two human activities that could contribute to the introduction of invasive species.

Answers

Answer 1

Answer:

Invasive species or alien species is the term referred to the organisms which are introduced in an ecosystem due to man made or any environmental activity. Humans play primary role in the introduction of invasive species in a certain ecosystem.

Explanation:

These activities may include the ships and boats flowing in aquatic regions of the world that carry novel aquatic organisms in their ballast water and propellers respectively. The small insects present into their shipping pallets and wooden parts are carried from one place to another place where they cause threat for the availability of food and nutrients to the already existing populations.

Another human activity that can contribute to the introduction of invasive species is the enhanced fuel consumption which leads to environmental pollution around the globe. This environmental pollution gets so immense in some areas that it can make the survival of existing species difficult and thus they move to new location for their survival.

Therefore, it can be seen that human activities have potential role in the spread and introduction of invasive species.

Hope it helps!


Related Questions

Which statement compares what happens in metaphase and anaphase?

Answers

Answer:In metaphase (a), the microtubules of the spindle (white) have attached and the chromosomes have lined up on the metaphase plate. During anaphase (b), the sister chromatids are pulled apart and move toward opposite poles of the cell.

Explanation:

Answer:

b

Explanation:

4 Points
Which is a cause of natural selection?
O
A. Limited food
O
B. Stable weather
O
C. Unlimited shelter
O
D. Lack of predators

Answers

The cause of natural selection would most likely be limited food which causes competition
It’s limited food hope it helps

How does drug effect the behavior of chromosomes during mitosis

Answers

This all depends on the drug for example lets say you are taking drugs that will slow down your nervous system there is a possibility that your cell production will slow down to. Lets say you take drugs that speed up everything the chances of you getting cancer is more likely, due to the overgrowth of cells.

I hope this helped

A scientist makes an image of all of a person's chromosomes. What
technique is she using?
O
A. Use of restriction enzymes
B. Polymerase chain reaction (PCR)
O
O
C. Karyotyping
O
D. Gel electrophoresis

Answers

Answer:

She is using Karyotyping

Explanation:

A karyotype is the number and visual appearance of the chromosomes in the cell nuclei of an organism or species.

In order to make an image of all of a person's chromosomes, the scientist uses Karyotyping.

What are chromosomes?

Chromosomes are found in the nucleus of a cell. These chromosomes contain the units of inheritance called genes. The sequence of genes determines the characteristics of organisms.

Now, in order to make an image of all of a person's chromosomes, the scientist uses Karyotyping.

Learn more about chromosomes: https://brainly.com/question/1596925

#SPJ2

Describe why biodiversity increased with the introduction of sea otters in California over the last fifty years

Answers

Answer:

Due to increment in food chains.

Explanation:

Biodiversity is actually the measure of changes in the ecosystem, genetic levels and various species levels. The sea otters introduced in California over last fifty years, increased the diversity in the ecosystem as well as in species too, thus changing the biodiversity. This was the impact of increase in food web in that particular area, the number of consumers, producers and prey increased thus increasing the biodiversity.

PLZ!!!! HURRY!!!!!

30 POINTS!!!!!!!!!!!!!!!!!!!!!!!!

Which of the following statements does not refer to how psychotherapy is helpful to an individual who seeks treatment? A. It teaches the patient new ways to deal with difficult situations or stress. B. It can be used to help people discover new ways to overcome difficulties. C. It can be comforting just to have someone to vent to. D. It allows therapists to use several techniques in treatment.

Answers

Answer:

allows therapists to use several techniques in treatment. - D.

Answer:

D, now your almost 1/5th of a century (20), if the only thing your good at is fortnite you probably want to start doing something with your sorry life...

*cough*

Explanation:

Which of these foods contain the most of Vitamin C and Fiber


A: Oats

B: Bananas

C: Pomegranates

D: Rice

Answers

Answer: B: Bananas

Explanation:

Bananas are the fruits which is most commonly found in many regions of the world. These are rich source of potassium, fiber, vitamin C, vitamin B6,  manganese, protein, folate, riboflavin, niacin, and iron.

The bananas are useful for treatment of cancer, high blood pressure, cancer, diabetes, digestive problems and cardiovascular disease.

Vitamins are organic compounds that are essential for body growth and development.

Vitamins are obtained from vegetables and fruit. There are different types of vitamins present, Some of them are fat-soluble and some others are water-soluble.

Fat-soluble vitamins are as follows:-

Vitamin AVitamin EVitaminDVitamin K

Vitamin C is also known as ascorbic acid and can help in the development of body repair.

Each fruit and vegetable have vitamins in them. According to the question, Bananas and pomegranates have more vitamin C.

For more information, refer to the link:-

https://brainly.com/question/2084893

what minimum internal temperature must the salmon reach cooking

Answers

Answer:

145 degrees

Explanation:

Because the united states food and drug administration recommends cooking salmon to an internal temperature of 145 degrees Fahrenheit. Push the tip of the meat thermometer gently into the middle of the salmon fillet at its thickest part.

Salmon should be cooked to a minimum internal temperature of 145°F, as measured by a food thermometer, to ensure it is safe to consume.

When preparing salmon, it is essential for safety and health to ensure the fish is cooked to the appropriate internal temperature. According to the USDA and food safety guidelines, seafood, including salmon, should be cooked to a minimum internal temperature of 145°F. This temperature should be measured using a food thermometer to confirm that the salmon has reached the temperature sufficiently high enough to kill harmful bacteria that can cause foodborne illnesses. Additionally, it's important to make sure that when cooking fish in a microwave oven, there are no cold spots where bacteria can survive. For even microwave cooking, cover the seafood, stir, rotate, and if no turntable is present, manually rotate the dish once or twice during cooking.

Dose anyone know the answer???????????

Answers

Cellular respiration occurs at the cytoplasm..

So the answer would be 'Z'

What does the field of biology study

Answers

Answer:

Biology deals with the study of living organisms present on earth. These could be ranging from the microscopic unicellular organisms to the more complex multicellular organisms, including bigger plants and animals.

The study of these organisms helps in understanding the structure, food type, development and growth, body functions and their distribution on earth.

The various sub-branches of biology are as follows-

1) Microbiology

2) Bioinformatics

3) Biotechnology

4) Genetic study

5) Botany

6) Medical

7) Zoology and some other fields.

The field of biology studies living things including plants and animals.

What does the field of biology study?

Biology is a branch of natural science that examines living things. Due to the enormous variety of life on Earth, it is a highly broad field, hence individual biologists typically concentrate on particular fields. Either the scale of life or the types of species investigated are used to categorize these fields.

Botany, zoology, and microbiology are the three main subfields of biology. Zoology is the study of animals, botany is the study of plants, and microbiology is the study of tiny creatures.

Learn more about biology at; https://brainly.com/question/30451768

#SPJ6

what is microevolution
3.
What is the most likely explanation for how speciation occurs?

A)It occurs only by gradual changes.

B)It occurs only by geographic isolation.

C)It occurs only by natural selection.

D)It occurs by more than one method.

Answers

Answer: D

Explanation: Speciation is process in which new and distinct species are formed over a course of time.


It occurs by many means:

1) Gradual Changes- every species undergo some molecular changes with inheritance and eventually leads to formation of an all new species.


2) Geographic isolation- with isolation into a different geographic area, the species try to adopt with the geography and ultimately forms different species. Eg. Australian marsupials.


How can one tell if a reaction has reached equilibrium?
O
A. The reaction starts to go in the reverse direction.
B. The concentrations of products and reactants stop changing.
O
C. The concentrations of products and reactants are equal.
O
D. The reaction stops once the reactants have been used up.

Answers

Final answer:

A chemical reaction reaches equilibrium when the concentrations of products and reactants stop changing, which corresponds to the forward and reverse reactions occurring at equal rates, making the system's reaction quotient (Qc) constant. This is known as dynamic equilibrium.

Explanation:

To determine if a reaction has reached equilibrium, one looks for a state where the concentrations of products and reactants stop changing. Despite the absence of visible changes in concentrations, both the forward and reverse reactions are still occurring at equal rates. This does not imply that the amounts of reactants and products are equal, but that they are constant due to the equal rates of the forward and reverse reactions represented by a double-headed arrow, as in A+B=C+D. During the approach to equilibrium, you'll observe that the reaction quotient (Qc) changes as product and reactant concentrations change; once equilibrium is reached, Qc remains constant.

Dynamic equilibrium is a term used to describe this state. It may seem as if the reaction has stopped, but in reality, the system is dynamically balanced with the forward rate of forming products (C & D) being equal to the rate of the reverse reaction of these products turning back into reactants (A & B).

if you have a prehistoric tooth how can you use carbon dating to determine its age

Answers

Answer:

Radiocarbon dating involves determining the age of an ancient fossil or specimen by measuring its carbon-14 content.Green plants absorb the carbon dioxide, so the population of carbon-14 molecules is continually replenished until the plant dies.

What are currents??????

Answers

A current is a rapid movement of ocean water. The wind also speeds up. Therefore, currents can be very dangerous. At the beach, you have to get out of the water at a certain time because currents can drag you under the water.

If you are referring to nature a current is...A BODY OF WATER OR AIR MOVING IN A DEFINITE DIRECTION

Read the paragraph. Then answer the question that follows. Perhaps you wanted pizza for dinner, but were out voted by the rest of the family who wanted chili. This is similar to what happens in a community. One person has to give up a right for the good of the group. Sometimes citizens' duties and rights conflict with each other. A good example is a public protest. People have the right to meet in groups and share ideas. However, a protest can disrupt traffic or other normal activities. A city must provide extra police protection to keep people safe. Therefore, the city has the right to require permission in advance for a protest. Government must make laws to balance the rights of individuals and different groups of people. Which of the following statements best describes this paragraph? The paragraph contains categories of comparison. The paragraph contains a simile. The paragraph contains no text connections. The paragraph contains an analogy.

Answers

Answer:the last one

Explanation:

Answer:

The paragraph contains an analogy.

Explanation:

Based on the above provided excerpt, we can see that the passage is an analogy on the two sides of every action. Just like the need to sacrifice the minority opinion for the majority, so is the same case for any protests or dissensions in a society.

Analogies provide comparisons between things for the better explanation of the issues concerned. By comparing the majority and minority opinions through the examples of "family pizza", " protests"or even "community rights", the author makes it a point to show the two sides of any story. Of course both opinions matter but for the sake of a democratized and equal footing of the two parties, there had to be some compromises made. And this is exactly what the analogy does. The analogy makes it perfectly understandable for the readers.

Marcy drops an antacid tablet in water and times how long it takes to dissolve. Which of the following will increase the reaction rate? increasing water temperature decreasing water temperature using less water

Answers

Answer:

increasing water temperature

Explanation:

Answer:increasing water temperature

Why is the fossil record incomplete? Choose all that apply.


Not all organisms are fossilized.


Not all scientists believe in the fossil record.


Not all fossils survive.


Not all fossils are found.

Answers

Answer:

The fossil record, however, is quite incomplete. Here's one major reason why: Sediment has to cover an organism's remains in order for the long fossilization process to begin. Most organisms decompose before this can happen.

Answer:

Not all organisms are fossilized. Not all fossils survive.Not all fossils are found.

Explanation:

The most direct way to determine the age of a species is to observe in the fossil record what was the first occurrence of this species. The biggest problem is that the fossil record is very incomplete, because many times organisms decompose before being fossilized, and many fossils have never been found. In short, we can say that the fossil record is incomplete because not all organisms are fossilized, not all fossils survive and not all fossils are found. Moreover, the fact that one finds fossils of a species from a certain age does not mean that such a species originated at that time in geological history. It may be that records of the species's presence in previous ages have been lost.

Why do some codons code for the same amino acid as another codon?

A. it is due to mutations.

B. There are only 20 amino acids and 64 possible combinations

C. Each codon is unique and they all code for different amino acids.

Answers

Answer:

B

Explanation:

i think it is b, because if they have 20 amino acid, 64 possible combination

they will be able to combine between themselve

Answer:

B. There are only 20 amino acids and 64 possible combinations

Explanation:

The genetic code is degenerate this means that more than one codon codes for a single type of amino acid.This degeneracy occurs because there are 64 possible triplets of the bases that exist however there are only 20 amino acids known to encoded by the genetic code. Out of this 64 possible triplet codons, 61 triplets are responsible for coding the amino acid whereas three of them form a stop codon that helps terminate the translation.

Which feature is characteristic of healthy coral reefs?
A. Shallow, clear water
B. Clear freshwater
C. Deep, salty water
D. Cold, murky water​

Answers

Answer:

Answer A

Explanation:

The correct answer is option A, that is, shallow and clear water. Coral reefs refer to the shallow-ocean habitats, which are occupied with sea life. The massive composition that coral reef comprises of is actually manufactured of coral polyps that are the small marine species, which live in colonies.

The hard compositions are left behind when these marine species die, and the branching and stony composition, which is left is limestone and is robust enough to produce a home for new species.

Final answer:

Healthy coral reefs are characterized by shallow, clear water and high biodiversity. The organisms living in the reefs have a mutualistic relationship with photosynthetic unicellular algae, which provide them with nutrition and energy. This clear water allows light to penetrate, supporting the growth of both corals and algae.

Explanation:

Coral reefs are ocean ridges formed by marine invertebrates living in warm shallow waters within the photic zone of the ocean. They are mostly found within 30 degrees north and south of the equator. Coral reefs are characterized by high biodiversity and the structures created by the invertebrates that live in them. They provide nourishment and shelter for a wide variety of species, including over 4,000 fish species.

Shallow, clear water is characteristic of healthy coral reefs. The organisms living in these reefs have a mutualistic relationship with photosynthetic unicellular algae, which provide them with nutrition and energy. The clear water allows light to penetrate, allowing the algae to carry out photosynthesis and the corals to thrive.

How will the level of carbon in the atmosphere change if humans do nothing to reduce their impact on the carbon cycle?

Answers

It will keep rising above 400 parts per million. Carbon is released into the atmosphere through the burning of fossil fuels. It will likely not go down for decades.

1.What is the function of a gene?








2.What do the letters you wrote on the graph paper stand for?








3.Which of the two strings of letters you used in this activity represent the gene?

Answers

Answer:

1. the function of a gene is what makes up the human (proteins,characteristics,traits), you can say genes are little chunks of the DNA and lots of chunks is what makes up what is called chromosomes break that up u get chromatins.

2. the letters you wrote on the graph paper stand for what i like to call "DNA script" written form of DNA

exp: ATATTATAGCCGTATACGGC

3. hmmm... i dont get this one but if you were talking about it like this:

A : adenine

G: guanine these two are nucleotides with two rings

~batmans wife dun dun dun....

what is chemotherapy​

Answers

Chemotherapy is a process of intense treatment for cancer. It includes one or more anti-cancer drugs. However, most people become sick after they go through with chemotherapy. This can last for days or longer. Hopefully, nobody gets cancer and has to go through this procedure.

Final answer:

Chemotherapy refers to the use of chemicals or drugs to treat disease, often for cancer or to treat infections with antimicrobial drugs. It works by killing or inhibiting growth of target cells and is frequently used when other treatments are limited or not possible.

Explanation:

Chemotherapy is a broad term that refers to the use of chemicals or drugs to treat disease. It is frequently associated with cancer treatments but can also refer to antimicrobial drugs that target infectious microorganisms. These drugs generally work by either killing target cells or inhibiting their growth, such as in the case of cancerous structures or infectious microbes.

The use of chemotherapy in cancer treatments involves drugs that interfere with the rapid cell division of cancerous cells. Such treatments are typically used when surgical removal of a tumor is not possible or when other traditional treatments like radiation or hormonal therapy have limitations. However, chemotherapy drugs often impact healthy tissue as well, leading to potential side effects such as nausea and hair loss.

In the case of antimicrobial chemotherapy drugs, they can be bacteriostatic (inhibit the growth of bacteria) or bactericidal (kill bacteria). The use of such drugs needs to be considered carefully to prevent superinfection and the development of antimicrobial resistance.

Learn more about Chemotherapy here:

https://brainly.com/question/36537063

#SPJ12

SCIENCE--A shark, a crab and a shrimp find themselves in hypoxic conditions. Who do you think is most likely to survive a dead zone? Select one: a. Shark b. Crab c. Shrimp

Answers

Answer:

a shark is most likely to survive

which information must be known about a compound to find the molecular formula from the empirical formula​

Answers

Answer:

Molecular mass or vapor density

Explanation:

The empirical formula is the simplest formula of a compound. The molecular formula expresses the exact formula of the compound. To derive the molecular formula, we need information about its molecular mass or if given the vapor density.

                (Empirical Formula)n = Molecular formula ------(i)

         n = number of repeating units of the empirical formula present in one                        mole of the molecule

          also, (molar mass of empirical formula)n = molar mass of compound

      From here, we can find n and insert in (i) above.

What causes the bonds to break in a chemical reaction

Answers

Answer:

Bond energy is the amount of energy that breaks a bond. Energy is added to break bonds and energy is also released when bonds form. ... In an exothermic reaction, the products have (more or less) energy than the reactants.

Explanation:

Final answer:

In a chemical reaction, bonds in the reactants are broken and new bonds are formed in the products. Energy is required to break the bonds and is released when the bonds are formed. This rearrangement of atoms forms new substances.

Explanation:

A chemical reaction involves breaking bonds in the reactants and forming new ones in the products. When a chemical bond is broken, energy is required, and when a chemical bond is formed, energy is released. The amount of energy needed to break a bond is the same amount of energy released when the bond is formed.

For example, in the reaction 2H₂O → 2H₂ + O2, the bonds of two water molecules (H₂O) are broken to form hydrogen (H₂) and oxygen (O2).

Overall, a chemical reaction involves the rearrangement of atoms and the breaking and forming of chemical bonds, which results in the creation of new substances with different compositions.

Which of these might be considered benefits of climate change? Select the
two correct responses.
O
A. Fewer business opportunities
O
B. Increased demand for building construction
O
C. Increased ocean acidity
O
D. The spread of invasive species
O
E. Increased crop growth
SUBMIT

Answers

Final answer:

Increased demand for building construction and increased crop growth are potential benefits of climate change.

Explanation:

The benefits of climate change can be debatable, but two potential benefits are increased demand for building construction and increased crop growth.

Increased demand for building construction: Climate change such as rising sea levels and extreme weather events can lead to the need for new infrastructure and rebuilding efforts, which can create job opportunities and stimulate the construction industry.Increased crop growth: In some regions, climate change can bring longer growing seasons, increased rainfall, or higher concentrations of carbon dioxide in the atmosphere, all of which can result in increased crop production.

Learn more about Benefits of climate change here:

https://brainly.com/question/13823589

#SPJ12

Final answer:

The two options that could potentially be considered 'benefits' of climate change are increased demand for building construction due to adaptation needs and increased crop growth in some regions due to warmer temperatures.

Explanation:

While climate change is generally viewed as a global problem with significant negative impacts, there are indeed a few potential 'benefits' that might occur. However, it is important to note that these potential benefits are often far outweighed by the potential harm.

In terms of your options, the two that could be considered potential benefits of climate change are:

B. Increased demand for building construction and E. Increased crop growth.

As sea levels rise and temperatures change, there may be an increased demand for building construction to adapt to these changes. This could also stimulate economic activity.

Warmer temperatures can also lead to longer growing seasons in some regions, potentially increasing crop growth. However, this is a complex issue and the overall impact on agriculture is likely to be negative due to factors such as increased drought and unpredictable weather patterns.

Learn more about Climate Change Benefits here:

https://brainly.com/question/13823589

#SPJ12

An ecosystem is like a machine that cycles matter by using _____

Answers

Answer:

An ecosystem is like a machine that cycles matter by using captured energy.

Answer:

captured energy

Explanation:

Which steps do geologists use to find the epicenter of an earthquake? Check all that apply.

They look at data from at least three seismographs.

They locate the point where circles intersect one another.

They measure the difference between arrival of P waves and S waves.

They draw circles around the epicenter from three locations.

They obtain information about the intensity of earthquakes from seismographs.

Answers

Answer:

They draw circles around the epicenter from three locations.

Explanation:

Geologists use triangulation method to determine the epicenter of an earthquake.

The epicenter of an earthquake is a point on the earth surface directly above the focus. The focus is the point beneath the surface where the earthquake occurs.

To determine the epicenter of an earthquake, we simply draw three circles whose point of intersection will be the epicenter. How do we now draw the circle?

From a seismogram obtained from 3 stations, we can deduce the time it takes a wave to travel. We simply compare the time lag between the first occurrence of the s-waves and that of the p-waves. Now that we have the time, we can determine the distance travelled by the wave. Since we know that the velocity of waves are constant, we simply use the relationship between velocity and time to find the unknown distance.

Using the distance as the radius, we draw three circles from different seismograph stations on a map. The point where the three circles intersects marks the epicenter of the earthquake.

Answer:

Option (1), (2), (3) and (4)

Explanation:

Earthquakes refers to the sudden shaking of the earth. It releases a certain amount of energy. During an earthquake, seismic P and S waves are generated that travels through the interior of the earth.

The seismographs that are located near the epicenter records the data during an earthquake. This data is then used to draw 3 circles around those 3 seismographs. The point where these 3 circles intersects is the location of the earthquake epicenter.

The arrival of P wave and S waves are also carefully observed. The P waves travels faster than the S waves, so they are recorded first in the seismograph. This difference between the arrival of these two waves are marked that is helpful for the determination of the epicenter.

The intensity of an earthquake is determined by the amount of damage it causes. It is measured by using a scale known as the Mercalli's intensity scale.

Hence, the correct answers are options (1), (2), (3) and (4).

What is the primary source of energy for food chains in an ecosystem​

Answers

The sun is the primary source of energy for food chains in an ecosystem

wich of the following is an example of an epeirogenic process​

Answers

Answer:In geology, epeirogenic movement (from Greek epeiros, land, and genesis, birth) is upheavals or depressions of land exhibiting long wavelengths and little folding apart from broad undulations. The broad central parts of continents are called cratons, and are subject to epeirogeny. PLZ HELP ME FOR MATH!!! go to my profile and plz try answer my question, but if you dont get it plz dont answer!!!

Explanation:

The following is an example of an epeirogenic process is A large plateau forms in the interior of a continental plate when a large section of the plate rises evenly due to an even expansion of the underlying mantle.

The correct option is (C).

1. Epeirogenic processes involve broad-scale vertical movements of the Earth's crust, typically affecting large areas of continents rather than localized regions.

2. Unlike orogenic processes (which involve the formation of mountains through folding, faulting, and volcanic activity), epeirogenic processes result in more gradual changes in elevation over large regions.

3. The formation of large plateaus, such as the Colorado Plateau in the United States or the Deccan Plateau in India, is an example of epeirogenic uplift.

4. This uplift occurs when large sections of the continental crust rise evenly due to processes such as isostatic rebound or mantle convection.

5. Isostatic rebound refers to the adjustment of the Earth's crust in response to changes in surface loads, such as the melting of glaciers or the erosion of mountain ranges, leading to the uplift of previously depressed regions.

6. Mantle convection can also drive epeirogenic uplift by generating upward flow within the Earth's mantle, resulting in the buoyant uplift of continental crust.

7. Overall, epeirogenic processes contribute to the formation of large-scale topographic features such as plateaus, which play important roles in shaping the landscape and influencing regional climates and ecosystems.

complete question given below:

Which of the following is an example of an epeirogenic process? A. Mountains form along a convergent plate boundary when two plates collide, causing rock to bunch and buckle upward B. A rift valley forms at a divergent boundary where two plates are stretched apart. C. A large plateau forms in the interior of a continental plate when a large section of the plate rises eventy due to an even expansion of the undertyng mantle D. Mountains form along a convergent plate boundary when an oceanic plate slips beneath a continental plate, resuling in an upward force on the continental plate.

Other Questions
could someone give me an answer and explain how you got it ? A 5.40 uF parallel-plate, air capacitor has a plate separation of 3.50 mm and is charged to a potential difference of 480 V. Calculate the energy density the region between the plates. why is concentrated sulphuric acid is weak acid A line passes through the points (9, 30) and (18, 30). Which statement is true about the line? How many grams of PbBr2 will precipitate when excess CrBr; solution is added to 60.0 mL of 0.551 M Pb(NO3)2 solution?3Pb(NO3)2(aq) + 2CrBr3(aq) >3PbBrz(s) + 2Cr(NO3)(aq) Match the correct definition with the correct term from questions 10-13: A. Internal energy B. Latent heat C. Chemical (bond) energy D. Nuclear energy 10.The internal energy associated with the atomic bonds in a molecule. 11. May be viewed as the sum of the kinetic and potential energies of the molecules 12. The internal energy associated with the bonds within the nucleus of the atom itself 13. The internal energy associated with the phase of a system. Under the principle of ___________________, the next of kin of a deceased man was to marry his widow and produce an offspring in order to prevent the deceased mans lineage and name from dying out. At what frequency will a 3.0 F capacitor have a reactance of 7.0 k? Lysogenic bacteriophages contribute to bacterial virulence because bacteriophages kill human cells. carry plasmids. kill the bacteria, causing release of endotoxins. produce toxins. give new gene sequences to the host bacteria. Identifying a Word's Part of SpeechMatch each word with the correct part of speech.Abcpredictadjectivepredictablynounpredictableadverbpredictionverb An Earth satellite moves in a circular orbit 561 km above Earth's surface with a period of 95.68 min. What are (a) the speed and (b) the magnitude of the centripetal acceleration of the satellite? Diese Zeichnung ist hochgradig dumm! Denn potentiell gewaltbereiten Menschen mit Gewalt begegnen zu wollen, fhrt zu keiner Lsung des Problems. Linke fordern stets bei Themen wie Gender oder Migration zu differenzieren, aber hier spielt man die Karte Tribalismus aus. Ich mach mir die Welt, widde widde sie mir gefllt. Historisch gesehen entstand der Faschismus als Reaktion auf antifaschistische Politik. Das wording folgte erst spter. Heute gibt es eine Linksflucht und Zusammenbruch der Mitte, die zum Rechtsruck fhrt. Warum wohl? Presented below is information for Carla Vista Co. for the month of January 2017. Cost of goods sold $220,100 Rent expense $33,000 Freight-out 9,500 Sales discounts 9,100 Insurance expense 13,400 Sales returns and allowances 20,000 Salaries and wages expense 63,100 Sales revenue 399,500 Income tax expense 5,000 Other comprehensive income (net of $400 tax) 2,000 . Prepare an income statement using the multi-step format. Which of the following groups have lived on the continent of South America for the longest time: Africans, Native Americans, Spaniards, or Portuguese graph 10x +20y >/= -9 The revenue (in thousands of dollars) from producing x units of an item is modeled by R(x) = 12x -0.005x^2.Find the average rate of change in revenue as x changes from 1001 to 1008. The average rate of change in revenue is ____ dollars per unit. (Do not round until the final answer. Then round to the nearest integer as needed.)I just need to know how to solve this problem, I know the answer. Thank you! if 1 liter cost $12 how much does 0.7 liters cost What did Reaganomics do?A. Force people on welfare to leave the countryB. Deregulate industriesC. Deregulate the militaryD. Force states to collect more taxes A series circuit that is connected to a 50 V, 60 Hz source is made up of 25 ohm resistor, capacite wieh X= 18 ohms, and inductor with X 24 ohms, what is the circuit impedance? a. 25.70 b. 29.2Q 32.4Q c. d. 35.90 5 AIDS, a disease of the immune system, is directly affected by stress. Stress may then promote the deadly progression of the disease. These two statements are an example of ________ factors influencing ________ processes.