Answer:
Warm water holds less oxygen
Explanation:
Thermal pollution may be defined as the cahnge in the ambient water temperature that can degrade the water quality. Main cause of thermal pollution is the use of water as coolant in industries.
Thermal pollution is harmful for aquatic life. Fish and other aquatic organismsm dies because thermal pollution increases the temperature of water. This warm water has less ability to hold oxygen and fishes die due to the lack of oxygen in water.
Thus, the correct answer is option 4.
Population growth how is population growth naturally regulated answer key
The natural regulation of population growth can occur through a variety of factors that are intrinsic to the ecosystem and the species themselves. These factors can be categorized into two main types: density-dependent factors and density-independent factors.
Density-Dependent Factors:
1. Competition for Resources: As the population size increases, the availability of resources such as food, water, and space becomes limited. This leads to increased competition among individuals, which can result in decreased birth rates and increased death rates due to starvation, stress, and disease.
2. Predation: Predators tend to eat more from abundant prey populations, which can help control the growth of these populations. As the prey population grows, the number of predators may also increase, further regulating the prey population.
3. Disease: Diseases can spread more rapidly in dense populations. High population density facilitates the transmission of pathogens, which can lead to increased mortality rates.
4. Parasitism: Similar to predation, parasites can have a significant impact on host populations. Higher host densities can lead to higher parasite loads, which can reduce host survival and reproductive success.
5. Territoriality and Intraspecific Competition: Many animals defend territories that provide the necessary resources for survival and reproduction. As populations grow, the size of these territories may shrink, leading to reduced reproductive success and increased mortality due to aggression and stress.
Density-Independent Factors:
1. Weather and Climate: Extreme weather events such as droughts, floods, storms, and temperature extremes can affect populations regardless of their density. These events can cause widespread mortality that is not related to the size of the population.
2. Natural Disasters: Earthquakes, volcanic eruptions, and fires can destroy habitats and cause mass mortality, impacting population sizes independently of population density.
3. Human Activities: Human-induced changes to the environment, such as pollution, habitat destruction, and the introduction of invasive species, can also regulate population growth. These factors can have catastrophic effects on populations, often independent of population density.
Carrying Capacity:
The carrying capacity of an environment is the maximum population size that the environment can sustainably support. When a population reaches or exceeds the carrying capacity, the limiting factors mentioned above become more pronounced, and the population growth is naturally regulated to bring it back to a sustainable level.
In summary, population growth is naturally regulated by a combination of density-dependent and density-independent factors. These regulatory mechanisms ensure that populations do not exceed the carrying capacity of their environment for extended periods, thus maintaining ecological balance.
Which of the biomolecules below includes a polydentate ligand called a porphyrin? hemoglobin chlorophyll cytochrome c carbonic anhydrase?
The biomolecule from the given option that includes a polydentate ligand named Porphyrin is called Hemoglobin.
What is Porphyrin?A porphyrin is a molecule with large rings made up of four pyrroles, which are smaller rings composed of four carbons and one nitrogen. These pyrrole molecules are linked together by a sequence of single-double bonds, forming a large ring known as tetrapyrrole.
Porphyrins are responsible for the red hue color of blood in mammals. These porphyrin molecules are used in the formation of -heme groups in mammals.
The nitrogen molecules in the ring's core have the ability to house an iron molecule that is responsible for the red color of blood called Hemoglobin.
Learn more about porphyrin here:
https://brainly.com/question/16522092
Choose all the answers that apply. Which of the following organelles are found in plant cells but not in animal cells?
(1) cell membrane
(2) cell wall
(3) chloroplasts
(4)vacuole
(5)nucleus
The organelles are found in plant cells but not in animal cells are cell wall and chloroplast. Thus, option B and C are correct.
What is the difference between plant cell and animal cell?
The main difference between plant cell and animal cell is that plant cell contain cell wall and chloroplast and animal cell does not contain cell wall as well as chloroplast. Plant cell contain chlorophyll that provide green color to the plants.The main function of the cell membrane has to keep away the toxic material out of the cell.
Cell membrane has been defined as a wall that differentiate and protect the inner structure of the cell from the outer environment. The main function of the cell membrane has to keep away the toxic material out of the cell. The cell membrane contain channels as well as the receptors that gives the permission to only selective permeable membrane to enter into the cell.
Therefore, The organelles are found in plant cells but not in animal cells are cell wall and chloroplast. Thus, option B and C are correct.
Learn more about plant cell and animal cell here:
https://brainly.com/question/1493437
#SPJ6
In _____, an energized molecule directly adds a phosphate group to adp, but _____ uses a concentration gradient of protons as the energy source required to phosphorylate adp.
Answer:
phosphorylation; ATP
Explanation:
Phosphorylation is the name of one of the processes that occur in mitochondria during cellular respiration. With phosphorylation, cells gain a reservoir of energy for metabolic activities. In this process electron transfer from electronic donors to electronic acceptors occurs. This transfer is the redox reactions that enable the process of energy release, biologically usable for ATP biosynthesis.
In this case, an energized molecule would add a phosphate group to the ADP for ATP formation. However, ATP would use a proton gradient as the energy source needed to phosphorylate ADP.
Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3')? view available hint(s) where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3')? it would not bind the target dna. ttttagccatttacgattaatcg ttttagccatttacgattaatcg ttttagccatttacgattaatcg?
It would bind to the part that has a complementary sequence. Since A pairs with T and C pairs with G then it would bind to ttagc sequence on the DNA strand. The two DNA pieces would also align in anti-parallel alignment.
_______ iron is found in some foods that provide all the amino acids humans require in their diet. heme flat nonheme raw
The right option is Heme Iron
Heme iron is a form of iron found
in some foods that provide all the amino acids humans require in their diet. Heme
iron is present in animal foods such as red meats, fish and poultry and it is
readily absorbed and not well regulated by the body as the body has no way to remove excess iron.
Answer:
Heme Iron
Explanation:
Iron from the diet of humans is absorbed through the intestinal mucosa cells, mainly in the duodenum, and is transported in the bloodstream and extracellular fluid bound to a plasma protein called transferrin. Two types of iron are provided by the diet: heme iron and non-heme iron. Heme iron is present in animal foods, such as beef, chicken and fish, and non-heme iron, in addition to being offered by red meat, is also found in cereals and other vegetables.
Heme iron is soluble in small bowel conditions and is easily absorbed into the intestinal mucosa without the interference of chemical and / or dietary factors. For this reason, it is highly absorbed: about 15% of the heme iron ingested by the normal individual and 35% in the one with low iron stores. Heme iron is found in some foods that provide all the amino acids humans need in their diet.
What is one of the most effective ways to stop invasive animal species from entering the Great Lakes ecosystem?
Answer:
The correct answer is - cleaning ballast water.
Explanation:
In the great lakes, 65% of the invasive species come from the ships that carry ballast water tanks to stabilize them on the long route journeys, this release invasive species when loading and unloading cargo.
Cleaning up these ballast water is one of the most effective ways to stop the new invasive to enter the Great Lakes.
The primary cause of recent global warming is believed to be ________.
Which characteristic do euglenoids and algae share
Answer: The answer is B. please mark me as brainliest
Explanation: I took the test
Mrs. j. is a 63-year-old woman who has a history of hypertension, chronic heart failure, and sleep apnea. she has been smoking two packs of cigarettes a day for 40 years and has refused to quit. three days ago, she had an onset of flu with fever, pharyngitis, and malaise. she has not taken her antihypertensive medications or her medications to control her heart failure for 4 days. today, she has been admitted to the hospital icu with acute decompensated heart failure.
This mutation results from the insertion of two nucleotides into the original sequence which causes the reading frame of the sequence to change this kind of mutation is known as
Answer:
Frameshift mutation
Explanation:
There are many different types of mutations in genetics, one such mutation is known as a frameshift mutation.
Codons are sequences of three nucleotides that determine the amino acid it codes for, and when something changes with these sequences, then we have a mutation.
In a frameshift mutation, nucleotides are added or deleted in such a way that the reading frame changes. For example:
If we have the nucleotide sequence- AUG UGC ACG UAC UUG CAG...
We can see that the reading frame reads three nucleotides per amino acid, however if an extra two nucleotides are added in a random location, then there is a shift- AUG UGC AUA CGU ACU UGC AG... (the underlined indicate the added nucleotides).
Now every amino acid after the frameshift mutation would be incorrectly coded for.
Which of the following statements regarding nonspecific immune responses is correct? A. A nonspecific immune response is the body's first line of defense against invaders. B. The influenza vaccine provides immunity by triggering nonspecific immune responses. C. Nonspecific immune responses involve the use of B and T lymphocytes. D. all of these
The correct answer is option A.
The immune system safeguards the body against the probable harmful materials by reacting and determining the antigens. Antigens are the components situated on the surface of viruses, cells, bacteria, or fungi. The immune system destructs and determines, or attempts to destroy the components, which comprise antigens.
Nonspecific or innate immunity is the defense system with which an individual is born. It safeguards the person against all the antigens. Innate immunity includes barriers, which keep the harmful substances from getting inside the body. These barriers make the first line of defense in the immune reaction.
Explain how an incubator helps with this cloning experiment.
On a hot, dry day, plants close their stomata to conserve water. what impact does this have on photosynthesis?
When plants close their stomata to conserve water on hot, dry days, the rate of photosynthesis is inhibited due to lower carbon dioxide intake, which is necessary for the Calvin cycle, and an increased internal oxygen concentration that can lead to photorespiration, reducing photosynthesis efficiency.
On a hot, dry day, plants close their stomata to conserve water, which can have a significant impact on photosynthesis. The closing of stomata reduces the uptake of carbon dioxide (CO2), which is a crucial component for the photosynthetic process. This leads to a decrease in the rate of photosynthesis because the reduced CO2 levels directly affect the Calvin cycle where CO2 is fixed and converted to sugars. Additionally, the closing of stomata to conserve water also prevents the escape of oxygen (O2), which results in an increase in internal O2 concentration, potentially leading to photorespiration, a process that competes with photosynthesis and decreases its efficiency.
during _____, the cell uses information from messenger RNA to produce proteins
Answer: Translation.
Explanation: Translation is a step in the protein synthesis where the genetic information is carried from the DNA in the form of series of three base code words.
Each code represents a particular amino acid. During this step only the coding is decoded to produce the specific sequence of the amino acids in the polypeptide chain.
I need help on what to color!!!
Enzymes
A) are composed of long chains of fatty acids
B) can be destroyed by variations in temperature or pH
C) are used up, in the process of performing a chemical reaction
D) raise the amount of energy required to start a chemical reaction
Enzymes are not destroyed by temperature or pH variations; they can be denatured, making them inactive. These proteins act as catalysts, lowering the activation energy of reactions without being consumed in the process.
Explanation:The correct answer to which of the following is not true about enzymes is option B) can be destroyed by variations in temperature or pH. Enzymes are not destroyed; they can be denatured or lose their functional shape due to extreme temperatures or pH levels. The denaturation renders them less effective or inactive, but it is a physical change, not a destruction. Enzymes are usually proteins made up of amino acid chains and serve as biocatalysts that accelerate biochemical reactions by specifically lowering the activation energy required for a reaction to proceed. Enzymes are not consumed in the reactions they catalyze; instead, they remain unchanged by the reaction and can be used repeatedly. Lastly, enzymes do not raise the energy requirement for a chemical reaction; instead, they lower it, thus enhancing the reaction rate without being used up.
When sedimentary rock is undisturbed , what is the relationship of the top layer and bottom layer
Answer:
The Top Layer Is Older Than The Botton Layer
Explanation:
You can say im a Nerd ;)
The fluid mosaic model describes the___.
A.organization of organelles in cytoplasm
B.cell membrane
C.movement of carbohydrates in and out of the cell
D.extracellular matrix
Answer:
The correct answer is B.cell membrane
Explanation:
The fluid mosaic model describes the mosaic nature of the cell membrane. Fluid mosaic modal signifies that the plasma membrane is made up of lipid bilayer which is not fully rigid and gives fluidity to its membrane.
Due to this fluidity, components of the plasma membrane, like various plasma membrane proteins move freely in the membranes. This elasticity of the plasma membrane allows some proteins to do flip-flop movement.
These movements of plasma membrane components play important role in the cell signaling and transport of molecules across the cell. Therefore the correct answer is B.cell membrane.
Within any large animal population, there is _______ a variety of traits. And between different animal populations, there is _______ a variety of traits.
A. always; always
B. never; always
C. never; sometimes
D. sometimes; sometimes
Its not option D yall he lying, its always; always
an air mass that originates in the pacific ocean west of brazil is most likely what
Answer:
Warm and wet
Explanation:
Air masses are large portions of air that have relatively homogeneous internal temperature, pressure and humidity conditions, influenced by the region where they are formed. The place of formation of the air mass is called the region of origin, this is where the air mass will acquire its characteristics of temperature, pressure and humidity. Therefore, an air mass originating from western Brazil, will have common characteristics of a tropical region, that is, this air mass will be wet and have a high temperature.
For this reason, we can guarantee that an air mass that originates in the Pacific Ocean west of Brazil is likely to be warm and wet.
Final answer:
An air mass originating in the Pacific Ocean, west of Brazil, would be classified as maritime tropical (mT), implying that it is A. warm and wet.
Explanation:
An air mass that originates in the Pacific Ocean, west of Brazil, is most likely warm and wet. Air masses are classified based on temperature and moisture. Since the Pacific Ocean is a large body of water, an air mass originating there would pick up moisture, making it "maritime" (m) or wet. The geographic location near the equator indicates that the air mass would be "tropical" (T), and thus warm. The combination of maritime and tropical characteristics leads us to classify the air mass as maritime tropical (mT), which is warm and moist.
kidneys couldn't work without the
because
How do scientists use the Doppler effect to measure the actual motion of stars?
The Doppler effect helps scientists determine a star's radial velocity and rotational speed by analyzing spectral lines for shifts. Redshifts indicate a star moving away, blueshifts indicate an approach, and line broadening suggests rotation.
Scientists use the Doppler effect to measure the actual motion of stars in several ways. They can measure a star's radial velocity, the speed at which it moves toward or away from us, by observing the Doppler shifts in the star's spectrum. When the star moves away from Earth, the spectral lines show a redshift; when it approaches, they exhibit a blueshift. This shift in the wavelength of light can be used to determine the speed of the star relative to the observer.
The Doppler effect can also reveal if a star is rotating by observing the widening of spectral lines, a phenomenon known as line broadening. Light from the edge of the star rotating toward us shifts toward shorter wavelengths (blueshift), while light from the receding edge shifts to longer wavelengths (redshift). Consequently, the spectral lines we observe from the star are broader than those from a non-rotating star, and the amount of broadening can indicate the star's rotational speed.
Additionally, high-resolution spectroscopy allows astronomers to detect subtle variations in a star's radial velocity caused by the gravitational pull of an orbiting planet, leading to planet detection. These minuscule changes do not depend on the star's distance, as long as high-quality spectra can be obtained by large telescopes.
The oceanic zone is _____. mostly photic mostly aphotic mostly benthic
The oceanic zone is mostly aphotic.
Photic zone is the part of the ocean where the light penetrates the depth and gets scattered in the water. This zone makes up a small part of the ocean ecosystem as light penetrates only for a few meters of depth. After this depth the aphotic zone begins where there is absence of light.
Benthic zone is the floor of the ocean where the shelled and aphotic deep sea animals live.
The oceanic zone here is mostly aphotic, lacking sufficient light for photosynthesis.
The oceanic zone is mostly aphotic, meaning it lacks sufficient light for photosynthesis.
Within the ocean, the photic zone is the portion where light can penetrate, and it extends to a depth of approximately 200 meters.
At depths greater than 200 meters, light cannot penetrate, and this is referred to as the aphotic zone.
The majority of the ocean is aphotic and mostly devoid of light.
Learn more about oceanic zone here:
https://brainly.com/question/4409167
#SPJ6
Match these cell cycle checkpoints to their role in genome integrity is the dna replicated with out damage?
The cell cycle is regulated by checkpoints (G₁, G₂, and M) that ensure genome integrity by assessing DNA integrity, chromosomal replication, and proper attachment of the kinetochores to spindle fibers, respectively.
Explanation:The cell cycle events are regulated at key points known as checkpoints. These checkpoints help maintain the genome integrity by ensuring that all the necessary actions have taken place correctly before the cell moves to the next phase.
First, the G₁ checkpoint is where the integrity of the DNA is assessed. If any damage to the DNA is detected, the cell cycle is halted until repairs are made. This is to prevent the replication of defective DNA.
The G₂ checkpoint is the phase where cell size and protein reserves are evaluated, and importantly it ensures all the chromosomes have been replicated without damage. If any irregularities are spotted, the cell cycle stops to either complete correct replication or repair the damaged DNA.
Lastly, the M checkpoint or the mitotic checkpoint works during the mitosis phase. Here, proper attachment of each kinetochore to a spindle fiber is assessed. The cell cycle will not proceed until all sister chromatids are correctly attached to the spindle fibers.
Learn more about Cell Cycle Checkpoints here:https://brainly.com/question/29639561
#SPJ3
Do you think building eco friendly homes that reduce greenhouse gas emissions could have positive effects on biodiversity? Explain your reasoning.
Eco friendly homes help to reduce the depletion of resources and a consequent loss of biodiversity due to scarcity of resources.
What is biodiversity?The term biodiversity has to do with the very many species of organisms that exists in the ecosystem.
The idea of ecofriendly homes aims to reduce the concentration of the greenhouse gases thereby stopping the sharp rise in the temperature of the surroundings.
This process would help to reduce the depletion of resources and a consequent loss of biodiversity due to scarcity of resources.
Learn more about biodiversity:https://brainly.com/question/13073382
#SPJ2
What cardiovascular disease creates a large number of abnormal white blood cells?
What type of manufacturing is most responsible for TCE releases?
How do mycorrhizal fungi benefit plants?
Mycorrhizal fungi benefit plants in several ways: Nutrient absorption, Water Uptake, Soil Structure, Protection against Pathogens etc.
1. Nutrient Absorption: Mycorrhizal fungi form a symbiotic relationship with plant roots, greatly increasing the surface area for nutrient and water absorption. The fungal hyphae can access nutrients such as phosphorus, nitrogen, and micronutrients that are otherwise less available to plants due to limited mobility in the soil.
2. Water Uptake: The extensive network of fungal hyphae can absorb water from a larger volume of soil, which is particularly beneficial during periods of drought. This helps to improve the plant's drought resistance.
3. Soil Structure: The hyphae of mycorrhizal fungi can help to stabilize soil structure, which improves soil aggregation and porosity. This leads to better aeration and water retention in the soil.
4. Protection Against Pathogens: Mycorrhizal fungi can protect plant roots from pathogens by competing with them for space and nutrients, and by producing compounds that inhibit the growth of pathogenic microorganisms.
5. Stress Tolerance: Plants with mycorrhizal associations often show increased tolerance to various environmental stresses, including salinity, heavy metal toxicity, and extreme temperatures.
6. Enhanced Growth: By improving nutrient and water uptake, mycorrhizal fungi can enhance plant growth and vigor, leading to increased biomass production and crop yields.
7. Ecosystem Diversity: Mycorrhizal fungi contribute to the diversity of plant communities by facilitating the establishment of certain plant species, which in turn supports a greater diversity of above-ground organisms.
8. Carbon Sequestration: The symbiotic relationship between mycorrhizal fungi and plants can lead to increased carbon sequestration in the soil, as the fungi receive carbon compounds from the plant and store some of it in the soil.
9. Nutrient Cycling: Mycorrhizal fungi play a crucial role in nutrient cycling within ecosystems by facilitating the decomposition of organic matter and the transfer of nutrients from the soil to the plant.
In summary, mycorrhizal fungi are essential for plant health and soil fertility, and they play a key role in sustainable agriculture and ecosystem functioning.
In which of the following processes does mitosis play a vital role?
1. the production of gametes for sexual reproduction
2. the production of new body cells to replace old cells
3 the production of additional embryonic cells following fertilization
Answer: 2. the production of new body cells to replace old cells
Mitosis is a form of cell division that results in two daughter cells that are identical (genetically) to each other and to its original cell. It plays a vital role in the life cycle of most living things.
In single-celled (unicellular) organisms such as bacteria, mitosis is a type of asexual reproduction, making identical copies of a single cell.
In multicellular organisms, mitosis produces new cells to replace old cells and promote growth and repair.
Answer:
The production of new body cells to replace old cells;
The production of additional embryonic cells following fertilization.