The definition of mutation is "any heritable change in the genetic material." the qualifier "heritable" is necessary because: most changes in the genetic material are repaired soon after they occur. changes in the genetic material occur at random along the genome. changes in the genetic material occur without regard to the needs of the organism. most changes in the genetic material are harmful to the organism.

Answers

Answer 1
The qualifier "heritable" is necessary because most changes in the genetic material are repaired soon after they occur. A heritable change is a genetic change that is passed on to the off springs and it is not lethal. These changes can mutate and become a weakness or a strength.

Related Questions



Which of the following might be an observation related to global temperature increases?

Glaciers in many areas of the world are shrinking.

The number of predatory birds in an area is decreasing over time.

There is an increase in skin cancer deaths in the United States.

CFC concentrations in the atmosphere are high.

Answers

Final answer:

Glaciers shrinking in various regions is a strong indicator of global temperature increases. This is part of the broader effects of global warming, which include ecosystem disruption and rising sea levels linked to human-induced greenhouse gas emissions.

Explanation:

An observation that might be related to global temperature increases is that glaciers in many areas of the world are shrinking. This phenomenon, often referred to as glacier recession, has been well-documented in various parts of the world, including Glacier National Park in Montana. The retreat of glaciers is a direct consequence of rising mean annual temperatures, which has been recorded at an increase of 1.33°C since 1900 in the park. As glaciers shrink, they contribute to rising sea levels and affect local ecosystems by reducing seasonal water supplies.

The impact of global warming is not limited to glacier retreat; it also encompasses the loss of polar ice fields, increases in extreme weather events, shifts in habitats and biodiversity, and a range of other ecological disturbances. These changes are indicative of the broader shifts occurring due to increases in greenhouse gas emissions, which have been linked to human activities such as the burning of fossil fuels.

Eukaryotic cells have developed more specialized functions than prokaryotic cells. What is this referring to?

Prokaryotic cells do not have a means for movement like eukaryotic cells do.

Prokaryotic cells exist in multicellular organisms and differentiate, but eukaryotic cells do not.

Eukaryotic cells are larger and have smaller surface area to volume ratios than prokaryotic cells.

Eukaryotic cells have membrane-bound organelles with specific functions, but prokaryotic cells do not.

Answers

Eukaryotic cells have membrane-bound organelles with specific functions, but prokaryotic cells do not.

Eukaryotic cells have membrane-bound organelles with specific functions, but prokaryotic cells do not, this makes eukaryotic cells more specialized, hence option D is correct.

Why are eukaryotic cells considered more specialized?

Eukaryotic cells also contain additional membrane-bound components known as organelles in addition to a nucleus. Eukaryotic cells can be more specialized than prokaryotic ones because to organelles.

Eukaryotes frequently have several cells, but prokaryotes are invariably unicellular. Eukaryotic cells are also between 100 to 10,000 times bigger and more complicated than prokaryotic cells. Prokaryotic DNA is kept in the cytoplasm, whereas DNA in eukaryotes is kept in the nucleus.

Therefore, they are able to perform complicated metabolic reactions that prokaryotic cells are unable to due to their ability to maintain many habitats within a single cell.

Learn more about eukaryotes, here:

https://brainly.com/question/14823352

#SPJ2

The protoplasm and cytoplasm of a plant are interchangeable terms.
a. True
b. False

Answers


B. False

Protoplasm- includes the nucleus
Cytoplasm- excludes the nucleus

SOS:

The answer is FALSE!!!

The cytoplasm is protoplasm that surrounds the nucleus. All the organic substances of the cell are referred to as the protoplasm. The cytoplasm and the nucleus make up the protoplasm.

Hope this helps!!

How does producing plastics benefit the economy?

Answers

Producing plastics benefits the economy by employing workers and it helps the economy of every state by spending billions of dollars on shipping plastic products. 

Hope this helps! Have a good day. 

Plastic has economic benefits and can save resources. It increases food shelf life and reduces fuel usage by being lightweight.

Why is plastic industry important?

The use of plastic has been shown to have a number of direct financial benefits as well as the potential to improve resource efficiency. It lengthens the time that food can be stored without going bad, which cuts down on food waste, and its relatively low weight cuts down on the amount of fuel needed to transport items.

The invention of computers, mobile phones, and the majority of the life-saving advancements in modern medicine would not have been conceivable without plastics. Plastics, thanks to their low weight and superior insulating properties, contribute to the reduction of fossil fuel consumption in heating and transportation.

The usage of plastics not only enables us to lead more fulfilling lives but also makes a positive contribution to the preservation of the environment. Plastics are actually beneficial to the protection of the environment since they help cut down on trash, which in turn helps save energy in our houses, cuts down on the weight of vehicles, which results in fewer greenhouse gas emissions from the burning of gasoline, and so much more.

Learn more about plastics, here:

https://brainly.com/question/11452652

#SPJ2

Do you think that humans and humpback whales share a common evolutionary lineage?

Answers

Yes because when it comes to whales and humans we have a lot in common. They have different behaviors and languages within their own culture as humans do.They come in a lot of sizes and have different behaviors. Just like us and they are also mammals. While other sea creatures have gills.

Yes, humans and humpback whales share a common evolutionary lineage. Both humans and humpback whales are mammals, which means they have many biological similarities.

Additionally, research has shown that all mammals share a common ancestor that lived approximately 200 million years ago, so humans and humpback whales would have diverged from this common ancestor and evolved along separate paths.

Genetic studies have also provided evidence for the relatedness of humans and other mammals, including whales.

The last common ancestor of humans and whales lived over 95 million years ago and was a small, insect-eating mammal that lived on land.

Learn more about mammals at:

https://brainly.com/question/15326492

#SPJ2

What gene does aacgaagaggacatagagtatctaccgaaaaacaatcccgaaggaccgttacaacactcgatcaaccgcaagaaagtacgatggcaacatccattgtgtatgcatccatatctcatccagcattctgaaagggtaatgaataattattccgctgagttcatgaggtatccgaaggaggagcaacacttaggctataagagtatcatgcacatagatcgggataaatcgcctatcatatgtgacaacaatttcatgattaaaagt code for?

Answers

A gene instructs for the making of protein molecules.
Please make brainliest!☺

Heat exhaustion is a deadly heat stress illness that occurs when the body's heat production significantly exceeds its cooling capacities and core body temperature rises to dangerous levels. heat exhaustion is a deadly heat stress illness that occurs when the body's heat production significantly exceeds its cooling capacities and core body temperature rises to dangerous levels.
a. True
b. False

Answers

This question is false.

the graph shows the percentage of dog breeds affected by elbow dysplasia, which causes dogs to limp. What???s the most likely explanation for the mixed breed???s disease incidence?

Answers

it have low diversities 

Answer:

The most likely explanation is that the mixed race has a low diversity in genes.

Explanation:

Elbow dysplasia is a condition that causes a bad development in the elbows of dogs, causing a bad formation of cartilage in that region of the paw, or a bad structure of the surrounding bones.

This condition is common in mixed breeds, because these breeds have little diversity of genes, allowing this disease to be passed to the offspring during crossbreeding between dogs that already have the disease.

The major problem with hydrogen as an alternative source of energy is that none exists on the surface of the earth.
a. True
b. False

Answers

The answer will be False! Because it does not have hydrogen as an alternative source of energy it is not exists on the surface of the earth.

Hope it helped

Answer will be bolded

What neuronal action occurs at the pyramids of the medulla oblongata? what neuronal action occurs at the pyramids of the medulla oblongata? there is a slight drying of brain tissue due to lack of cerebral spinal fluid in this region. the axons of upper motor neurons cross to the opposite side of the brain. cranial nerves attach at this region and cross to the opposite side of the brain. the axons of general sensory neurons relay proprioceptive impulses from the spinal cord to the cerebellum at the pyramids?

Answers

The axons of upper motor neuron cross to the opposite site of the brain.

Multipolar neurons are found in the cerebral cortex, amygdala. Pyramidal neurons are usually primary excitation unit of mammalian prefrontal cortex and corticospinal tract. Pyramidal tracts such as the corticospinal tracts and corticobulbar tract motor fibers are contained in the pyramids. The lower limit of pyramids is marked when the fiber crossed or decussate. Most of the fibers of the pyramidal tracts  leave the pyramid in bundles and decussate in the anterior medial fissure of the medulla. 
Final answer:

At the pyramids of the medulla oblongata, upper motor neurons cross over to the opposite side of the brain. This results in contralateral control of the body for voluntary movements. Sensory information from the periphery is relayed to the cerebellum for feedback.

Explanation:

The neuronal action that occurs at the pyramids of the medulla oblongata involves the upper motor neurons in activities pertaining to voluntary movements. The axons of upper motor neurons cross to the opposite side of the brain in this area. This crossing over, also known as pyramidal decussation, allows for the contralateral control of the body, meaning that the right side of the brain controls the left side of the body and vice versa.

This process is part of the corticospinal tract which is responsible for conscious or voluntary movements of skeletal muscles. The corticospinal tract descends from the cortex, passing through the deep areas of the brain and reaching the pyramids of the medulla oblongata. Here, it does its characteristic crossing over.

Motor commands from the primary motor cortex are sent down the axons to activate lower motor neurons in the ventral horn of the spinal cord. Sensory information from the periphery also enters this area, providing feedback about movements and balance to the cerebellum through the inferior olive.

Learn more about Pyramids of Medulla Oblongata here:

https://brainly.com/question/32398580

#SPJ12

Which head glands secrete sucrase, lipase, amylase, and invertase?

Answers

The answer would be labial glands.

The labial gland is a small gland that located near the orifice of the mouth. It can secrete several kinds of enzymes like sucrase and amylase that degrades the carbohydrate(sugar and starch), or lipase that degrades fat. These enzymes can help protect the mouth and teeth from bacteria.

How the planes could be used to help a patient describe a patient concern?

Answers

how the planes could be used to help a patient

The three planes namely, sagittal (median) plane, coronal plane and transverse plane. Through these planes, the position and orientation of the body parts can be described. Median plane cuts body into left and right symmetrical halves, coronal plane cuts into front and rear halves and transverse plane cuts into upper and lower portions.

Which state would best be suited to harness wind energy?

Answers

North Dakota would be the best state to harness wind energy.

The correct answer is North Dakota.


The best state which is suited to harness wind energy is North Dakota.


Harvesting of wind energy has some advantages. For example,

1 .Wind energy is one of the leanest and most effective forms of harnessing a renewable form of energy.

2. Wind energy is cleaner, more renewable and cheaper than many of the current sources of energy.


We use harnessing wind energy because,

1. It produces no pollution.

2. It produces more jobs per watt.

3.It is renewable and lasts for long

In facilitated diffusion, the carrier protein has equal affinity for the molecule being transported on both sides of the membrane. in facilitated diffusion, the carrier protein has equal affinity for the molecule being transported on both sides of the membrane.
a. True
b. False

Answers

This is false

In facilitated diffusion a molecule is moved with its concentration gradient with the assistance of a protein carrier molecule, and no energy is required.

A neuron that carries impulses away from the central nervous system is a:

Answers

the answer is sensory neurons

Does meiosis and mitosis (or both) end with unreplicated chromosomes? Which begins with replicated chromosomes?

Answers

Yes, both meiosis and mitosis end with unreplicated chromosomes.

Both meiosis and mitosis end with unreplicated chromosomes because mitosis has diploid chromosomes and meiosis has haploid chromosomes. We know that in mitosis, two daughter cells are produced that has double number of chromosomes each.

While on the other hand, in meiosis, four daughter cells are produced, each has half number of chromosomes. Mitosis is a type of cell division that start with replication of DNA in which exact copy of DNA formed which is distributed equally among the two daughter cells so we can conclude that both mitosis and meiosis end with unreplicated chromosomes.

Learn more: https://brainly.com/question/9074834

What advantage might chromosome banding patterns have in the analysis and diagnosis of chromosomal problems or abnormalities?

Answers

Chromosomal banding pattern is the pattern of colors formed when the chromosome is exposed to certain specific dyes.

These dyes do a color reaction with a special repetitive sequence of base pairs.

When the normal pattern is not obtained
there may be two reasons
1. Chromosomal injury
2. Chromosomal aberration.

In injury certain part is either deleted or shifted to somewhere else

in aberration chromosome is normal but its sequence is got changed.

So its certain that is has got great diagnostic value.
But it fails
in case of point mutation or certain others.

This banding pattern is also helpful in preliminary diagnosis of a suspect in any crime but most of the judiciaries do not assure of its results.

What are the constituents of the vascular and lymphatic systems? consider structural similarities and differences between blood and lymph vessels, differences in the cell and molecular content of the blood and lymph, differences in the mechanism of fluid propulsion within blood and lymph vessels?

Answers

Lymph vessels travel one-way, back to the heart, venous route; has similar structure to veins including tunics and valves structural difference includes the lymph vessel's need to diffuse bigger molecules; lymph transport slower and has lower pressure and speed than veins

In sickle-cell disease, variation in one gene causes red blood cells to bend, or sickle. This means the sickled cells _____.

carry toxic levels of oxygen through the body

attract larger numbers of the malaria parasite

are better at destroying the malaria parasite

cannot carry normal levels of oxygen to cells

Answers

Sickle cells are shriveled and do not function properly. Thus, they cannot carry normal levels of oxygen to cells. Think of it this way— a healthy cell that properly carries oxygen to cells is round and smooth. That’s how the cell is supposed to be. When a cell is a shriveled sickle cell, it is damaged, and isn’t able to work like it’s meant to.
Something interesting about sickle cell disease is that you can be a carrier for it (aka homozygous for the trait, Xx). Carriers are actually resistant to malaria. They have regular blood cells AND sickle cells! However, if you’re homozygous (XX) you will have complete sickle cell disease. And that’s not fun!!
Hope this helped you at all!!

In sickle-cell disease, variation in one gene causes red blood cells to bend, or sickle. This means the sickled cells cannot carry normal levels of oxygen to cells. Thus, the correct option is D.

What is sickle-cell disease?

Sickle-cell disease may be defined as a cluster of inherited red blood cell disorders.

Due to this disease, the shape of the red blood cells has an abnormal crescent, blocks small blood vessels, and does not last as long as normal red blood cells.

Due to the alterations in the shape of red blood cells, the affinity of oxygen binding decreases, and hence they cannot carry normal levels of oxygen to cells.

Therefore, the correct option for this question is D.

To learn more about the sickle-cell disease, refer to the link:

https://brainly.com/question/17063471

#SPJ5

Many older individuals develop presbyopia, a condition in which ________. the lens loses elasticity and can no longer focus for distant vision the near point of accommodation becomes further away visual acuity declines the lens loses elasticity and can no longer focus for distant vision, and visual acuity declines

Answers

Many  order   individual   develop  Presbyopia  a  condition  in  which  the  near  point  of  accommodation    become  further  away
 
 Presbyopia  is  an   eye -related  condition  that  causes  blurred near  vision.  Typically it  starts  at  around  the   age  of  $0   years.  It  may  affect   even   those   who  have  never  had  vision  problem   before.  When  presbyopia  begins  one   hold  reading  material   at   arm  length  to  help  their  eyes  focus.

A medical researcher hypothesizes that a new drug can reduce cholesterol. Which of these would most likely be the dependent variable in a study involving this medication?

A. The number of participants in the study.
B. The ages of the people treated for cholesterol with other medications.
C. The cholesterol level of the participants in the study.
D. The number of people treated for high cholesterol with other medications.
which is it?

Answers

The answer is "C. The cholesterol level of the participants in the study".

In a test or any experiment, the independent variable is controlled and the impacts watched. These watched impacts or observed factors are known as dependent variables. They are frequently the conjectured result of controlling the independent variables.  
A change in the dependent variable relies upon the independent variable and it's this relationship that scientists endeavor to measure when directing tests.

Answer:

C. The cholesterol level of the participants in the study.

Explanation:

The dependent variable is the one that is being studied in the experiment. In the given experiment, the effect of the drug on cholesterol levels is being studied.

Hence, the cholesterol levels of the experimental group would serve as a dependent variable here. According to the hypothesis, the cholesterol level is supposed to be reduced in the experimental group that is being treated with the drug.

What evolutionary development allowed plants to grow tall? see concept 29.3 (page 626)?

Answers

If your choices are the following:
A. rhizoids
B. sporophylls
C.leaves
D.the waxy cuticle
E. lignified vascular tissue

Then the answer is E.

Final answer:

The development of a vascular system with xylem and phloem enabled plants to grow tall, while the adaptations of seed and pollen facilitated reproduction independent of water and promoted wide dispersion, respectively.

Explanation:

The evolutionary development that allowed plants to grow tall was the development of a vascular system. This system includes xylem and phloem, which are tubes that transport water, minerals, and nutrients throughout the plant. The xylem is responsible for the upward transportation of water and minerals from the roots, while the phloem distributes sugars and other organic nutrients from the leaves to the rest of the plant.

Seed and pollen adaptations were crucial for the development and expansion of seed plants. Seeds allow plants to reproduce without being dependent on water, thus enabling them to survive in a variety of environments, including arid zones. Pollen, with its hardy structure, could be dispersed by wind or animals, reaching far distances and promoting gene flow between plant populations.

These developments provided plants with structural support to grow tall and compete for sunlight, while also being able to spread across vast territories.

Which precaution is most important for the nurse to teach the 32-year-old female client prescribed topical tazarotene (tazorac) cream for psoriasis?
a. apply a dressing over?

Answers

D. Adhere to strict contraceptive measures while using the drug.Rationale: Tazarotene is highly teratogenic (can cause birth defects) even when used topically. Teach sexually active women of childbearing age using this drug to adhere to strict contraceptive measures. Lesions should not be dressed, and the drug should not be stopped without consulting the prescriber. Tazarotene does not alter the immune response and thus does not increase infection risk.

Why is it said that natural selection acts on pheno- types rather than on the genetic material of organisms?

Answers

If you are strong and healthy then it doesn't matter if your genetic material isnt a complex structure
The environment can act directly on phenotypes, which are, of course the variations presented by genotypes. Genotype does determine phenotype but it is the phenotype which is exposed to the external environment so selection pressures can only act on the traits individuals have, not what gives them the trait i.e. if the same trait is produced by two different genotypes selection will act equally on both.

sweating an panting are examples of which characteristics of life

Answers

a. responding to the environment

Answer: Responding to the outer environment.

Explanation:

There are many characteristics of human beings that is required to survive. Out of all those one of them is responding to the outer environment.

The response of the outer environment can be any response by the body. Suppose the environment outside is cold then the body starts shivering and when the environment outside is hot then the body starts sweating or panting.

This is how the body responds to the outer environment.

"cold and dry" temperature and precipitation patterns are characteristic of

Answers

"cold and dry" temperature and precipitation patterns are characteristic of polar climates.

What are polar climates?

The polar climate regions are characterized by a lack of warm summers but with varying winters. Every month in a polar climate has an average temperature of less than 10 °C. Regions with polar climate cover more than 20% of the Earth's area.

Moreover, a polar climate is a place where the climate usually has a temperature below freezing, icy, and covered in snow. These areas do not get direct heat and sunlight from the sun. Polar climates are located at the North Pole of the Arctic, and at the South Pole on the continent of Antarctica.

Therefore, the polar regions surround Earth's North and South Poles. The area around the North Pole is called the Arctic. The area around the South Pole is called Antarctica.

Learn more about polar climates:

https://brainly.com/question/26116310

#SPJ6

Centers for disease control and prevention have determined that ___________ is the single largest factor affecting longevity of life.

Answers

Lifestyle is considered as the single largest factor affecting the longevity of life. Maintaining a healthy lifestyle such as having a proper diet and adequate exercise increase the longevity of life while bad lifestyle habits such as smoking, alcohol use, and drug use, decrease the longevity of life and increase morbidity.

odd one between carrot,beetroot,potato,radish

Answers

The odd one out in the given case is Potato All other things mentioned here that is Carrot, Beetroot and Radish are stem tubers while Potato is root tuber. In case of Stem tuber, there is no roots bore intact within it while in case of Root tuber, the roots can come out from any place within the tube..

Anywhere the skin is touched in that area stimulates that ____________ neuron.

Answers

Anywhere the skin is touched in that area stimulates that sensation neuron.

The leading preventable cause of cancer is _____.
A.tobacco B.UV exposure C.HPV D.bacterial infection

Answers

I think the answer is C.

Answer:

The answer is A: Tobbaco

Explanation:

Health officials estimate that almost 40 percent of cancers can be prevented by a healthy diet, physical activity, and avoidance of tobacco. In fact, tobacco use is the single most preventable cause of cancer in the world.

Other Questions
Mitchell has noticed that his co-workers are unable to open attachments in the emails he sends. What is one possible reason for this network issue? En qu ao empez a popularizarse el Son Cubano?a.en 1800b.en 1920c.1890d.1950 which of the following is not a common hydratea epsom saltb boraxc sugard alumi belive the answer is sugar A client who has been having recurrent attacks of severe abdominal pain over the past few months informs the physician about a 25-pound weight loss in the past year. the nurse attributes which factor as the most likely cause of this weight loss? What causes lithospheric plates to move? (5 point) What was the name of the treaty with which the boldt decision was concerned a treaty of Ghent b medicine Creek treaty c treaty of Seattle d treaty of Isaac Stevens evaluate the purpose and effectiveness of United States aid around the world. The price of apples went from $1.99 per lb to $3.19 per lb in four years. Find the rate of change of the price of apples. Recording music using a keyboard controller is commonly accomplished using which type of audio file format? explain why Eliza couldn't keep her family together Jonas jogged up the hill at an average rate of of a 1/12 mile per minute and then walked down the hill at an average rate of of a 1/16 mile per minute. The round trip took him 42 minutes. What is the missing value in the table that represents the distance of the trip down the hill?Table Rate Time DistanceUp the Hill 1/12 x 1/12(x)Down the Hill 1/16 42-x ? Which of the following statements is true about the function of DNA in the body?a.DNA transfers cell products.b.DNA confers structure on the cell.c.DNA makes enzymes work more efficiently.d.DNA stores the information needed to make protein., What kind of government operates in Salem, Massachusetts in 1692? A gallon of gas cost $3.15. your car goes twenty miles for every gallon. each week you will drive to and from work five times, seven-mile round trip. you will drive an extra twenty-five miles for non-work related activities. how much will you need to spend on gas in a month which statment is true Robin bought a computer for $1,250. It will depreciate, or decrease in value, by 10% each year that she owns it. a) Is the sequence formed by the value at the beginning of each year arithmetic, geometric, or neither? Explain. b) Write an explicit formula to represent the sequence. c) Find the value of the computer at the beginning of the 6th year. Commercial jets fly in the lower stratosphere. What happens to the exterior temperature of these planes as they leave the ground and rise to enter the stratosphere? what is he definition of Liveah? Use 3.14 for the radius to estimate the area of a circle the diameter is given round your answer to the nearest hundredth if necessary. Abby filled her goodie bags with 4 cookies and 3 candy bars and spent a total of $10.25 per bag. Marissa filled her goodie bags wih 2 cookies and 7 candy bars and spent a total $14.75 per bag. Each cookie costs the same amount. Each candy bar costs the same amount. Write a system of linear equation that can be used to find the cost of one cookie (x) and one candy bar (y). What was the total cost, in dollars, of each candy bar?