The processes of endocytosis and exocytosis both require?

Answers

Answer 1
require cells to expend energy
Answer 2

Answer: Uses vesicles


Related Questions

What is the basic structural unit of both dna and rna?

Answers

The Nucleotide. DNA and RNA are both nucleus acids. Nucleic acids' monomer is called a nucleotide.

How can blimps be of use in scientific studies of the air?

Answers

Blimps are efficient vehicles for holding a wide range of scientific instrumentation at various altitudes that scientists can choose. They could measure barometric pressures, temperature, concentrations of specific chemicals using special equipment, humidity using hygrometers, et cetera. Blimps also could be used to track air currents since blimps drift as they are pushed by winds.

The restriction enzyme saci has a recognition sequence of gagct^c, where the caret (^) indicates the cut site. examine the dna molecule below. agagctcagtcgagagctcagatcgataggagctcagatctcgatcacctc tctcgagtcagctctcgagtctagctatcctcgagtctagagctagtggag how many separate molecules of dna would you end up with if you treated the above dna molecule with saci?

Answers

dge78wdgqwe8fguefuqefioequf9be

There are total three molecules of dna would you end up with if you treated the above dna molecule with saci.

What are restriction enzymes?

A restriction enzyme, restriction endonuclease, or restrictase is an enzyme that cleaves DNA into fragments at or near specific recognition sites within molecules known as restriction sites. Restriction enzymes are one class of the broader endonuclease group of enzymes.

Moreover, a restriction enzyme is a protein isolated from bacteria that cleaves DNA sequences at sequence-specific sites, producing DNA fragments with a known sequence at each end. The use of restriction enzymes is critical to certain laboratory methods, including recombinant DNA technology and genetic engineering.

Therefore, four types of restriction enzymes are recognized, designated I, II, III, and IV, which differ primarily in structure, cleavage site, specificity, and cofactors.

Learn more about restriction enzymes:

https://brainly.com/question/14953274

#SPJ6

How would earth's atmosphere change if plants stopped carrying out photosynthesis?

Answers

the plant would no longer put out oxygen, and the concentration of carbon.
the atmosphere would no longer have oxygen and carbon. 

What has uekaryotik cells liver, virus, oak, lactobacillus?

Answers

Eukaryotic cells have chromosomes, a membrane-bound nucleus, and membrane-bound organelles, practically any living thing. Eukaryotic cells are also considered animal cells. 

It could be both liver and oak
It could also just be liver if it specifies eukaryotic animal cells. 

What to do during study hall when you have no homework?

Answers

You can do your homework, search for a project you may have, read etc
You should try doing something that will affect your grade by going up
1.study
2.finsish any missing asinements
3.study for a test
4.finish anything that's due
I hope this helps.. :)

The fitt principle is applied to physical activity and exercise. what does fitt represent

Answers

Frequency, Intensity, Time, and Type.
Final answer:

The FITT principle represents Frequency, Intensity, Time, and Type, which are guidelines for creating an effective physical exercise program to enhance physical fitness and good health.

Explanation:

The FITT principle is a set of guidelines that can help you structure a physical exercise program effectively. FITT stands for Frequency, Intensity, Time, and Type:

Frequency refers to how often you engage in physical activity or exercise.Intensity indicates how hard you exercise during a workout session.Time refers to the duration of each exercise session.Type means the kind of exercise you do to improve or maintain physical fitness and overall good health.

Employing the FITT principle helps ensure that the workouts you perform are balanced and cover all aspects necessary for a comprehensive fitness program. This can include a combination of cardiovascular exercises, strength training, and flexibility workouts.

The antibody molecule is held together by ________ bonds.

Answers

It is the disulphide bond. 

Which statement best describes the population at point D? A.The carrying capacity has been reached. B.The population density is very low. C.The birthrate is very low. D.There is unlimited food and space.

Answers

I think it might be either A or B. Hope this helped. Have a great day! :D
A. The carrying capacity has been reached. 

As you can see from the graph that there is a red dotted line (Carry capacity) and at D. this has been met.

Human growth hormone is a secreted protein that stimulates growth and cell reproduction. in the 1960s it was discovered that this was an effective treatment for a form of dwarfism. however, before it was genetically engineered, it was _____

Answers

The answer is that it was harvested from cadavers which are corpses of a body that is deceased—they are used before the treatment that is effective for dwarfism was genetically engineered and by this, there has been some studies and researches that has been found out when they harvested from the cadavers.

The bony, spiral-shaped, fluid-filled sense organ used for hearing is the __________.

Answers

Generally the ear, and more specifically the cochlea

The ear is composed of 3 parts namely:
 1. The outer ("external") ear, composed of the pinna and ear canal, 
 2. The middle ear, composed of tympanic cavity and three ossicles, 
 3. The inner ear, composed of semicircular canals, the utricle, saccule, and the cochlea. 

Hearing happens initially by allowing the pinna of your ear to focus the sound. Then, by means of the ear canal and the ossicles, the sound is sent to the fluid-filled eardrum, which begins to vibrate. The vibrations are sent to the snail-shell looking component of the inner ear called the cochlea. The cochlea senses these vibrations and converts them to nerve impulses to be interpreted by the brain, making you "hear" the sound. 




Suppose an organism can alternate between aerobic and anaerobic respiration. if it had to use anaerobic respiration exclusively, how many glucose molecules must it break down to generate the same atp as it would in aerobic respiration?

Answers

When one glucose is broken down under aerobic condition, 38 ATP are normally produced. When one molecule of glucose is broken down under anaerobic condition, 2 ATP are always produced.
If the organism is using aerobic respiration, it will generate 38 ATP. Under anaerobic condition, the organism have to break down 19 glucose molecules in order to produce 38 ATP, since it can only get 2 ATP from each glucose molecule.

The circulatory system of organisms carries nutrients throughout that organism. Which cell structure has a similiar structure?

Answers

The answer is: Endomembrane system

As food molecules are broken down during __________, carbon is released back into the atmosphere as carbon dioxide.
a. breathing
b. the nitrogen cycle
c. the water cycle
d. cellular respiration

Answers

D. Cellular Respiration

similarities between outer planets and inner planets

Answers

the outer planets are big and cold but the inner planets have more warmth and in earths case LIFE

Which set of body parts does every mollusk have?

Answers

Hello!

A mollusk is a snail in case you didn't know! Every single one has a foot, a Visceral Mass, and a head. A Visceral mass is like the body and it includes the organs.

I hope this helped!

I am, yours most sincerely,
SuperHelperThingy.

The body plan of a mollusk ordinarily comprised of a head region, a muscular foot, and a visceral mass of abdominal organs that are usually enclosed inside a dorsal shell. Each class holds some contrast on this primary plan.

The structure of the gastropod body is substantially comparable to the primary body plan of mollusks.

Most mollusks have a muscular foot for crawling or burrowing. Some mollusks also have a head with sense organs. The delicate body comprises lungs or gills to breath and digestive and generative parts, all surrounded by a covering like an organ known as the mantle.

The _____ body cavity is where the nerves of the spinal cord are located.

Answers

I believe it would be the dorsal body cavity. 

Hope this helped!

Insulin is a(n) ________ that lowers blood sugar by allowing the body's cells to absorb glucose from the blood.

Answers

Is a hormone produced by the pancreas

Tortoises with long necks were found to be abundant in regions that had vegetation on a higher level. A few years later, drought hit the region and the vegetation dried up. Over time, grasses were observed in the region. Shortly thereafter, an increase in short-necked tortoises was observed in the region. What does this change in the species of tortoises suggest?

Answers

Answer:

A.  

Changes in the environment give rise to evolution of species.

Explanation:

I just did this on PLATO and I got 100%

Final answer:

The change in the species of tortoises suggests natural selection, where tortoises with shorter necks became more abundant in a region with grasses after a drought.

Explanation:

This change in the species of tortoises suggests natural selection at play. In the given scenario, tortoises with long necks were more abundant in regions with higher-level vegetation. This is because their longer necks allowed them to reach and access more leaves for food. However, when a drought hit the region and the vegetation dried up, grasses started to grow. As a result, short-necked tortoises had an advantage as they could easily access the grasses. Over time, these short-necked tortoises became more prevalent in the region.

Which of the following is generally true of female bones in relationship to male bones?

They are typically larger.
They are typically longer.
They are typically smoother.
They are typically spotted.

Answers

The are actually smoother!
b becuse there female ..........hope it helps

A cross between a tetraploid and a diploid member of the same species will produce offspring that can undergo sexual reproduction. hints a cross between a tetraploid and a diploid member of the same species will produce offspring that can undergo sexual reproduction.
a. True
b. False

Answers

False

In order to happen sexual reproduction, the cells that origin gametes must have an even number of chromosomes. By crossing a tetraploid (4n) with a diploid (2n), the offspring would have a total number of 3 copies of each chromosome (2 from the tetraploid parent and 1 from the diploid parent), which when undergoing sexual reproduction would not allow meiosis to happen because the chromosomes could not be evenly divided to gamete cells.

The client newly diagnosed with type 2 diabetes mellitus eats a lot of pasta products, such as macaroni and spaghetti. the client is 40 pounds (18 kg) overweight. the client asks the nurse if pasta can be included in the diabetic diet. what is the best response by the nurse?

Answers

The statement that the nurse best response in the client who has diagnose with type 2 diabetes mellitus eats a lot of pasta products is "Pasta can be a part of your diet. It's included in the bread and cereal exchange." So the nurse may say that pasta should be part of the client diet because it includes in the bread and cereal exchange.

What is one major impact of seedless vascular plants?

Answers

By far the greatest impact of seedless vascular plants on human life, however, comes from their extinct progenitors. The tall club mosses, horsetails, and tree-like ferns that flourished in the swampy forests of the Carboniferous period gave rise to large deposits of coal throughout the world.

The vascular seedless plants are utilized as the medicinal plant and fertilizer.

Further Explanation:

The vascular plants are those plants that possess xylem and phloem for the transport of water and food respectively. Plants that have vascular system but are seedless are the members of Pteridophytes.

The characteristics of Pteridophytes:

1. They are seedless and vascular cryptogams: They reproduces through the production of spores.

2. They show alternation of generation as the sporophytic generation alternates with the gametophytic generation: Sporophyte possess true root, stem and leaves.

3. Spores are developed in the sporangia. Both type of spores are developed- homosporous and heterosporous.

4. Sex organs are multicellular and are jacketed.

Some of the example of Pteridophytes are:

1. Equisetum

2. Salvinia

3. Dicksonia

4. Selaginella

The importance of pteridophytes:

1. They are used as cattle feed

2. They are used for medicinal purpose. For example the foliage decoction of Lycopodium is utilized in homeopathy to treat certain disease such as constipation, eczema, diarrhea and inflammation of liver. Equisetumcontains various flavonoid and saponina that have diuretic effect.

3. Marsilea contains starch and are consumed by people as food in some areas.

4.  Aquatic pteridophyte such as Azollaare used as a very good biofertiliser.

Learn more:

1. Learn more about plant https://brainly.com/question/862697

2. Learn more about photosynthesis https://brainly.com/question/873199

3. Learn more about food https://brainly.com/question/1251757

Answer Details:

Grade: College Biology

Subject: Biology

Chapter: The Plant Kingdom

Keywords:

Vascular seedless, xylem, phloem, pteridophytes, sporophytic generation, gametophytic generation, Lycopodium, Marsilea, Azolla.

The nurse is used to working on the postpartum floor taking care of women who have had normal vaginal births. today, however, the nurse has been assigned to help care for women who are less than 24 hours post cesarean birth. the nurse realizes that some areas will not be assessed. what would the nurse leave out of the client assessments

Answers

The answer is perineum, usually a woman who experiences cesarean birth does not have an episiotomy though seldom this may be the case. In addition, perineum is the area among the anus and the scrotum in the male and among the anus and the vulva the labial opening to the vagina in the female. An episiotomy is a surgical process to expand the outlet of the birth canal to ease delivery of the baby and evade a sharp rip of the perineum.

Identify the medical term referring to a (head) cold:

Answers

The medical term referring to a head cold is coryza. The coryza occurs when an individual’s mucous membranes in their nasal cavity has a presence of inflammation in which will likely result into having a hay fever or causing a person to have a cold.

Final answer:

The medical term referring to a (head) cold is rhinorrhea, which is the excessive production of mucus in response to a viral infection. It is a common symptom of a cold and is often accompanied by sneezing, congestion, sore throat, and coughing.

Explanation:

The medical term referring to a (head) cold is rhinorrhea. Rhinorrhea is the medical term for a runny nose, which is a common symptom of a cold. It occurs when the nasal tissues produce excessive mucus in response to a viral infection. Other symptoms of a cold may include sneezing, congestion, sore throat, and coughing.

Learn more about Rhinorrhea here:

https://brainly.com/question/34319474

#SPJ6

The hard and brittle outer layer of the Earth is known as the _______. A. core B. lithosphere C. atmosphere D. mantle

Answers

Hi Ash, thanks for asking a question here on Brainly!

The hard and brittle outer layer of the Earth is known as the lithosphere.

Answer: Letter B 

Hope that helps! ★ If you have further questions about this question or need more help, feel free to comment below or post another question and send the link to me. -UnicornFudge aka Nadia 

If ur doing studyisland the answer is (A) lithosphere

Your patient tells you he is a jehovah's witness. what should you do to show your support for his spiritual beliefs?

Answers

Get to know your patient, learn more about it. that will show that you support his/her believes.

Final answer:

To show support for a patient who is a Jehova's Witness, it is important to understand and respect their spiritual beliefs. Ask about their specific beliefs, align medical treatments with those beliefs, and provide relevant resources and connections.

Explanation:

If your patient identifies as a Jehova's Witness, it is important to respect and support their spiritual beliefs in your role as a healthcare provider. Here are some steps you can take to show your support:

Ask your patient about their specific beliefs and practices as a Jehova's Witness. This will help you understand their unique needs and preferences.Ensure that any medical treatments or procedures align with their religious beliefs. For example, Jehova's Witnesses may refuse blood transfusions due to religious reasons, so it is important to explore alternative treatment options.Provide resources and connect your patient with a medical team that has experience working with Jehova's Witnesses. This can help ensure that their spiritual beliefs are respected throughout their healthcare journey.

We have already talked about another class of chemicals that help send signals in the body – neurotransmitters. how are neurotransmitters and hormones similar and how are they different

Answers

Hormones are the chemical messengers of the endocrine system and are transported by blood to distal target cells.Neurotransmitters are the chemical messengers found in the nervous system that specifically do the transmission across the synaptic cleft, where the space exists between two axons.They both carry messages but belong to different systems of the body.

Final answer:

Neurotransmitters and hormones serve as chemical messengers in the body, with neurotransmitters traveling short distances for precise communication between neurons, while hormones travel longer distances through the circulatory system to reach target cells. Neural messages are likened to train travel, limited to nerve tracts, while hormonal communication is akin to car travel, reaching any cell via blood flow. Neural messages are faster, whereas hormonal messages can lead to enduring changes.

Explanation:

Neurotransmitters and hormones both serve as chemical messengers in the body. Neurotransmitters are used by neurons and travel short distances to bind with receptors on postsynaptic neurons, while hormones enter the circulatory system to travel longer distances to reach target cells and bind with specific receptors.

Neural messages are like traveling on a train, limited to existing nerve tracts, while hormonal communication is compared to traveling in a car, able to reach any cell receiving blood via the circulatory system. The speed of neural messages is faster due to the short distance traveled, while hormonal messages can result in long-lasting changes throughout the body.

What is the hallmark of our species, according to evolutionary psychologists?

Answers

The hallmark of our species, according to evolutionary psychologists is OUR ENORMOUS CAPACITY AND OUR SHARED BIOLOGY ENABLED OUR DEVELOPED DIVERSITY.
Evolutionary psychology is the study of the root of behavior and mental processes using the process of natural selection and focusing on what make human beings alike. Evolutionary psychologist believed that human beings are so very much alike because they have the same biological make up and high capacity.

Which term means increasing the angle between two bones of the straightening of a limb?

Answers

extension- increasing the angle between two boned of the straightening of a limb
Other Questions
1. A video cassette recorder uses 2m of tape in 3 minutes when set on extended play. The tape is about 240 m long. How many hours can be recorded at this setting?2. You would burn about 200 calories by walking for 60 minutes. About how many calories would you burn if you walk or 15 minutes? 3. A 17 minute phone call from Boston to Chicago costs $2.38. What is the cost per minute? Which type of rock tends to have ripple marks, mud cracks, and layers (strata)?Question 1 options:Extrusive igneous rocksSedimentary RocksIntrusive igneous rocksMetamorphic Rocks Refer to Explorations in Literature for a complete version of this narrative.Which phrase from "Uses and Abuses of the Umbrella" most clearly informs the reader that the author is being sarcastic?A. "'...The umbrella is an article proper to the desk.'"B. "...the umbrella is too fine, too delicate and lovely an article for water to be allowed to ruin it."C. "...to enjoy a shower of pure water from the heavens,..."D. "...for it presumes that next to every desk there ought to be a coat rack and, hanging on the coat rack, an umbrella."Refer to Explorations in Literature for a complete version of this narrative.What effect does word choice have on the meaning of this excerpt from Benjamin Franklin's "A Witch Trial at Mount Holly"?...both Accused and Accusers being strippd (saving only to the Women their Shifts) were bound Hand and Foot, and severally placed in the Water, lengthways, from the Side of a Barge or Flat, having for Security only a Rope about the Middle of each, which was held by some in the Flat.A. The phrase "held by some" shows that the villagers cooperated together.B. The phrase "only a Rope" highlights the lack of technology in Franklin's time.C. The phrase "bound Hand and Foot" emphasizes the seriousness of the danger.D. The phrase "both Accused and Accusers being stripp'd" clarifies that the accused were unfairly treated. HIGH CHANCE OF GETTING BRAINLIEST !!!!!!Which clouds are fluffy and white in the sky? A. cumulus B. nimbus C. cumulonimbus D. cirrus Which of the following applications can be used as a data source for a Microsoft Word mail merge? A.Outlook Contacts B.Microsoft Access Databases C.Microsoft Excel Spreadsheet D.All of the above le gusta dibujar y pintar Based on Anabela's statements about herself, which items would you say she prefers? Soy simptica, extrovertida y muy graciosa. a. Going to parties. b. Reading books. complete the solution of the equation. Find the value of y when x equals -4 x + 3y = 14 The _______ is a pact that unites the united states, canada, and mexico into one of the world's largest free-trade zones. Hat does bertie mean when he calls himself a "chappie?" that he is a serious villain that he is a lousy scoundrel that he is a regular man that he is a sickly person Matt and Brad own a ice cream store and they believe they have the best ice cream in town. They invite ten of their closest friends to their ice cream shop, give them free ice cream, and then ask for their opinions. Brad and Matt encouraged their friends to try other ice cream shops, but they told them that they would have to buy the ice cream there. After a week, Matt and Brad took all the participants out to dinner and 90% of the "tasters" voted Matt and Brad's shop to be the best in town. Which of these would NOT lead to bias in this experiment?A)Matt and Brad took the participants to dinner.B)Only ten participants were used in the experiment.C)Only friends were used in the experiment, and friends will quite often be nice to each other.D)The "tasters" received free ice cream from Matt and Brad, but they had to pay for it at the other shops. What do the quilts represent to Maggie at the end of "Everyday Use"?A.Her scars from having been badly burned in the house fire B.Her triumph at being chosen over Dee to receive something C.Her sadness that she can't get along with her sister D.Her hopes for a long and happy married life with John Thomas "I claim the 5th.""I decline to testify on the basis of my Fifth Amendment right!"Id like to plead the fifth!(explains the meanings of this statement.) Which choice represents the fraction below as a single exponential expression?8^2/8^16a. 8^-12b. 8^12c. 1/4d. 8^4 What does it mean to say that two variables are negatively associated? Zappos was created and made possible by a changing business-environmental factor. this factor is Deon drove 408 miles using 16 gallons of gas. At this rate, how many miles would he drive using 11 gallons of gas? In the deli, meat and cheese are sold by the pound. There is usually a unit price in each variety in the refrigerator case. If honey ham costs $5.99 per lb, how much would 1.5 lbs cost?Enter your answer as a decimal rounded to the nearest cent. How many cell layers are found in a blastula? A. 3 B. 4 C. 1 D. 2 7. Glaciers have two types of deposition. Define them below: