The Declaration of the Rights of Man made all French citizens equal before the law. How did this equality contrast with the ways of the Old Regime? The declaration removed the king from power. The declaration forced the aristocracy to give up their land. The declaration created a separation between church and state. The declaration abolished the three estates.

Answers

Answer 1
 The declaration abolished the three estates.
Answer 2

The Declaration of the Rights of Man made all French citizens equal before the law. This equality contrast with the ways of the Old Regime as  The declaration abolished the three estates. Thus the correct option is D.

What is law?

A law is defined as a set of rules and regulations that the governing government implements in accordance with constitutional provisions in order to uphold friendly relations among citizens and ensure that a nation is run effectively.

During the first few months of the French Revolution, on August 26, 1789, the National Assembly of France approved the Declaration of the Rights of Man and of the Citizen.

The Declaration's fundamental tenet was that "man is born a slave and similar in rights," which were defined as the liberties, private property rights, protection of individual the person, and the freedom to oppose government.

Therefore, option D is appropriate.

Learn more about the Declaration of the Rights of Man, here:

https://brainly.com/question/2895481

#SPJ5


Related Questions

Which founding father held the role of lead military general during the American Revolutionary War?
A.
Thomas Jefferson
B.
George Washington
C.
Paul Revere
D.
Benjamin Franklin

Answers

b. george washington was the leader of the continental army.

According to the publius what are two examples of foreign nations not taking the U.S. seriously?

Answers

Final answer:

American countries and developing nations are two examples of foreign nations not taking the U.S. seriously.

Explanation:

Two examples of foreign nations not taking the U.S. seriously can be seen in the relationships with American countries and developing nations in the past. In the case of American countries, the U.S. interference in their affairs to protect their markets led to a legacy of bitterness and resentment. This resulted in these countries not taking the U.S. seriously. In the case of developing nations, the U.S. tended to view their affairs from a colonialist perspective, not giving them the attention and respect they deserved. Vietnam serves as an example of the consequences of this mentality.

During the great earthquake in Chile in 1960, what mitigated the loss of life?
a. It did not occur in an area that was very populated.
b. Chile’s excellent building codes kept most structures standing.
c. Chile’s location next to the Pacific Ocean.
d. The people felt the foreshocks before the actual earthquake hit and left their homes.

Answers

During the great earthquake in Chile in 1960, the cause that mitigated the loss of life was that the people felt the foreshocks before the actual earthquake hit and left their homes.

The correct answer is - d. The people felt the foreshocks before the actual earthquake hit and left their homes.

Before the major earthquake stroke, there were multiple others that were in front of it, and this scared and also warned the people, so they left their homes as quick as possible. When the main earthquake stroke, it was with a magnitude of 9.5, and it was and remained as the strongest earthquake of the 20th century. The earthquake itself did not killed any people, but the resulting tsunami managed to kill little over 1,600 people, and living 2 million people effectively homeless.

What was one place on the globe where the cold war was hot?

Answers

Korea was one place on the globe where the cold war was "hot."

How did oliver cromwell open the halls of government to citizens?

Answers

Cornwall opended the halls of governemnt to the citezens by abolishing the monarchy as well as the House of the Lords.

Which answer best describes how the Supreme Court viewed Maryland's taxing of the national bank created after the War of 1812? (10 points)

a) The Supreme Court decided Maryland was within its rights as a state.

b) The Supreme Court decided Maryland had created the model for state governments.

c) The Supreme Court decided Maryland had challenged the authority of federal power.

d) The Supreme Court decided Maryland used implied power over the federal government.

Answers

The answer is c. hope it helps
Final answer:

The Supreme Court in McCulloch v. Maryland (1819) decided that Maryland could not tax the national bank and had challenged the authority of federal power.

Explanation:

The Supreme Court's view on the matter of Maryland taxing the national bank is best represented by McCulloch v. Maryland (1819). According to this landmark decision, the Supreme Court determined that the state of Maryland had challenged the authority of federal power by attempting to tax the Second Bank of the United States. The Court asserted that through the Necessary and Proper Clause of the Constitution, Congress had the authority to establish a national bank as it was a means to fulfill its constitutionally enumerated powers. The ruling also emphasized that states did not have the power to tax the national government, as doing so could undermine federal operations.

Why was the printing press so significant?

Answers

Because it allowed people all over the world to be able to have a bible, and it allowed the newspaper to be created.

Which of the following groups would most likely support the policies of Alexander Hamilton?

Answers

C, entrepreneurs in the manufacturing north

what did the supreme court decide in dred scott vs. sanford

Answers

Dred Scott vs. Sanford ruled that Black Americans were not American citizens and did not have the right to sue someone in federal court. It also ruled that Congress lacked the power to ban slavery in the U.S..

Define or explain powhatan

Answers

Native American people in Virginia



Edward III's major contribution was to restore Archbishop Stratford as chancellor.
True
False

Answers

That statement is false

The two assemblies that made up the Roman senate were

Answers

I'm pretty sure the two assemblies are the Curiate and the Tribal assemblies. However there was also an assembly called the Centuriate assembly.

Answer:

military and tribal

Explanation:

edg

What was the most serious criticism against the Constitution?

It lacked a bill of rights for the people.
Not all colonists favored the Constitution.
The government did not have the power to enforce it.

Answers

The correct answer is it lacked a bill of rights for the people.

This fight for a bill of rights for the people was lead by a group known as the Anti-federalists. The Anti-federalists feared that the new constitution did not guarantee a certain set of rights to citizens. This groups fear was that without this list of rights, the central (aka federal) government may become tyrannical and take away rights from citizens. This fear was rooted in America's experience as colonists under the control of Great Britain.

This is why the US Constitution ended up with a bill of rights, as Anti-federalists refused to agree to it until one was implemented.

Answer:

It lacked a bill of rights for the people.

Explanation:

hope it helps! <3

Which founding father held the role of lead military general during the American Revolutionary War?
A.
Paul Revere
B.
Benjamin Franklin
C.
George Washington
D.
Thomas Jefferson

Answers

C George Washington.

Answer: George Washington

C.

Explanation:



Which statement best characterizes the American population between 1790 and 1850?
The American population stayed about the same with regard to people living in urban or rural areas.
The American population was becoming more urban than rural.
The American population was becoming more rural than urban.
The American population became more urban than rural until 1850 and then leveled off for the next sixty years.

Answers

The correct answer is the second choice which is where the American population was becoming more urban than rural because the American population between 1790 up until 1850, started to progress in which they are likely to be more into things that are trendy in which urban people engage in, making them to be influence and associated to it than of the rural life.
Final answer:

Between 1790 and 1850, the American population was becoming increasingly urban due to the economic opportunities provided by the Industrial Revolution, but the majority still lived in rural areas.

Explanation:

The statement that best characterizes the American population between 1790 and 1850 is that the population was becoming more urban than rural. During this period in American history, the Industrial Revolution influenced a shift from a primarily agrarian society to one that was more urbanized. Rapid industrialization led to the rise of factory jobs and growth of cities, drawing more people to move to urban areas from rural ones for better economic opportunities.

It's important to note that while there was an urbanization trend, the majority of the American population still lived in rural areas since the transition was a gradual process that continued throughout the 1800s.

Learn more about American population here:

https://brainly.com/question/17297348

#SPJ6

Which became a new focus for the NAACP after 1950?
creating equal facilities for segregated schools
ending segregation in public education
funding African American public schools
strengthening segregation in public education

Answers

The correct answer is ending segregation in public education

They were famous supporters of creating schools for everyone and were highly involved in the revolutionary Brown vs. Board of Education court case.

Ending segregation in public education became a new focus for the NAACP.

What is NAACP?

This is known as National Association for the Advancement of Colored People and is a civil right organization which was established around 1909 to eliminate racial segregation.

This organization focused on ending segregation in public education after 1950 which was why option B was chosen as the most appropriate choice.

Read more about NAACP here https://brainly.com/question/1146050

What foreign dictator did this American think had good ideas?

A.
Will Rogers - Adolf Hitler

B.
Charles Lindbergh - Joseph Stalin

C.
Philip LaFollette - Benito Mussolini

Answers

C.
Philip LaFollette - Benito Mussolini

Philip LaFollette - Benito Mussolini  foreign dictator did this American think had good ideas. Option (c) is correct.

What do you mean by Idea?

A strategy, idea, or recommendation, especially one that addresses what to do in a specific circumstance. Calling before we go might be a good idea.

Benito Mussolini was the first fascist dictator in 20th-century Europe and the prime minister of Italy (1922–1923); The local blacksmith's first child was Mussolini. Later in life, he proudly acknowledged his modest beginnings and frequently referred to himself as a "man of the people."

Therefore, Option (c) is correct. Philip LaFollette - Benito Mussolini  foreign dictator did this American think had good ideas.

Learn more about Idea, here;

https://brainly.com/question/320670

#SPJ2

From your reading, why do you think President president roosevelt believed america needed to expand its realm of influence?

Answers

President Theodore Roosevelt asserted the right of the United States to intervene to stabilize the economic affairs of small nations in the Caribbean and Central America if they were unable to pay their international debts. Thank you for posting your question here at brainly. I hope the answer will help you. Feel free to ask more questions.

. How does amending the Constitution demonstrate the desire to make a “more perfect union” by U.S. citizens?

Answers

The Constitution clearly defines the roles of government and protects the rights of citizens. It has a built-in "checks and balances" system to prevent one branch from becoming too powerful. It also provides for procedures to amend the document as the nation's needs change. It was a vast improvement over the Articles of Confederation that provided almost all power to the states, but didn't provide for any real way to regulate relations between the states. 


Many argue the Constitution doesn't work anymore, but there is one catch to our form of government. It requires an educated and responsible citizenry to participate in the process. We have gotten away from that and now most people are overcome with apathy. What we need is for people to get educated and pay attention to the process and not shows like American Idol.

Which phrase best describes the tone of Langston Hughes poem Harlem 2

Answers


Below are the choices:

growing fear
uncontrolled rage
extreme happiness
 deep bitterness

I believe it would be the first one since there is anger or happiness in the context. I Would have to say fear because they don't understand something, and sometimes that can cause someone to be scared of the outcome.

Answer:

I took the test and the answer is A.

growing fear

Explanation:

Who was arguably most influential in the unification of Germany?

Answers

The correct answer for the given question above would be Otto von Bismarck. Otto von Bismarck was arguably one of the most influential figures in Germany's unification. Otto con Bismarck designed a series of wars that ultimately led to  the unification of the disparate German states. He was chancellor of Prussia and Germany and out played everybody at diplomacy and foreign affairs. Hope this answers your question.

What does the author say about the bulk of the content in the Declaration of Independence?

A. That it was nothing new to Congress
B. That it was first written by Benjamin Franklin
C. That it was not tough enough on the British
D. That it was poorly written

Answers

The author say about the bulk of the content in the Declaration of Independence,That it was nothing new to Congress.

Muslim achievements include all of the following except a) inventing the arch b) introducing Aristotle to the Christian West c) inventing algebra d) correcting star charts

Answers

 a) inventing the arch
The Romans did that one. 

Answer:

The correct answer is "A".  

Muslim achievements include all of the following except inventing the arch.

Explanation:

About the invention of the Arch: The arch is an invention of prehistory that is attributed to different human populations since it was used in different parts of the planet as tool that boosted hunting activity.Taking into account different archaeological finds it is known that this element was included in cave paintings of different cultures.

About the introduction of Aristotle in the Christian West: Although Neoplatonism was the main philosophical influence in Christian thought, Aristotelian thought also shaped Christian teachings in the West when his  work on physics, metaphysics and ethics became available in Latin, translated from Greek or Islamic sources. Many works of Aristotle traveled to Western Europe from Al-Andalus (name that the Muslims gave to the Iberian Peninsula).

About the invention of Algebra: An important mathematician was Mohammed ibn-Musa Al-Jwarizmi, to whom we owe the term algebra, which comes from the title of the book "Al-jabr w'al-muqabalah", which means science of transposition and simplification.While the word "algebra" comes from the Arabic word (al-Jabr), its origins date back to the ancient Babylonians, who had developed an advanced arithmetic system with which they were able to make calculations in an algebraic form. The history of algebra It began in ancient Egypt and Babylon, where they were able to solve linear (ax = b) and quadratic (ax2 + bx = c) equations, as well as indeterminate equations such as x2 + y2 = z2, with several unknowns.

About the correction of Stars Charts: It is said that in Muslim astronomy the first accurately drawn star card was made by the Persian astronomer Abd al-Rahman al-Sufi in 964. It contained illustrations of the constellations and portrayed the brightest stars as points. This book was an update of the catalog of stars elaborated by Ptolemy.

In the late 1800s farmers demanded an increase in the money supply through the influx of silver. What law tried to meet the demands of the farmer?

Answers

The bland Allison-act tried to meet the demands of the farmer in the late 1800's when farmers demanded an increase in money supply through the influx of silver
The correct answer of the given question above would be the BLAND-ALLISON ACT. The law tried to meet the demands of the farmer in the late 1800s when farmers demanded an increase in the money supply through the influx of silver is the Bland-Allison Act. 

How did the lifestyle of nobles at Versailles contribute to unrest in France?

Answers

the peasants didn't like that they were homeless while the nobles were living in a palace

France was undergoing such a drastic economic depression that there wasn't enough food to go around. As with most monarchies, the upper class was always insured a stable living, so while the rich remained very wealthy, the majority of the French population was starving.

Meanwhile, the royal court at Versailles was isolated from and indifferent to the escalating crisis. While in theory, King Louis XVI was an absolute monarch, in practice he was often indecisive and known to back down when faced with strong opposition. While he did reduce government expenditures, opponents in the parliaments successfully thwarted his attempts at enacting reforms.

What did President Johnson do to warrant articles of impeachment being brought against him?

Answers

In order to warrant articles of impeachment being brough against him, he defied the Tenure of Office Act by firing a cabinet member. Although the impeachment trial of Andrew Johnson was ostensibly about a violation of the Tenure of Office Act, it was about much more than that. Also on trial in 1868 were Johnson's lenient policies towards Reconstruction and his vetoes of the Freedmen's Bureau Act and the Civil Rights Act. The trial was, above all else, a political trial. I hope this is a god info for you

He defied the Tenure of Office Act by firing a cabinet member.

What was one result of the breakup of the Soviet Union?
(A)Russia faced a smooth transition from its communist system to capitalism and democracy.
(B)The Russian military attempted to seize control of the government in a violent coup d’état.
(C)Former republics of the Soviet Union joined a new nation that became known as Russia.
(D)Russia briefly led a confederation of independent states and maintained some control of the region.

Answers

The correct answer is D. Russia briefly led a confederation of independent states and maintained some control of the region. Answers B and C did not occur as a result of the breakup of the Soviet Union, and A is not true because the transition to democracy and capitalism for Russia was very challenging. 

Answer:

The Correct Answer is Option D.

Explanation:

Soviet Union Economy failing due to many factors such as:They spent a lot of money on an "Arms Race" with the United States.Their Economy could not compete with the free market economy of the West.They are losing control over the Communist countries. Gorbachev recognized the Independence of Lithuanian and the other Baltic States.In December 1991 Russia, Belarus and Ukraine declared independence and formed the Commonwealth of Independent States.

The reign of terror during the french revolution led to the

Answers

It led to the execution of thousands suspected of treason. 

Answer:

it is C.the invasion of france by several foreign armies

Explanation:

Which of the following is a true statement about the federal government?

The legislative branch is bicameral with two houses that work together to pass legislation.
The legislative branch is unicameral with one house that only works on passing legislation.
The executive branch is bicameral with two houses that work together to pass legislation.
The executive branch is unicameral with one house that only works on passing legislation.

Answers

The legislative branch is bicameral with two houses that work together to pass legislation is true statement about the federal government.

Answer:

The true statement about the federal government is that the legislative branch is bicameral with two houses that work together to pass legislation.

Explanation:

Article One of the Constitution of the United States puts all the legislative powers of the federal government in Congress. This is a bicameral body, composed of the House of Representatives and the Senate.

The House of Representatives has 435 members representing a congressional district they serve for a biennium. The positions are divided according to the population of each state. Currently, its number does not grow, although in the beginning, one representative corresponded to every 30,000 people.

In contrast, each state has two Senators, regardless of their population. There are 100 senators, who serve at least a six-year term. Both the representatives and the senators are now elected by the people.

Which of the following is NOT TRUE about the Supreme Court?
A. There is only one chief justice on the Court.
B. There are eight associate justices on the Court.
C. The chief justice is always the justice who has served the most years on the
Court.
D. The Supreme Court is the highest court in the land.

Answers

Options A, B, and D are true, and option C. Is not true. The chief justice is chosen by the president and does not need to be the longest serving justice, and the nomination is confirmed by the senate.
C. The chief justice is always the justice who has served the most years on the 
Court. is NOT TRUE :) Hope this helps
Other Questions
What is the common difference d of the sequence?9, 8, 25, 42, 59, ...d = During World War II, many blacks migrated from the South to industrial cities in the North. Why did they do this? Which of these is a complete sentence? (1 point) A. Starting at four o'clock.B. The theater where rehearsals take place..C. Stage hands, props, and lighting crew.D. Hannah memorized her lines. A number has the digit 8 and 4 .to the nearest 10.the number round to 50.what is the number? are fruit battery's good for the enviorment a landscaper estimates that a set of plants can be installed in six hours by 12 workers the landscaper wants to finish a set of plants in 4 hours assuming that the variables are inversely related how many workers should the landscaper bring to the job How did airports encourage city growth ?a. they promoted the building of hotels, restaurants,services and rapid transit to accommodate travelers b. they are so big and require so much land that they need a larger population to be sustained c. they limit the effects of gridlock and make travel more pleasantd. they were responsible for transporting over 13 billion tons of materials Second grade homework easy!!!! Plz answer 15 pointsThx "lucy owns a bakery in 2006 she sold pies for $9.50 each in 2010 she sold pies for $17.50. Find the rate of change for the price of a pie from 2006 to 2010" Si te gusta estudiar, leer y escribir cuentos eres write 2.18 as a mixed number in simplest form Find the Nth term of the following sequence...7, 27, 47, 67, ..... Marvin is trying to finish 1/2 of his test every 2/3 hour. How many hours will it take Marvin to complete his whole test List the integers between the square root of 15 and the square root of 48 ? Why is radium valuable what is 3400 as a decimal answer asap Solve the given differential equation dN/dt=kN, (k=constant) ...? The trash, located by the sink, is always taken out at least once a week to keep the kitchen from smelling. What is the dangling modifier in this sentence? Given the ip address 192.168.112.0. each network requires between 35 and 60 hosts. what is the broadcast address of the first available subnet? 30 POINTS DONT ANSWER IF YOU DONT KNOW THE ANSWER FOR SUREIn the gene TATTCATTGTTATGATTTATTCG, CATTGTTA encodes for pepsin, a digestive enzyme. The rest of the sequence doesnt code for any protein. Which sequence contains a mutation that will affect the formation of pepsin?A. TATTCATTCATTATGATTTATTCGB. TATTCATTGTTATGACTTTATTCGC. TATTCATTGTTATGATTTATTGGCGD. TATTCATTGTTATGATATTCGE. TGCATTCATTGTTATGATTTATTCG