The restriction enzyme saci has a recognition sequence of gagct^c, where the caret (^) indicates the cut site. examine the dna molecule below. agagctcagtcgagagctcagatcgataggagctcagatctcgatcacctc tctcgagtcagctctcgagtctagctatcctcgagtctagagctagtggag how many separate molecules of dna would you end up with if you treated the above dna molecule with saci?

Answers

Answer 1
dge78wdgqwe8fguefuqefioequf9be
Answer 2

There are total three molecules of dna would you end up with if you treated the above dna molecule with saci.

What are restriction enzymes?

A restriction enzyme, restriction endonuclease, or restrictase is an enzyme that cleaves DNA into fragments at or near specific recognition sites within molecules known as restriction sites. Restriction enzymes are one class of the broader endonuclease group of enzymes.

Moreover, a restriction enzyme is a protein isolated from bacteria that cleaves DNA sequences at sequence-specific sites, producing DNA fragments with a known sequence at each end. The use of restriction enzymes is critical to certain laboratory methods, including recombinant DNA technology and genetic engineering.

Therefore, four types of restriction enzymes are recognized, designated I, II, III, and IV, which differ primarily in structure, cleavage site, specificity, and cofactors.

Learn more about restriction enzymes:

https://brainly.com/question/14953274

#SPJ6


Related Questions

Earth is an open system with respect to _____.

(A)information

(B) matter

(C) energy

(D) people

Answers

C. Energy, hope this helped :)

Answer: (C) energy

Earth is an open system with respect to energy because the earth receives energy from the sun in the form of solar energy. This energy is absorbed by the oceans and terrestrial land. The solar energy in the form of thermal energy heat up the oceans and the terrestrial land which results in the release of thermal energy by the oceans and terrestrial lands. Some of this thermal energy is reflected back to the exterior of the earth which supports the fact that earth is an open system.

Which kind of activity is pressing your palms against a wall with full force?

Answers

The answer is isometric.

If you ate bacon and fried eggs for breakfast, the largest component of the energy would come from the

Answers

The protein from the egg.
the energy is from the eggs

Besides the ability of some cancer cells to divide uncontrollably, what else could logically result in a tumor?

Answers

Other than the ability of some cancer cells to divide uncontrollably, the lack of appropriate cell death can logically result in tumor. When there is an occurrence of lack of appropriate cell death, this can lead to inappropriate tissue growth and tumor development. This is also characterized by altered mitochondrial metabolism. When there is a centrality of the dysfunction of the mitochondria in our system, there is surprisingly a wide range of major human diseases slowly becoming recognized. This brings along with it the prospect of novel therapeutic approaches to treat a multitude of unpleasant and pervasive diseases. We can therefore say that the there is a large and vital contribution of mitochondria in the maintenance of the normal cells in the body of an individual. 

To make a new line of plants burbank used the process of

Answers

 he used hybridization

In a dihybrid cross exhibiting complete genetic linkage, what would you expect? in a dihybrid cross exhibiting complete genetic linkage, what would you expect? one parental allele combination occurring more frequently than another and no recombinant gametes only recombinant gametes one parental allele combination occurring more frequently than another two equally frequent gametes containing only parental allele combinations and no recombinant gametes

Answers

two equally frequent gametes containing only parental allele combinations and no recombinant gametes

A woman is 6 weeks pregnant. she has had a previous spontaneous abortion at 14 weeks of gestation and a pregnancy that ended at 38 weeks with the birth of a stillborn girl. what is her gravidity and parity using the gtpal system?

Answers

so she didn't get abortion then 
Final answer:

Using the GTPAL system, the woman's reproductive history would be represented as 3-1-0-1-0: 3 pregnancies in total, 1 term birth that resulted in a stillborn, 0 preterm births, 1 abortion (miscarriage), and 0 living children.

Explanation:

The system used to describe a woman's reproductive history is called the GTPAL system. The acronym stands for Gravidity, Term births, Preterm births, Abortions, and Living children. In this case, a woman who is 6 weeks pregnant, has had a previous spontaneous abortion at 14 weeks (considered a second-trimester miscarriage), and a stillbirth at 38 weeks (a Term birth, even though the child was not born alive), can be described using the GTPAL system as follows:

Gravidity (G): The total number of times the woman has been pregnant, including current pregnancy. Hence, this will be 3.Term births (T): The number of pregnancies that ended at or after 37 weeks. She has 1 term birth that unfortunately resulted in a stillborn.Preterm births (P): The number of pregnancies that ended after 20 weeks but before 37 weeks. In her case, this is 0 since she does not have any live preterm births.Abortions (A): The number of pregnancies that ended before 20 weeks. This includes both miscarriages and elective abortions. Therefore, this number is 1.Living children (L): The total number of living children. For this woman, it is 0 as she has no living offspring.

So, the GTPAL for this woman would be 3-1-0-1-0.

Not all amino acids have to be supplied by food. this is true because:
a. the liver is able to manufacture some amino acids from fatty acids.
b. the liver is able to manufacture some amino acids from others.
c. not all necessary amino acids are found in food.
d. hormones furnish the missing amino acids.

Answers

"b. the liver is able to manufacture some amino acids from others."

The liver has the capability to transform some amino acids into others (called non-essential because they can be produced by the body and there is no need to get them from food). This is done by transamination. Transamination is the process of transferring an amino group from one molecule to another without forming ammonia thanks to enzymes that are called transaminases and preform such transfer.

Final answer:

The body can synthesize non-essential amino acids but requires essential amino acids from food, thus the liver can make certain amino acids from others.

Explanation:

Not all amino acids have to be supplied by food because the human body is capable of synthesizing some amino acids from the components of other molecules; however, there are nine that it cannot synthesize, which are known as the essential amino acids. These essential amino acids must be obtained from dietary sources since the body cannot produce them. The claim that the liver is able to manufacture some amino acids from others is true, as it can produce non-essential amino acids from intermediate compounds of various metabolic pathways.

The correct answer to the student's question is: b. the liver is able to manufacture some amino acids from others.

What therapeutic nursing intervention may redirect a hyperactive, manic client?

Answers

The answer to this question would be: Encouraging the client to tear pictures out of magazines for a scrapbook

Manic patient has a high amount of energy. Doing physical activity can help to reduce that energy. Make them focus on doing something that is not dangerous would be ideal. Tearing picture would need energy and help the manic patient to focus on something. Writing is a good option too but the manic patient won't writes a short one.

The production of genetically identical cells, organisms, or dna molecules is known as _________.

Answers

Cloning is the process of producing genetically identical copies of cells, organisms, or DNA. Cellular cloning occurs naturally in unicellular organisms, while reproductive cloning is an artificial process used to clone multicellular organisms. Molecular cloning involves copying short DNA sequences.

The production of genetically identical cells, organisms, or DNA molecules is known as cloning. In biology, this process can occur naturally among unicellular organisms, like bacteria and yeast, through cellular cloning when they replicate asexually by binary fission. During this replication, the nuclear DNA duplicates through mitosis, resulting in an exact replica of the genetic material. However, multicellular organisms typically reproduce sexually and do not naturally produce genetically identical copies, which is where reproductive cloning comes into play. Advances in biotechnology have enabled the artificial induction of asexual reproduction in the laboratory, thus creating clones of multicellular organisms, as seen with the famous sheep named Dolly, who was the first large mammal to be successfully cloned. Besides, scientists perform molecular cloning to copy short stretches of DNA, which is foundational in genetic research and biotechnology.

Which organism would be classified as an echinoderm?

Answers

The phylum Echinodermata contains organisms that share a specific set of characteristics, including spiny or bumpy skin. There are five different classes of animals in the phylum: starfish, brittle stars, echinoids (which include the sea urchins and sand dollars), sea cucumbers, and sea lilies.

So starfish, brittle stars, echinoids, sea urchins crinoids, sew cucumbers

sea star      is the answer

What would happen if we didn't have photosynthesis and cellular respiration?

Answers

1)Without photosynthesis: If we didn't have plants, algae and bacteria  to do the photosynthesis, CO2, a air pollutant wouldn't be converted in to glucose for those organisms and there would be no more Oxygen released to the atmosphere. Less photosynthesis  means less oxygen production and many organisms, like us, would die.
2)Without cellular respiration: Without this process we couldn't convert our food into the energy, ATP, necessary for the cells to function properly. Plus, this process also forms water, and without it, it would be another reason for the death of the cells.
Ultimately, will cause the death of the aerobic organism.

Most normal cells in an adult organism are in which phase of the cell cycle?

Answers

cellular production or respiration

Most adult cells are in the interphase of the cell cycle, where they grow and perform normal functions. Interphase consists of G1, S, and G2 phases, with the majority of time spent in this stage over the mitotic phase.

Most normal cells in an adult organism are in the interphase of the cell cycle. During interphase, cells grow and perform their normal functions, such as creating proteins and organelles. Interphase includes three subphases: G1 phase (first gap), S phase (synthesis), where the DNA is replicated, and G2 phase (second gap), where the cell prepares for division. The other stage of the cell cycle is the mitotic phase, which includes mitosis and cytokinesis, where the cell divides to form daughter cells. However, most adult cells reside in interphase unless prompted to divide.

The majority of the sun's energy comes from:

Answers

Answer:Nucleur Fusion

Explanation:

Anaerobic metabolism: requires oxygen does not require oxygen requires carbon dioxide

Answers

Anaerobic metabolism requires oxygen

The part of a neuron that carries nerve impulses toward the cell body is called _____.

Answers

it is called the axon

The difference between leaves A and B is closest to




Answers

b. 20 centimeters difference

Which of the following is NOT one of Earth's four spheres?


1)
Mesosphere


2)
Hydrosphere


3)
Atmosphere


4)
Biosphere

Answers

the four earth spheres are atmosphere lithosphere hydrosphere and biosphere ...... therefore  mesosphere is NOT part of it

The correct option would be the Mesosphere.

The earth has 4 systems, otherwise known as spheres. These include:

The atmosphere: the portion of the earth containing air.The hydrosphere: the portion that contains water.The biosphere: the portion that contains living organisms.The lithosphere: the rocky, otherwise known as the outer portion of the earth

Hence, the only option that is not part of the four spheres of the earth is the Mesosphere.

More on the earth's sphere here: https://brainly.com/question/24215268

Mitosis is characterized by four stages. select the list of stages in the correct chronological order.

Answers

Prophase, Metaphase, Anaphase, and Telophase

Which is the first step in the critical thinking plan?

Answers


The first step to plan a quinceanera is create your guest list. This will help you decide how many invitations, party favors, thank you cards, etc.

Final answer:

The first step in the critical thinking plan is to identify and clearly state the problem or issue, as it sets the foundation for all further analysis and supports critical engagement with the subject matter.

Explanation:

The first step in the critical thinking plan involves identifying and clearly stating the problem or issue at hand. This is crucial as it lays the foundation for all subsequent analysis and conclusions. By asking and answering key questions, we begin to challenge our assumptions and set the stage for an organized method of analysis. This step is essential for uncovering the vital issues, which become the cornerstone for formulating positions and contentions on the claim under discussion. According to the AAC&U's critical thinking rubric, critical thinkers must "clearly state and comprehensively describe the issue or problem", "independently interpret and evaluate sources", and "thoroughly analyze assumptions" behind the ideas encountered. This approach not only aids in solving problems but also in drawing informed conclusions.

Our sensory organs, such as our eyes and ears, contain many sensory receptors. these sensory receptors are part of the ___________.

Answers

Our sensory organs, such as our eyes and ears, contain many sensory receptors. These sensory receptors are of the peripheral nervous system.
I hope this helps.

Explanation:

The answer is ORGANS

Oxygen unloading occurs at the _________________________ This process causes a(n) _________________ in the oxygen partial pressure of the blood leaving this region.

Answers

The answer to this question would be: tissues; decrease

Oxygen is delivered to the tissue by the heart. It will be unloaded in the tissue, causing the oxygen level in the blood to be decreased. After that, the blood also picks up the carbon dioxide so its level will be increased. 
In lungs, the carbon dioxide will be unloaded and oxygen will be loaded back into the blood.

Oxygen unloading occurs at the tissues. This process causes a decrease in the oxygen partial pressure of the blood leaving this region.

In tissues, where oxygen is needed for cellular respiration, oxygen unloading occurs from hemoglobin molecules in red blood cells. As oxygen is delivered to the tissues, the partial pressure of oxygen in the blood decreases.

This decrease in oxygen partial pressure facilitates the release of oxygen from hemoglobin, allowing it to diffuse into the surrounding cells for cellular respiration. Therefore, oxygen unloading at the tissues results in a decrease in the oxygen partial pressure of the blood leaving this region.

Which of the following helps plant cells remain rigid?

A. Cell membrane
B. Nucleous
C. Capsule
D. Central Vacuole

Answers

Central vacuole is your answer hope it helps :) 

The Central Vacuole, because it  functions to maintain the proper pressure within the plant cells to provide structure and support for the growing plant.

This membrane allows blank to pass through, but not soluble particles or molecules?

Answers

The membrane allows proteins to pass through

While primary production refers to the synthesis of plant material, secondary productivity refers to the synthesis of _____.

Answers

ecosystems , is your answer if I'm not wrong 

Answer:

The given blank can be filled with animal tissue.

Explanation:

Secondary productivity refers to the fixation of energy by the heterotrophic species or the frequency of biomass formation. These obtain all their vitality from photosynthetic plants or via other autotrophs, either indirectly or directly, and their productivity tells about the sizes of the food chains and the number of trophic levels within an ecosystem. Thus, secondary productivity can be considered as the synthesis of animal tissues.

Myosin is a motor protein involved in animal cell cytokinesis. It binds to ATP or ADP, causing the myosin to move with respect to actin. What is the effect of the interaction between myosin and actin?

Answers

The interaction between myosin and actin MAKE THE FURROW TO BE DEEPENED. 
Cytokinesis is the last stage of cell division in living cells. During cytokinesis, the cytoplasm split into two and the cell divides. In animal cells, the plasma membrane of the parent cell pinches inward by the help of the micro filament, which is make up of actin and myosin until two daughter cells are formed.

How will the movement of water affect a cell if it is transferred from a hypotonic solution to a hypertonic solution

Answers

Answer:

When the cell is in a hypotonic environment, it is swollen because there is a movement of water from the middle into the cell. When it is transferred to a hypertonic environment there is a movement of water out of the cell which causes the cell to become dehydrated and for this reason it contracts.

What is the major monosaccharide found in the body?

Answers

The answer for this is Glucose
Final answer:

The major monosaccharide in the human body is glucose, which serves as the primary source of energy for cells and is crucial in the production of ATP.

Explanation:

The major monosaccharide found in the human body is glucose. Monosaccharides are the simplest form of carbohydrates, and glucose is the primary source of energy for the body's cells. It is carried through the bloodstream and is used by cells to perform their functions. The liver and muscles store excess glucose in the form of glycogen, which can be converted back to glucose when needed. Glucose is also a crucial component in the production of ATP, the molecule that serves as the main energy event in the human body.

Learn more about Monosaccharide here:

https://brainly.com/question/33307338

#SPJ6

Which law of physical science must be followed when balancing chemical equations?

Answers

The law of physical science that must be followed when balancing chemical equations is that for every action, there is an equal and opposite reaction. When you make changes to a chemical compound, there will be an equal and opposite reaction to those changes.

All of the organs in the organ system have which of these in common? A) They all have the same exact function. B) Humans could not survive without them. C) Each of the organs is made from individual cells. D) All of the organs make up the respiratory system.

Answers

C.) Each of the organs is made from individual cells.

All of the organs have different functions.... very different.

Humans can survive without some of our organs, such as a kidney, gall bladder, etc.

And only a certain number of organs can make up the respiratory system.

the answer is C)  Each of the organs is made from individual cells.

Other Questions
Help ASAP!!!?? read this from "Love after Love""Give wine. Give bread. Give back your heart to itself, to the stranger who has loved you"How wuld you describes the speaker's toneA)AuthoritativeB)CalmingC)EncouragingD)Pleadingi don't think it's A Manny is disillusioned. he originally got into education to help students learn but he finds that he spends much of his time focusing on order and control. he is beginning to think that __________. What is the typical path a bill proceeds through the senate? Evaluate 4(6) + 7 (5 - 3 ) A: 118B: 80C: 10D: 38 The power was off last night, and the yeast cultures in your incubator cooled down from 25 degrees to 20 degrees centigrade in temperature. to your great relief, you find that the yeast cells did not die. however, when you analyze the composition of the lipids in the plasma membrane of your yeast cells, you discover How effectively do you think president kennedy handled the cuban missile crisis? How did the outcome of the presidential election of 1876 lead to the compromise of 1877? At the turn of the twentieth century, a sweatshop was a small work room in a large factory. a small factory with safe working conditions. a small factory with unsafe working conditions. a small apartment where several families worked. Briefly describe the cellular events responsible for the refractory period (hint: discuss the mechanism of repolarization). Use a transformation to solve the equation. f 8 = 40 a f=5 b f=32 c f=48 df=320 An integer x is divided by an integer y, and quotient is 24.the sum of these two integers is 75. what is the value of x? How would a sociologist view guerrilla warfare? Having a physical health issues does not affect a persons social health.True or false Nadia was getting harassed at work by companies to whom she owed money. what act protects her from this? equal credit opportunity act the truth in lending act the fair debt collection practices act the fdic deposit regulations act Imagine your a part of inc which group would you join? Moderates or radicals? Give reasons Given right triangle JKM, which correctly describes the locations of the sides in relation to J? a is the hypotenuse, b is adjacent, c is opposite a is the hypotenuse, b is opposite, c is adjacent a is adjacent, b is opposite, c is the hypotenuse a is opposite, b is the hypotenuse, c is adjacent The statement below describes a situation in which opposite quantities combine to make 0. Is the statement true or false? A plane takes off, circles the airport, then lands at the same airport Long Beach California has an elevation of -7 ft New Orleans Louisiana is 8 feet below sea level which city has lower elevation what economic measurement helps to define when business cycles begin and end Maurice is a child who lives with a single parent. in 1960, less than ___ percent of children under the age of 18 lived in single parent homes.