioxide and water for the photosynthesis.

Plants uses sunlight that contains the solar energy. This solar energy is converted into the chemical energy from the breakdown of water molecule and formation of carbohydrates. Hence, the solar energy of sun is converted into chemical energy.

Thus, the correct answer is option (B).

PLZ!!!! HURRY!!!!!

30 POINTS!!!!!!!!!!!!!!!!!!!!!!!!

Which of the following statements does not refer to how psychotherapy is helpful to an individual who seeks treatment? A. It teaches the patient new ways to deal with difficult situations or stress. B. It can be used to help people discover new ways to overcome difficulties. C. It can be comforting just to have someone to vent to. D. It allows therapists to use several techniques in treatment.

Answers

Answer:

allows therapists to use several techniques in treatment. - D.

Answer:

D, now your almost 1/5th of a century (20), if the only thing your good at is fortnite you probably want to start doing something with your sorry life...

*cough*

Explanation:

what are the types of mutations, and how does each alter the encoded protein? college level answer please​

Answers

Answer:

point mutation missense mutation silent mutation non sense mutation

Explanation:

point mutation it change one base of DNA in this case nucleotide substitution occur like sickle cell missense mutation in this case replacement of one nucleotide nonsense mutation cause the replacement of codon silent mutation does not change the sequence of protein because of new triplets codes for the same amino acid

Final answer:

Mutations like missense, nonsense, frameshift, and substitution, can alter the encoded protein in different ways, potentially affecting the organism's characteristics and causing diseases. Mutations can cause single or multiple changes in amino acids, leading to altered protein function.

Explanation:

There are several types of mutations that alter the encoded protein in different ways, including missense mutations, nonsense mutations, insertion or deletion mutations (frameshift mutations), and substitution mutations. Missense mutations cause a single change in an amino acid, which may or may not significantly alter the protein function. A nonsense mutation replaces an amino acid with a stop signal, resulting in a truncated and typically nonfunctional protein.

Frameshift mutations, caused by an insertion or deletion of a nucleotide that's not a multiple of three, result in changes to every subsequent amino acid, thereby producing a dramatically altered and generally nonfunctional protein. Substitution mutations replace one amino acid with another; if it occurs at a crucial point in the protein, it can cause significant changes to protein function.

Finally, in some cases, mutations cause repetitions of the same codon (trinucleotide repeat expansions), leading to repeated regions of the same amino acid in the protein. All these types of mutations can result in changes to the characteristics of an organism or can be potential causes for various diseases.

Learn more about Types of Mutations here:

https://brainly.com/question/30337180

#SPJ2

what minimum internal temperature must the salmon reach cooking

Answers

Answer:

145 degrees

Explanation:

Because the united states food and drug administration recommends cooking salmon to an internal temperature of 145 degrees Fahrenheit. Push the tip of the meat thermometer gently into the middle of the salmon fillet at its thickest part.

Salmon should be cooked to a minimum internal temperature of 145°F, as measured by a food thermometer, to ensure it is safe to consume.

When preparing salmon, it is essential for safety and health to ensure the fish is cooked to the appropriate internal temperature. According to the USDA and food safety guidelines, seafood, including salmon, should be cooked to a minimum internal temperature of 145°F. This temperature should be measured using a food thermometer to confirm that the salmon has reached the temperature sufficiently high enough to kill harmful bacteria that can cause foodborne illnesses. Additionally, it's important to make sure that when cooking fish in a microwave oven, there are no cold spots where bacteria can survive. For even microwave cooking, cover the seafood, stir, rotate, and if no turntable is present, manually rotate the dish once or twice during cooking.

Which of the following describes an antibiotic that is good for a human to take as a medicine?


A. The antibiotic kills harmful bacteria but not human cells.
B. The antibiotic is a harmful substance called a toxin.
C. The antibiotic kills all living things, including bacteria and human cells.
D. The antibiotic provides food molecules that are needed for good health.

Answers

Answer:

The correct answer would be option A, The antibiotic kills harmful bacteria but not human cells.

Explanation:

Antibiotics are the medicines given to a person who gets sick due to a bacterial infection in his body. Bacterial Infection can not be treated without using the antibiotic medicines because antibiotics are the only medicines that kill the harmful bacteria inside a human body while keeping the human cells alive and healthy. Antibiotics do not harm the body cells. They just work on the bacterial infection and kill the bacteria. Other functions of the body are not disturbed by taking the antibiotics.

What does the field of biology study

Answers

Answer:

Biology deals with the study of living organisms present on earth. These could be ranging from the microscopic unicellular organisms to the more complex multicellular organisms, including bigger plants and animals.

The study of these organisms helps in understanding the structure, food type, development and growth, body functions and their distribution on earth.

The various sub-branches of biology are as follows-

1) Microbiology

2) Bioinformatics

3) Biotechnology

4) Genetic study

5) Botany

6) Medical

7) Zoology and some other fields.

The field of biology studies living things including plants and animals.

What does the field of biology study?

Biology is a branch of natural science that examines living things. Due to the enormous variety of life on Earth, it is a highly broad field, hence individual biologists typically concentrate on particular fields. Either the scale of life or the types of species investigated are used to categorize these fields.

Botany, zoology, and microbiology are the three main subfields of biology. Zoology is the study of animals, botany is the study of plants, and microbiology is the study of tiny creatures.

Learn more about biology at; https://brainly.com/question/30451768

#SPJ6

Which of the following groups of people would be the least affected by air pollution?
a. people with asthma
b. infants
c. teenagers
d. the elderly

Answers

I would say teenagers. Because usually babies, elderly, and people with disabilities are typically prone to more health problems associated with air pollution than people who aren’t in these categories

Teenagers are the groups of people that would be the least affected by air pollution.

AIR POLLUTION:

Air pollution is the release of harmful gases into the atmosphere. These pollutants include gases like carbon monoxide (CO), nitrogen dioxide (NO2) etc or particles like dust etc.

According to this question, air pollution can affect any group of people, however, some groups are more susceptible to air pollution than others.

Groups of people that are more susceptible to air pollution are as follows:

Asthmatic patientsElderlyInfants or babies

Therefore, teenagers are the groups of people that would be the least affected by air pollution because they have a stronger immune system than other groups.

Learn more about air pollution at: https://brainly.com/question/16357973

Which natural resource management approach acknowledges the uncertainties about the functioning of the natural resource systems?

Answers

Answer:

integrated management - C.

which information must be known about a compound to find the molecular formula from the empirical formula​

Answers

Answer:

Molecular mass or vapor density

Explanation:

The empirical formula is the simplest formula of a compound. The molecular formula expresses the exact formula of the compound. To derive the molecular formula, we need information about its molecular mass or if given the vapor density.

                (Empirical Formula)n = Molecular formula ------(i)

         n = number of repeating units of the empirical formula present in one                        mole of the molecule

          also, (molar mass of empirical formula)n = molar mass of compound

      From here, we can find n and insert in (i) above.

4 Points
Which is a cause of natural selection?
O
A. Limited food
O
B. Stable weather
O
C. Unlimited shelter
O
D. Lack of predators

Answers

The cause of natural selection would most likely be limited food which causes competition
It’s limited food hope it helps

Why do some codons code for the same amino acid as another codon?

A. it is due to mutations.

B. There are only 20 amino acids and 64 possible combinations

C. Each codon is unique and they all code for different amino acids.

Answers

Answer:

B

Explanation:

i think it is b, because if they have 20 amino acid, 64 possible combination

they will be able to combine between themselve

Answer:

B. There are only 20 amino acids and 64 possible combinations

Explanation:

The genetic code is degenerate this means that more than one codon codes for a single type of amino acid.This degeneracy occurs because there are 64 possible triplets of the bases that exist however there are only 20 amino acids known to encoded by the genetic code. Out of this 64 possible triplet codons, 61 triplets are responsible for coding the amino acid whereas three of them form a stop codon that helps terminate the translation.

Why is the fossil record incomplete? Choose all that apply.


Not all organisms are fossilized.


Not all scientists believe in the fossil record.


Not all fossils survive.


Not all fossils are found.

Answers

Answer:

The fossil record, however, is quite incomplete. Here's one major reason why: Sediment has to cover an organism's remains in order for the long fossilization process to begin. Most organisms decompose before this can happen.

Answer:

Not all organisms are fossilized. Not all fossils survive.Not all fossils are found.

Explanation:

The most direct way to determine the age of a species is to observe in the fossil record what was the first occurrence of this species. The biggest problem is that the fossil record is very incomplete, because many times organisms decompose before being fossilized, and many fossils have never been found. In short, we can say that the fossil record is incomplete because not all organisms are fossilized, not all fossils survive and not all fossils are found. Moreover, the fact that one finds fossils of a species from a certain age does not mean that such a species originated at that time in geological history. It may be that records of the species's presence in previous ages have been lost.

A geologist finds four layers of sedimentary rock. She determines that no geologic events have shifted the layers. She labels
the layers A, B, C, and from the top to the bottom.
Which statement about these layers is accurate?
As older than B.
Bis older than C.
C is younger than A.
B is younger than D.
Save and Exit
Nest
Save and Exit
Next
Submit
Submit
Mark this and return

Answers

Answer:

B is younger than D

Answer:

D-B is younger than D.

Explanation:

In sedimentary rocks, the bottom layers are older that overlaying layers. This is because sediments are placed on top of each other by surface runoffs to ocean beds. Therefore, the first sediments to be deposited will always be towards the bottom as more and newer ones are brought in and deposited.

Which is not a high-level radioactive waste?

fuel rods

control rods

reactor coolant

contaminated clothing

Answers

ANSWER:

Contaminated clothing is not a high level radioactive waste but a low level radioactive waste.  

EXPLANATION:

Radio-active waste is any waste that contains radio-active material and is usually a "by-product" of nuclear reactions. Radio-active waste is considered to be hazardous for all forms of life as well as the environment. High level radio-active waste contains high levels of radio-active material and therefore must be disposed as soon as possible. Contaminated clothing has very low level of radio-active waste that can be removed by washing in appropriate medium.

Which feature is characteristic of healthy coral reefs?
A. Shallow, clear water
B. Clear freshwater
C. Deep, salty water
D. Cold, murky water​

Answers

Answer:

Answer A

Explanation:

The correct answer is option A, that is, shallow and clear water. Coral reefs refer to the shallow-ocean habitats, which are occupied with sea life. The massive composition that coral reef comprises of is actually manufactured of coral polyps that are the small marine species, which live in colonies.

The hard compositions are left behind when these marine species die, and the branching and stony composition, which is left is limestone and is robust enough to produce a home for new species.

Final answer:

Healthy coral reefs are characterized by shallow, clear water and high biodiversity. The organisms living in the reefs have a mutualistic relationship with photosynthetic unicellular algae, which provide them with nutrition and energy. This clear water allows light to penetrate, supporting the growth of both corals and algae.

Explanation:

Coral reefs are ocean ridges formed by marine invertebrates living in warm shallow waters within the photic zone of the ocean. They are mostly found within 30 degrees north and south of the equator. Coral reefs are characterized by high biodiversity and the structures created by the invertebrates that live in them. They provide nourishment and shelter for a wide variety of species, including over 4,000 fish species.

Shallow, clear water is characteristic of healthy coral reefs. The organisms living in these reefs have a mutualistic relationship with photosynthetic unicellular algae, which provide them with nutrition and energy. The clear water allows light to penetrate, allowing the algae to carry out photosynthesis and the corals to thrive.

How is the range of a data set determined?
A. Sum of the data divided by the number of data points.
B. It is all real numbers.
C. Largest value plus the smallest value, divided by 2
D. Largest value minus the smallest value.

Answers

Answer:

D

Largest value minus the smallest value

Explanation:

The range of a set of data is the difference between the highest and lowest values in the set. To find the range, first order the data from least to greatest. Then subtract the smallest value from the largest value in the set.

Final answer:

The range of a data set is determined by taking the largest value and subtracting the smallest value. For a given example data set {3, 4, 5, 6, 9}, the range is calculated as 9 - 3, hence the range is 6.

Explanation:

The range of a data set in mathematics is determined by subtracting the smallest value in the set from the largest value. This concept is used in statistical analysis to measure the dispersion or spread in a data set. So, the correct option from the choices you provided is D. 'Largest value minus the smallest value'. Let's look at an example: If we have a data set that includes the numbers {3, 4, 5, 6, 9}, the range would be calculated as 9 (largest number) minus 3 (smallest number), which equals 6. So, the range of this data set is 6.

Learn more about Range in Mathematics here:

https://brainly.com/question/33612635

What about cellouse makes it ideal for structural support

Answers

Cellouse is ideal as a structural material since it’s fibers give strength and toughness to a plants leaves , roots and stems
Answer:

Due to the strong intermolecular force of attraction in cellulose it provides high strength and support.

Explanation:

Cellulose is a significant polysaccharide since it is the most copious natural compound on Earth. Cellulose is a significant segment of intense cell dividers that encompass plant cells, and it's what makes plant stems, leaves, and branches so solid. It absolutely takes a ton of effort to cause damage to the structure of cellulose.  

Cellulose particles are arranged parallel to one another and are combined with hydrogen bonds. This structures long, link like structures, which join with other cellulose atoms and is the thing that produces such a solid help structure.

Describe why biodiversity increased with the introduction of sea otters in California over the last fifty years

Answers

Answer:

Due to increment in food chains.

Explanation:

Biodiversity is actually the measure of changes in the ecosystem, genetic levels and various species levels. The sea otters introduced in California over last fifty years, increased the diversity in the ecosystem as well as in species too, thus changing the biodiversity. This was the impact of increase in food web in that particular area, the number of consumers, producers and prey increased thus increasing the biodiversity.

Other Questions
Is (4y-8)cm divided by 2 equals to 4y-8cm over 2 and then a cm or is it (2y-4)cm? Explain how simulation is used in the real world. Provide a specific example from your own line of work, or a line of work that you find particularly interesting. Type the correct answer in the box. Use numerals instead of words. If necessary, use / for the fraction bar. The solution set of n2 14n = -45 is [ ] (01.03 MC)Which of the following is a step in simplifying the expression(Xy^4/x^-5y^5)^3 10. If 15 - x = 4, then x =A. -21B. -11C. 1D. 11 What is the solution to the following equation? 4(3x 6) + 15 = 27 2 3 4 5 Suppose your company needs $13 million to build a new assembly line. Your target debt-equity ratio is .55. The flotation cost for new equity is 6 percent, but the flotation cost for debt is only 3 percent. Your boss has decided to fund the project by borrowing money because the flotation costs are lower and the needed funds are relatively small. a. What is your companys weighted average flotation cost, assuming all equity is raised externally? (Do not round intermediate calculations and enter your answer as a percent rounded to 2 decimal places, e.g., 32.16.) b. What is the true cost of building the new assembly line after taking flotation costs into account? (Do not round intermediate calculations and enter your answer in dollars, not millions, rounded to the nearest whole dollar amount, e.g., 1,234,5667.) 2 PointsWhat is the role of consumers and producers in a free-market system?OA. They do what government planners tell them.OB. They allocate resources for production.C. They provide goods and services to workers.OD. They make the economic decisions.SUBMIT A three-year-old-has stuck a crayon in his nose. Assessment reveals the crayon to be deeply embedded in the right nostril with some irritation and swelling noted. His vital signs are: pulse 124, respiration 20, and SpO 2 100 percent. Which of the following would be MOST appropriate when caring for this child? Continental crust grows, recycles, and evolves by direct means of both, ________ and _________.seafloor spreading and terrane accretionseafloor spreading and hot spot magmatismseafloor spreading and subduction magmatismterrane accretion and subduction magmatismearthquakes and volcanism Which was true of new Spain? A. Within a few years, no one spoke Spanish B. There were too many men because woman wanted to become nunsC. There was no class systemD. Although Spain wanted families to immigrate , most of the settlers were male A city determines that a planned community must have at least 4 acres of developed and open space, and the differencebetween the number of developed acres, y, and the number of open acres, x, can be no more than 1. Which graphrepresents the system of inequalities for this scenario? A conventional current of 7 A runs clockwise in a circular loop of wire in the xy plane, with center at the origin and with radius 0.097 m. Another circular loop of wire lies in the same plane, with its center at the origin and with radius 0.03 m. How much conventional current must run counterclockwise in this smaller loop in order for the magnetic field at the origin to be zero? Which of the following is a heterogeneous mixtureA) A hot cup of coffeeB) Hot teaC) A milk chocolate barD) A fruit salad Felicity set the thermostat of her refrigerator to 37F. The refrigerator temperature t in degrees Fahrenheit h hours after the temperature sensor in the refrigerator is activated satisfies t=1cos(1.05h)+37 . Determine the period of the function and explain what it represents. Include the maximum and minimum temperatures in your answer. What is the most downloaded iphone application of all time? What is the magnitude of the kinetic frictional force A Carnot cooler operates with COP = 11, whose ambient temperature is 300K. Determine the temperature at which the refrigerator absorbs heat. Can someone please help me, I need to know the missing side length (x) using trigonometric ratios. A certain drug is made from only two ingredients: compound A and compound B. There are 3 milliliters of compound A used for every 5 milliliters of compound B. If a chemist wants to make 680 milliliters of the drug, how many milliliters of compound A are needed?