What characteristics distinguish invertebrates from invertebrates chordates

Answers

Answer 1
Invertebrates lack a backbone while a vertebrate has one

Hope this helped :)

Answer 2

Invertebrates lack a backbone, while invertebrate chordates, part of the phylum Chordata, lack a backbone but have key features like a notochord and dorsal hollow nerve cord. Urochordata (tunicates) and Cephalochordata (lancelets) are examples of invertebrate chordates.

Invertebrates are animals that lack a backbone, whereas invertebrate chordates are a subgroup within the phylum Chordata that also lack a backbone but share key characteristics with vertebrates. The phylum Chordata includes both vertebrates and invertebrates, and is distinguished by the presence of a notochord, a dorsal hollow nerve cord, pharyngeal slits, and a tail at some point during the organism's lifecycle.Urochordata (tunicates) and Cephalochordata (lancelets) are two clades of invertebrate chordates. Tunicates are mostly found on the ocean floor and are suspension feeders, while lancelets are suspension feeders that feed on phytoplankton and other microorganisms.

Related Questions

The client newly diagnosed with type 2 diabetes mellitus eats a lot of pasta products, such as macaroni and spaghetti. the client is 40 pounds (18 kg) overweight. the client asks the nurse if pasta can be included in the diabetic diet. what is the best response by the nurse?

Answers

The statement that the nurse best response in the client who has diagnose with type 2 diabetes mellitus eats a lot of pasta products is "Pasta can be a part of your diet. It's included in the bread and cereal exchange." So the nurse may say that pasta should be part of the client diet because it includes in the bread and cereal exchange.

The _____ body cavity is where the nerves of the spinal cord are located.

Answers

I believe it would be the dorsal body cavity. 

Hope this helped!

What has uekaryotik cells liver, virus, oak, lactobacillus?

Answers

Eukaryotic cells have chromosomes, a membrane-bound nucleus, and membrane-bound organelles, practically any living thing. Eukaryotic cells are also considered animal cells. 

It could be both liver and oak
It could also just be liver if it specifies eukaryotic animal cells. 

A student using a light microscope observes a cell and correctly decided that it is

Answers

An animal cell/ plant cell/ what transition it is in cell division. You might need to be more specific. A lot can be seen through a microscope

Which of the following is generally true of female bones in relationship to male bones?

They are typically larger.
They are typically longer.
They are typically smoother.
They are typically spotted.

Answers

The are actually smoother!
b becuse there female ..........hope it helps

The hard and brittle outer layer of the Earth is known as the _______. A. core B. lithosphere C. atmosphere D. mantle

Answers

Hi Ash, thanks for asking a question here on Brainly!

The hard and brittle outer layer of the Earth is known as the lithosphere.

Answer: Letter B 

Hope that helps! ★ If you have further questions about this question or need more help, feel free to comment below or post another question and send the link to me. -UnicornFudge aka Nadia 

If ur doing studyisland the answer is (A) lithosphere

How would earth's atmosphere change if plants stopped carrying out photosynthesis?

Answers

the plant would no longer put out oxygen, and the concentration of carbon.
the atmosphere would no longer have oxygen and carbon. 

The circulatory system of organisms carries nutrients throughout that organism. Which cell structure has a similiar structure?

Answers

The answer is: Endomembrane system

How do the atoms in diagram differ from those in diagram d

Answers

Do you mean diagram A compared to Diagram D?

Diagram D is different from Diagram A because Diagram D shows representations of molecules which make up compounds. Diagram A is a representation of atoms which make up elements.

What is the name of muscle's state of perpetual partial tension?

Answers

In healthy humans, our muscles are always a little bit tensed, or in a state of perpetual partial tension. This is called muscle tone. It keeps the bones and joints stable, and prevents muscles that are not being actively used from beginning to atrophy. This is not a conscious process; we don't think about keeping muscles partly active, the body just does it.

Muscle tone, or tonus, is the state of perpetual partial tension in muscles. It allows muscles to maintain posture and readiness for action, while muscle tension can vary to handle different levels of load.

The name of the muscle's state of perpetual partial tension is muscle tone or tonus. This state helps to maintain posture and ensures that muscles are ready for action. The control of muscle tension involves neural control that initiates the formation of actin-myosin cross-bridges. The tension a muscle produces can vary, allowing it to handle different levels of load, from light objects to heavy objects. During an isotonic contraction, tension in the muscle remains constant as the muscle changes length. Factors like the cross-sectional area of the muscle fiber and the frequency of neural stimulation influence the amount of tension produced.

The restriction enzyme saci has a recognition sequence of gagct^c, where the caret (^) indicates the cut site. examine the dna molecule below. agagctcagtcgagagctcagatcgataggagctcagatctcgatcacctc tctcgagtcagctctcgagtctagctatcctcgagtctagagctagtggag how many separate molecules of dna would you end up with if you treated the above dna molecule with saci?

Answers

dge78wdgqwe8fguefuqefioequf9be

There are total three molecules of dna would you end up with if you treated the above dna molecule with saci.

What are restriction enzymes?

A restriction enzyme, restriction endonuclease, or restrictase is an enzyme that cleaves DNA into fragments at or near specific recognition sites within molecules known as restriction sites. Restriction enzymes are one class of the broader endonuclease group of enzymes.

Moreover, a restriction enzyme is a protein isolated from bacteria that cleaves DNA sequences at sequence-specific sites, producing DNA fragments with a known sequence at each end. The use of restriction enzymes is critical to certain laboratory methods, including recombinant DNA technology and genetic engineering.

Therefore, four types of restriction enzymes are recognized, designated I, II, III, and IV, which differ primarily in structure, cleavage site, specificity, and cofactors.

Learn more about restriction enzymes:

https://brainly.com/question/14953274

#SPJ6

Where do the adp and nadh go after they are used in the calvin cycle?

Answers

They are consumed.  Please mark Brainliest!!!

The bony, spiral-shaped, fluid-filled sense organ used for hearing is the __________.

Answers

Generally the ear, and more specifically the cochlea

The ear is composed of 3 parts namely:
 1. The outer ("external") ear, composed of the pinna and ear canal, 
 2. The middle ear, composed of tympanic cavity and three ossicles, 
 3. The inner ear, composed of semicircular canals, the utricle, saccule, and the cochlea. 

Hearing happens initially by allowing the pinna of your ear to focus the sound. Then, by means of the ear canal and the ossicles, the sound is sent to the fluid-filled eardrum, which begins to vibrate. The vibrations are sent to the snail-shell looking component of the inner ear called the cochlea. The cochlea senses these vibrations and converts them to nerve impulses to be interpreted by the brain, making you "hear" the sound. 




Human growth hormone is a secreted protein that stimulates growth and cell reproduction. in the 1960s it was discovered that this was an effective treatment for a form of dwarfism. however, before it was genetically engineered, it was _____

Answers

The answer is that it was harvested from cadavers which are corpses of a body that is deceased—they are used before the treatment that is effective for dwarfism was genetically engineered and by this, there has been some studies and researches that has been found out when they harvested from the cadavers.

Which trigonometric functions have asymptotes? (select all that apply.)?

Answers

The trigonometric functions that have asymptotes are:
1. Tangent function 
 f(x) = tan (x)
2. cotangent function
f(x) = cot (x)
3. secant  function
f(x) = sec (x)
4. cosecant function 
f(x) = csc (x)

Suppose an organism can alternate between aerobic and anaerobic respiration. if it had to use anaerobic respiration exclusively, how many glucose molecules must it break down to generate the same atp as it would in aerobic respiration?

Answers

When one glucose is broken down under aerobic condition, 38 ATP are normally produced. When one molecule of glucose is broken down under anaerobic condition, 2 ATP are always produced.
If the organism is using aerobic respiration, it will generate 38 ATP. Under anaerobic condition, the organism have to break down 19 glucose molecules in order to produce 38 ATP, since it can only get 2 ATP from each glucose molecule.

Which set of body parts does every mollusk have?

Answers

Hello!

A mollusk is a snail in case you didn't know! Every single one has a foot, a Visceral Mass, and a head. A Visceral mass is like the body and it includes the organs.

I hope this helped!

I am, yours most sincerely,
SuperHelperThingy.

The body plan of a mollusk ordinarily comprised of a head region, a muscular foot, and a visceral mass of abdominal organs that are usually enclosed inside a dorsal shell. Each class holds some contrast on this primary plan.

The structure of the gastropod body is substantially comparable to the primary body plan of mollusks.

Most mollusks have a muscular foot for crawling or burrowing. Some mollusks also have a head with sense organs. The delicate body comprises lungs or gills to breath and digestive and generative parts, all surrounded by a covering like an organ known as the mantle.

What is the hallmark of our species, according to evolutionary psychologists?

Answers

The hallmark of our species, according to evolutionary psychologists is OUR ENORMOUS CAPACITY AND OUR SHARED BIOLOGY ENABLED OUR DEVELOPED DIVERSITY.
Evolutionary psychology is the study of the root of behavior and mental processes using the process of natural selection and focusing on what make human beings alike. Evolutionary psychologist believed that human beings are so very much alike because they have the same biological make up and high capacity.

As food molecules are broken down during __________, carbon is released back into the atmosphere as carbon dioxide.
a. breathing
b. the nitrogen cycle
c. the water cycle
d. cellular respiration

Answers

D. Cellular Respiration

A cross between a tetraploid and a diploid member of the same species will produce offspring that can undergo sexual reproduction. hints a cross between a tetraploid and a diploid member of the same species will produce offspring that can undergo sexual reproduction.
a. True
b. False

Answers

False

In order to happen sexual reproduction, the cells that origin gametes must have an even number of chromosomes. By crossing a tetraploid (4n) with a diploid (2n), the offspring would have a total number of 3 copies of each chromosome (2 from the tetraploid parent and 1 from the diploid parent), which when undergoing sexual reproduction would not allow meiosis to happen because the chromosomes could not be evenly divided to gamete cells.

The __________ skeleton is made up of 126 bones of the limbs and girdles.

Answers

Human body skeleton

Which of the following pairs with uracil in RNA?

adenine


thymine


guanine


cytosine



RNA is single stranded AND found mainly in the nucleus.

True
False


Which of the following is NOT true?

DNA is found in the nucleus.


DNA replication produces four new strands of DNA.


DNA and RNA each contain four nitrogenous bases.


A nucleotide consists of a sugar, a base, and a phosphate.

Answers

Adenine
T
DNA and RNA each contain four nitrogenous bases.

What is one major impact of seedless vascular plants?

Answers

By far the greatest impact of seedless vascular plants on human life, however, comes from their extinct progenitors. The tall club mosses, horsetails, and tree-like ferns that flourished in the swampy forests of the Carboniferous period gave rise to large deposits of coal throughout the world.

The vascular seedless plants are utilized as the medicinal plant and fertilizer.

Further Explanation:

The vascular plants are those plants that possess xylem and phloem for the transport of water and food respectively. Plants that have vascular system but are seedless are the members of Pteridophytes.

The characteristics of Pteridophytes:

1. They are seedless and vascular cryptogams: They reproduces through the production of spores.

2. They show alternation of generation as the sporophytic generation alternates with the gametophytic generation: Sporophyte possess true root, stem and leaves.

3. Spores are developed in the sporangia. Both type of spores are developed- homosporous and heterosporous.

4. Sex organs are multicellular and are jacketed.

Some of the example of Pteridophytes are:

1. Equisetum

2. Salvinia

3. Dicksonia

4. Selaginella

The importance of pteridophytes:

1. They are used as cattle feed

2. They are used for medicinal purpose. For example the foliage decoction of Lycopodium is utilized in homeopathy to treat certain disease such as constipation, eczema, diarrhea and inflammation of liver. Equisetumcontains various flavonoid and saponina that have diuretic effect.

3. Marsilea contains starch and are consumed by people as food in some areas.

4.  Aquatic pteridophyte such as Azollaare used as a very good biofertiliser.

Learn more:

1. Learn more about plant https://brainly.com/question/862697

2. Learn more about photosynthesis https://brainly.com/question/873199

3. Learn more about food https://brainly.com/question/1251757

Answer Details:

Grade: College Biology

Subject: Biology

Chapter: The Plant Kingdom

Keywords:

Vascular seedless, xylem, phloem, pteridophytes, sporophytic generation, gametophytic generation, Lycopodium, Marsilea, Azolla.

why are temperatures near the great lakes cooler in the summer than temperatures a few miles away?


EARTH SCIENCE

Answers

Because water has high special heat capacity

Answer:the lakes have a high specific heat capacity

Explanation: ape x

Living organisms are composed of millions of organic compounds, each having a unique structure . What element is responsible for this huge diversity of molecules? Describe the diversty of structures that can be formed in the properties of this element that allow this diversity of form to occur

Answers

The element that is responsible for the huge diversity of the molecules is CARBON.
Carbon is able to bring about these diverse molecules as a result of its atomic structure. Carbon has four electrons in its outermost shell which enables it to form different types of chemical bonds with different types of elements and with itself. The smallest molecule among the diverse molecules form by carbon is methane, all other molecules are bigger and more complex than methane.

What is the basic structural unit of both dna and rna?

Answers

The Nucleotide. DNA and RNA are both nucleus acids. Nucleic acids' monomer is called a nucleotide.

What does it mean when we describe water as being polar?

Answers

Water is polar because one side negatively charged and one side is positively charged. 
Water is polar because it's polar.

The processes of endocytosis and exocytosis both require?

Answers

require cells to expend energy

Answer: Uses vesicles

Choose the factor that is likely to limit population growth.

Answers

The answer would be D

Limiting factors are the resources that can limit population growth. It can include keystone species, predator, energy, available space, disease and food supply etc.

What are the limiting factors for population growth?

Population growth limiting factors are either density-dependent or density-independent.

Density dependent factors can include disease, competition and predators while density independent factors can include harsh weather, limited food supply, lower quantity of nutrients etc.

Thus, in the given question, option D is correct.

For more information about population growth, visit:

https://brainly.com/question/18415071

We have already talked about another class of chemicals that help send signals in the body – neurotransmitters. how are neurotransmitters and hormones similar and how are they different

Answers

Hormones are the chemical messengers of the endocrine system and are transported by blood to distal target cells.Neurotransmitters are the chemical messengers found in the nervous system that specifically do the transmission across the synaptic cleft, where the space exists between two axons.They both carry messages but belong to different systems of the body.

Final answer:

Neurotransmitters and hormones serve as chemical messengers in the body, with neurotransmitters traveling short distances for precise communication between neurons, while hormones travel longer distances through the circulatory system to reach target cells. Neural messages are likened to train travel, limited to nerve tracts, while hormonal communication is akin to car travel, reaching any cell via blood flow. Neural messages are faster, whereas hormonal messages can lead to enduring changes.

Explanation:

Neurotransmitters and hormones both serve as chemical messengers in the body. Neurotransmitters are used by neurons and travel short distances to bind with receptors on postsynaptic neurons, while hormones enter the circulatory system to travel longer distances to reach target cells and bind with specific receptors.

Neural messages are like traveling on a train, limited to existing nerve tracts, while hormonal communication is compared to traveling in a car, able to reach any cell receiving blood via the circulatory system. The speed of neural messages is faster due to the short distance traveled, while hormonal messages can result in long-lasting changes throughout the body.

Other Questions
Ou are performing rescue breathing on a victim who was pulled unconscious from a swimming pool. after blowing slowly into your cpr mask until the victim's chest rises, you should: remove your mouth from mask, but cover the breathing part with your hand keep your mouth on the exhalation port while the victim exhales remove your mouth from the mask and allow the victim to exhale give a second rescue breath red scare social darwinism growth of the ku klux klan convictions of sacco and vanzetti 5. the events of the 1920s listed above reflect the influence of What is one way the United States uses a Command economy? Christian wrote his version of a myth about Daphne and Apollo for his English assignment. Read this excerpt from paragraph 2 of Christians draft of his introduction and answer the question. He had slain a horrifying monster called the Python, a serpent whose poisonous body had coveredan entire hillside. It required a thousand arrows to kill it. What is the best way to combine the underlined portion to achieve parallel structure? a serpent whose poisonous body had covered an entire hillside and had required a thousand arrows to kill it. a serpent whose poisonous body had covered anentire hillside, and Apollo had required a thousand arrows to kill it. a serpent whose poisonous body had covered an entire hillside and requiring a thousand arrows to kill it. a serpent whose poisonous body had covered an entire hillside and who had required a thousand arrows to kill it. which best indenifies a characteristic of historical fiction Why was theodore roosevelt seen as the first conservationist president? Which of the following sentences uses spatial organization? A.The candidate was not doing well in the polls because he made some controversial comments. B.If the dough starts to feel too stiff as you're kneading it, add some water. C.The clownfish aquarium is located at the end of the tropical fish hall on your right hand side. D.You'll need to fill out this form before you can see the doctor. If you need to set up direct deposit ,which information from your check would you likely need? Solve the system 4x+2y=7 y=5xA. (1,5)B. (3,15)C. (2,10)D. (0.5,2.5) What incident causes apollo to send a plague to kill the achaens 1)List the number of protons, neutrons, and electrons in Carbon-13. 2)A fictitious element X is composed of 10.0 percent of the isotope X-55, 20.0 percent of the isotope X-56, and 70.0 percent of the isotope X-57. Calculate the weighted atomic mass of element X to the nearest tenth. Please help with both questions and show all work! Which inheritance pattern results when parents are crossed for pure traits and the resulting offspring have traits that appear to blend? How did the French and Indian War play a role in causing the American Revolution?A)The French and Indian War had no effect on the American Revolution.B)It led to disputes and conflict between the American colonists and the British crown over the war's expense and British policies.C)The British government adopted a variety of policies to punish the American colonies for siding with the French and the Indians during the conflict.EliminateD)The fighting between the French settlers and the Indians created an opportunity for the American colonists to seize French settlements on the frontier. How did america transform from an elite group into a more democratic nation? How does global stratification impact the united states what are the positive and negative effects? Round 0.955 inches to the nearest tenth of an inch explain how phoenicia economically survived If you add salt continuously to a glass of water, eventually some salt will remain at the bottom. why? Refractive index measures the speed of light in a vacuum to its speed in A fact is something that is. changeable. objective. personal. subjective.