What gene does aacgaagaggacatagagtatctaccgaaaaacaatcccgaaggaccgttacaacactcgatcaaccgcaagaaagtacgatggcaacatccattgtgtatgcatccatatctcatccagcattctgaaagggtaatgaataattattccgctgagttcatgaggtatccgaaggaggagcaacacttaggctataagagtatcatgcacatagatcgggataaatcgcctatcatatgtgacaacaatttcatgattaaaagt code for?

Answers

Answer 1
A gene instructs for the making of protein molecules.
Please make brainliest!☺

Related Questions

While making rounds, the nurse finds a client lying on the floor next to a wheelchair. the client states, "i was trying to get back to bed and slipped." what should be the nurse's initial action?

Answers

The nurse should first help the patient get into bed. He/ she should then call the nurse manager and alert the administration of what has happened. Later an arrangement should be done to examine the client to make sure there are no injuries that may harm the client.

Ocean salinity is usually expressed in _____.

charts and graphs
chemical formulas
parts per billion
parts per thousand

Answers

Ocean salinity is usually to expressed into their one parts per thousand. And the correct answer is D. parts per thousand. Then the wrong answer should be A. Charts, and graphs, B. Chemical formulas, and C. Parts per billion.

Hope it helped!

Answer: parts per thousand

Explanation:- Salinity is the total amount of solid material dissolved in water.

1. Charts and graphs are used to represent a set of numerical  data in pictorial form.

2. Chemical formulas is the formula which depicts the number of atoms of each element present in  a substance.

3. parts per billion is used to express the concentration of very dilute solutions.It is used when 1 part of the solute is dissolved in [tex]10^9[/tex] parts of the solution.

4. parts per thousand is used to express the concentration of dilute solutions. It is used when 1 part of the solute is dissolved in 1000 parts of the solution.

The rate at which blood flows through the human body changes in response to many factors. Which statement describes one of these factors and its effect on blood flow?
A.The narrowing of blood vessels increases pressure and leads to faster blood flow.
B. High blood viscosity increases the resistance in the blood vessels and leads to slower blood flow.
C. Low blood pH decreases the rate of diffusion through the blood vessels and leads to slower blood flow.
D.The changing of the shape of red blood cells to a crescent shape decreases resistance and leads to faster blood flow.

Answers

A high viscosity of blood causes an increased resistance in the blood vessels and leads to slow blood flow.

Viscosity refers to the thickness of blood. This thickness is caused by the number of red blood cells. Thick blood travels through blood vessels at a slower rate than thin blood.

High blood viscosity increases the resistance in the blood vessels and leads to slower blood flow describes one of these factors and its effect on blood flow. Thus, option B is correct.

What is viscosity?

The thickness of a liquid in known as viscosity or its property of being sticky and its consistency which is created due to the friction present inside it.The unit of viscosity is newton- second per square meter and it is written as pascal-second in SI system.

There are several methods by which viscosity is measured and these are rotational rheometry, non-contact rheology, vibrating viscometers, capillary viscometers.

The viscosity of honey is 3,200.0, viscosity of peanut butter is 250,000.0 it means different items have different viscosity.

Therefore, High blood viscosity increases the resistance in the blood vessels and leads to slower blood flow describes one of these factors and its effect on blood flow. Thus, option B is correct.

Learn more about viscosity here:

https://brainly.com/question/13385698

#SPJ2

A tricyclic antidepressant has been prescribed to a 77-year-old client whose current medication regimen includes omeprazole, captopril, calcium carbonate, alendronate, and warfarin. what assessment should the nurse prioritize when monitoring the client for drug-drug interactions?

Answers

Monitor the client closely for bleeding and review coagulation indices when available.

Combining TCAs with warfarin creates a risk for bleeding, which should be addressed in the nursing care plan. There is no known interaction between TCAs and calcium supplements or bisphosphonates that would create a risk for hypocalcemia. TCAs do not heighten the risk of gastroesophageal reflux. TCAs can affect blood pressure, but this is unrelated to any known drug-drug interactions.

According to prep u/ Course point

Answer:

There is a need to monitor closely for bleeding and review coagulation indices when accessible.  

Explanation:

Combining warfarin with TCAs develops a threat for bleeding that should be assessed in the nursing care plan. There is no familiar association between the calcium supplements or bisphosphonates and TCAs, which would develop a threat of hypocalcemia. The TCAs do not elevate the threat of gastroesophageal reflux. The TCAs can influence blood pressure, however, this is not associated with any known drug-drug associations.  

Which is a functional characteristic of phagocytes?

Answers

A functional characteristic of phagocytes is that phagocytes may experience chemotaxis.

Hope this helps you!

From which type of organism did the ancestor of land plants likely evolve

Answers

Protists similar to green algae. Hope this helps! ◕‿◕

Mr. jones has a large kidney stone that is obstructing the flow of urine in his left kidney, resulting in kidney enlargement and backing up of urine into his ureter. this is known as:

Answers

Kidney stones that are present are called calculi (plural of calculus: "stone" in Latin). They may or may not ever obstruct, but when they do it is termed "Nephrolithiasis."

In the process of genetic engineering, what is the correct order of the steps?

Answers

Final answer:

The correct order of steps in the process of genetic engineering is: identify desirable gene, isolate gene, insert gene into vector, introduce vector into host organism, allow replication and expression, and screen for successful incorporation and expression.

Explanation:

The correct order of steps in the process of genetic engineering is as follows:

Identify the desirable trait or gene that you want to introduce into the organism.Isolate the gene from the source organism using molecular cloning techniques.Insert the gene into a vector, such as a plasmid.Introduce the vector into the host organism, often using a technique called transformation.Allow the host organism to replicate and express the foreign gene.Screen for successful incorporation of the foreign gene and verify its expression.

Learn more about genetic engineering here:

https://brainly.com/question/34206889

#SPJ12

In the second phase of the seligman and maier (1967) experiment with dogs in the shuttle box, dogs in the condition(s) during phase 1 of the experiment were able to learn how to escape the shock.

Answers

The correct answer is "escapable shock".
Seligman and Maier's experiment was focused on the psychological phenomenon of learned helplessness. The first phase of the experiment included three groups of dogs who were put in harnesses. Dogs from groups 2 and 3, were tied in pairs and received electric shocks at random times. Dogs from group 2 were trained to press a lever to stop the electric shock. When dogs from group 3 pressed a lever, there was no effect on the electric shock. Therefore, dogs from group 3 perceived the electric shock as an inescapable painful stimulus. The second phase of the experiment involved a shuttle box. Dogs from all groups were put in these boxes and were free to jump outside the box when the electric shock was applied. However, dogs from group 3 (who were trained in phase 1 to believe that this was an inescapable shock) were passive and did not make any effort to escape the box. This was an experiment proving the theory of learned helplessness, according to which an animal or human who is chronically exposed to painful and inescapable stimuli, is unable to try and escape from new painful situations.

Choose the correct anatomical sequence that presents the order in which food passes through the digestive system of a mammal. see concept 41.3 (page 903)

Answers

Food enters through the mouth, where teeth perform the initial breakdown of food into smaller particles and mix it with saliva. The food passes down the pharynx situated behind the mouth and nose, down into the oesophagus, into the, stomach where further breakdown of food occurs, into the small intestine and finally into the large intestine.


what is the difference between an endangered species and a threatened species

Answers

A endangered species is in danger of being extinct. And a threatened species is in danger of being a endangered species
4times x = 425 times 7 is =1000.25

How did early cyanobacteria affect the physical and chemical conditions on earth?

Answers

Early atmosphere of earth had less oxygen (had more carbon dioxide and ammonia) hence was a non-reducing atmosphere. Most bacteria that thrived were anaerobes. However, the emergence of cyanobacteria approximately 3.5 million years ago filled the atmosphere with oxygen. This is because cyanobacteria respire out oxygen. The atmosphere thenceforth became reducing and hence most anaerobes perished while aerobics thrived. This is referred to as the Great Oxidization Event. The formation of ozone layer also enabled thriving of life since the UV light from sunlight was blocked and hecne could not damage organic molecules.


Mean arterial pressure is equal to diastolic pressure plus one-third of the pulse pressure. an equivalent equation is map = 2/3 dbp + 1/3 sbp. why is diastolic blood pressure (dbp) a larger component of map than systolic blood pressure (sbp)?

Answers

This is because the ventricular diastole or the filling of the ventricles with blood takes much more time than ventricular systole or the pumping of blood from the ventricles to systemic and pulmonary circulations. The difference in time between diastole and systole reflects on the equation.

True or false: the smallest unit in a worksheet is a cell.

Answers

The answer would be true.

Answer:

True

Explanation:

One effect of orienting movements is that they
a. inhibit those sensory systems not receiving any current input
b. help to obtain the maximum information possible about the stimuli in which one is interested
c. position the visual stimulus on the peripheral parts of the retina
d. inhibit any eye movements, thus leading to absolute fixation on the stimulus in which one is interested

Answers

You're a bot. If you aren't I'm sorry but your name is like the exact same as a bunch of others

Explain what happens in the large intestine to cause diarrhea or constipation. how does the function of the large intestine relate to another key resource?

Answers

Answer: Diarrhea or constipation can be caused when the muscles of the large intestine do not function properly

Explanation: Diarrhea is caused when an infection or illness cause the body to release too much water into the intestines in order to flush them out. Constipation is the opposite; not enough fiber causes a backup of stool in the large intestine. The colon's main job is to absorb water, nutrients and electrolytes from partially digested food, the rest is pushed down as waste (feaces)

Muscles in the colon work to get rid of the body's waste products. They contract and relax as they push the undigested food through the large intestine. If the muscles in the colon don't work at the right speed for proper digestion or if the coordination with muscles in the rectum or pelvis is interrupted, the contents of the colon can't move along smoothly. When this happens, a person can feel the belly cramps, bloating, constipation, and diarrhea  

Diarrhea and constipation are caused by disruptions in the GI tract's normal function in the large intestine, resulting in loose or hardened stools.

Diarrhea occurs when the large intestine discharges its contents before water reabsorption is complete, resulting in loose stools. Conversely, constipation happens when the colon retains contents for too long, leading to hardened feces. Both conditions are caused by disruptions in the GI tract's normal function.

Why does ether prevents action potential from occuring?

Answers

Ether prevents the action potential, by opening potassium ion pores which allow the escape of potassium from the neurons, which results in hyper-polarized of the neuron, thus preventing the action  potential from occurring. Ether is an organic functional group consisting of a disubstituted oxygen, or an oxygen atom bonded to 2 carbon atoms. Lock anesthetics block nerve conduction by preventing the increase in membrane permeability to sodium ions that normally leads to a nerve impulse.

Protein channels that specifically allow water to move across the cell membrane is

Answers

aquaporin is the answer

After changing a dressing that was used to cover a draining wound on a client with vancomycin-resistant enterococci (vre), the nurse should take which step to ensure proper disposal of the soiled dressing?

Answers

the nurse should dispose the dressing in a red bag labeled as hazardous material. Remember that any material coming from an infected patient is considered as infectious. it is potentially infectious to the human body, especially to those who are immunocompromised. Vancomycin resistant enterococci is a bacteria which is resistant to the antibiotic Vancomycin. it means this type of antibiotic is not working to kill the bacteria, moreover this type of bacteria is highly infectious that's why precaution is observed. 

What can a deficiency of growth hormone during bone formation cause? what can a deficiency of growth hormone during bone formation cause? decreased osteoclast activity inadequate calcification of bone increased osteoclast activity decreased epiphyseal plate activity?

Answers

The deficiency of growth hormone during bone formation would cause a decreased proliferation of the epiphyseal plate cartilage. Growth hormone is a peptide hormone secreted by the pituitary gland under the control of the hypothalamus. It directly through IGF-I stimulates osteoblasts proliferation and activity, promoting bone formation. In addition it also stimulates osteoclast differentiation and activity, promoting bone resorption. Therefore, growth hormone is an important hormone in bone formation. 
Final answer:

A deficiency of growth hormone during bone formation can lead to conditions like pituitary dwarfism in children, characterized by reduced growth. Other hormones like thyroxine, sex hormones, calcitriol, and parathyroid hormone also play crucial roles in bone growth and formation. Their deficiencies could lead to decreased bone density and conditions like osteoporosis.

Explanation:

A deficiency of growth hormone during bone formation can cause several issues. Most notably, it can cause pituitary dwarfism in children, a condition characterized by reduced growth resulting in a significantly smaller stature, often under 30 inches in height. Growth hormone is important for it increases the length of long bones, enhances mineralization, and improves bone density.

Other important hormones also play significant roles in bone growth. For instance, thyroxine stimulates bone growth and promotes the synthesis of bone matrix, while sex hormones, such as estrogen and testosterone, promote osteoblastic activity and the production of bone matrix. These hormones are also responsible for the adolescent growth spurt, and promote closure of the epiphyseal plates.

Meanwhile, calcitriol and parathyroid hormone stimulate the osteoclast activity and are involved in the absorption of calcium and phosphate necessary for bone formation. Deficiency of these hormones could lead to decreased bone density, leading to conditions such as osteoporosis.

Learn more about Hormonal regulation of bone growth here:

https://brainly.com/question/10640978

#SPJ3

Distinguish between the structure of pyrimidines and purines. explain why adenine bonds only to thymine.

Answers

Pyrimidines have a single ring structure. Purines have a double ring structure. Adenine and thymine bind together as they’re complementary base pairs to one another, and form 2 hydrogen bonds upon binding

Final answer:

Pyrimidines, such as cytosine and thymine, are single-ringed structures, while purines, like adenine and guanine, are double-ringed. Adenine bonds only to thymine because they can share two hydrogen bonds, maintaining DNA's stable helix structure.

Explanation:

Distinguishing Between Pyrimidines and Purines

The structure of DNA nucleotides includes two distinct types of nitrogenous bases known as pyrimidines and purines. Pyrimidines are single-ringed structures and include cytosine (C) and thymine (T). In contrast, purines are double-ringed structures represented by adenine (A) and guanine (G).

When it comes to the bonding of these bases, adenine forms bonds only with thymine due to the ability of these to share two hydrogen bonds. This selectivity in bonding is also facilitated by the way DNA structures its nucleotide pairings—one purine with one pyrimidine—providing the necessary spacing to maintain the helix's integrity. The double-ring of a purine and the single-ring of a pyrimidine together form a pairing of a consistent shape and size, critical for the DNA structure. For this reason, adenine cannot pair with another purine such as guanine because it would create too much spatial hindrance, nor can it pair with another pyrimidine like cytosine due to excessive spacing.

So, adenine bonds only to thymine due to their matching ability to create two hydrogen bonds and the structural conformity that results when a purine is paired with a pyrimidine, thereby maintaining the optimal width of the DNA helix.

How did plate tectonics affect the evolution of dominant animal life in the mesozoic era?

Answers

As the vast Pangea continent broke apart due to tectonic movements, the movement of animals was restricted to their continent hence gene flow between populations was reduced. As the tectonic plates moved across latitudes, their climate changed and consequently, the fauna on the continents. This necessitated for speciation of the offspring population from parent population so as to adapt to the new habitats. Some animals were unable to adapt while others such as the reptiles, adapted well.






Final answer:

Plate tectonics influenced the evolution of dominant animal life in the Mesozoic Era by creating new environments and ecological niches for species to diversify and evolve.

Explanation:

Plate tectonics greatly influenced the evolution of dominant animal life during the Mesozoic Era. The movement of continental plates led to the formation of supercontinents like Pangaea, which affected the distribution of terrestrial and marine habitats. As the continents shifted and new environments were created, different niches and ecological opportunities emerged, allowing for the diversification and evolution of new species. For example, the formation of new mountain ranges and inland seas led to the isolation of certain animal groups, facilitating speciation and increased biodiversity. Additionally, changes in climate and sea level associated with plate tectonics influenced the availability of resources and the composition of ecosystems, further shaping the evolution of dominant animal life during this era.

Complex carbohydrates, such as fruits and vegetables, are universally viewed as healthier than simple carbohydrates like sugar. Why are complex carbohydrates a better dietary choice?

Answers

I'm not a biologist, so I don't know the actual answer. But my best guess is that there is more in fruits and vegetables than just simple sugars or even complex carbohydrates. There are vitamins for example. Some of the vegetables have simple proteins which are much easier to break down that the complex ones found in meat. 

Explanation:

Complex carbohydrates like fruits, vegetables, whole grains, beans, peas etc. They contain vitamins, minerals and fibres, that's why they are the source of long lasting energy because they take long time to digest.

Complex carbohydrates are healthier than simple carbohydrates like sugar are present in fruits, table sugar, soft drinks, milk and milk products etc. They digested quickly not the long lasting as complex carbohydrates, they can easily broken down by the body.

Complex are better dietary choice because it contains more nutrients than simple carbs. They are high in fibre and digested slowly, this is the better way for weight control.

The Rh factor is a protein found on the surface of red blood cells. The Rh factor must be matched during blood transfusions. Rh+ individuals may receive blood from Rh+ and Rh- donors while Rh- individuals can only receive Rh- blood. Rh+ individuals possess at least one dominant allele (R) for the trait while Rh- individuals are homozygous recessive. Two Rh+ parents have children. What is the probability that any offspring will NOT be able to receive a transfusion from either parent?

Answers

Answer:

The correct answer would be 25 percent.

It is the case when both the parents are heterozygous for the trait that is, both are Rr in genotype.

Thus, both the parents would produce two types of gametes one of which contain R and the other one would contain r.

The cross would result in the production of the offspring with three types of genotypes; RR, Rr, and rr.

The three genotypes would be present in the ration 1 (RR): 2 (Rr): 1 (rr).

Thus, only one out of four would be Rh- in phenotype. Hence, only 25 percent is the probability that the offspring would not be able to receive blood from either parent.

According to the Punnett square, it is likely that 1 out of 4 offspring will be homozygous recessive or Rh-. That means there is a 25% that offspring will be Rh- and will not be able to receive blood from either parent.

A(n) __________ is not associated with structural deformation.

Answers

A stratigraphic trap is not associated with structural deformation.

Hope this helps !

Photon
Hey there :)

Stratigraphic pinch out Traps

It is the termination by thinning or tampering out of a reservoir/lake against a nonporous [Not letting water or air pass through] sealing rock

Which one is NOT true of deep ocean trenches? A. They are associated with mid ocean ridges B. They are part of active continental margins c. They are sites where plates plunge back into the mantle d. They are long and narrow depressions at subduction zones

Answers

D. They are long and narrow depressions at subduction zones

Deep ocean trenches are not associated with mid-ocean ridges. The correct option is A.

What is a Deep ocean trench?

Deep ocean trenches are actually associated with subduction zones, which are areas where one tectonic plate is being forced beneath another plate.

They are typically located at the boundaries of tectonic plates where oceanic crust is being subducted beneath either another oceanic plate or a continental plate.

Mid-ocean ridges, on the other hand, are divergent boundaries where tectonic plates are moving away from each other, resulting in the upwelling of molten material from the mantle and the formation of a new oceanic crust.

These ridges are characterized by volcanic activity and the creation of new seafloor.

Therefore, the correct statement should be "A".

To know more about Deep ocean trench, click here:

https://brainly.com/question/1224612

#SPJ6

Which of these is an environmental effect of burning fossil fuels and pesticides from farming?
Smog
Poisoning Wildlife
Increased Temperature
Use of large amounts of water

Answers

I believe the answer would be Poisoning Wildlife.
I really hope this helps, and good luck to you.

Answer:

The answer is Poisoning Wildlife

Explanation:

I just did the test.

What can a stem cell do that most body cells cannot do?

Answers

Since they are unspecialized, they can become any specialIzed cell in the body

Which theory ties the fields of biology and geology together?

Answers

Paleontology is the scientific field that bridges biology and geology, using geological context to understand biological evolution. It has been greatly influenced by geologists like James Hutton and Charles Lyell through their concepts of geological time and uniformitarianism, which also impacted Charles Darwin's evolutionary theory.

The theory that ties the fields of biology and geology together is called paleontology. Paleontology includes aspects of both biology, such as the study of evolution, the physiology of animals and plants, and ecological relationships, and geology, which provides the timeline through the study of rocks and fossils. This field of science allows us to understand the history of life on Earth by examining the fossil record within the context of Earth's geological history. Notable geologists like James Hutton and Charles Lyell have significantly contributed to evolutionary theory through their concepts of geological time and the principle of uniformitarianism, indicating that the processes we see today have also shaped the Earth in the past. The work of these geologists has been integral to the development of Darwin's theory of evolution and the study of paleoanthropology, which deals with the origins and development of early humans.

Bacterial flagella have a very complex structure composed of 42 distinct proteins. what is the most likely explanation for the evolution of these complex structures?

Answers

The answer is 'Exaptation'. This term describes the change in the function of a trait developed during evolution, i.e., a trait that evolved to fulfil one function, eventually serves to fulfil another function for which it was not originally evolved. It is thought that this is common in animal anatomy and behaviour. For example, bird feathers may have initially evolved for temperature regulation, but later were adapted for flight. 
Other Questions
Which communities do early colonizers form? Early colonizers result in the formation of communities. The "positive" and "negative" terms applied to reinforcement and punishment refer to MEDAAAL :DYou invest $2,000 in an account that is compounded annually at an interest rate of 5%. You never withdraw money from the account. How much money will be in the account after 4 years?, What kind of setting is expected in realistic fiction? A.The setting takes place in foreign times in a familiar place. B.The setting takes place in a modern time in an unfamiliar place. C.The setting takes place in a modern time in familiar place. D.The setting takes place in a foreign time in an unfamiliar place Nayati wants to swim 50 miles this school year. She plans to swim 1/4 mile each day. How many days will it take her to swim 50 miles. Show your work. Jane is thinking of a number between -10 and 10. if you multiply Jane's number by -2, then subtract 2, the result is greater than 6. What is Jane's number Spanish homework help please? Gatsby disappeared which other character unexpectedly arrived at lunch Explain the relationship between logical and physical design? Which of the following characterizes gothic literature? A. It centers on individuals, society, or events from the past combined with fictional characterizations. B. It's made up of letters from various protagonists. C. It pessimistically portrays selfishness, filth, and violence through characters who have no control over their destinies. D. It combines a desolate setting and mysterious events to create an atmosphere of terror. Three questions!!How would you say that someything is rather dirty-un momento-yo pongo-bastante sucio A figure has a vertex at the point (-4, -6) the figure is dilated with the center at the Irgun with a scale factor of 5 What harms did the people in the colonies suffer from imperialism? What is the equation of the line that is parallel to the line y = x + 4 and passes through the point (6, 5)? y = x + 3 y = x + 7 y = 3x 13 y = 3x + 5 In Marissa's Calculus course, attendance counts for 5% of the grade, quizzes count for 10% of the grade, exams count for 60% of the grade, and the final exam counts for 25% of the grade. Marissa had 100% average for attendance, 93% for quizzes, 86% for exams, and 85% on the final exam. Determine Marissa's course average. The ledger is a? A. Chronological record of the days transactions. B. Group of accounts that records data from business transactions.C. Took used to ensure that debits equal creditsD. Tool used to make sure that all accounts have normal balances Alacatuieste o propozitie in care : a) numeral multiplicativ intreit sa aiba valoare adverbiala b) nr. card. doi sa aiba fs. de cd) nr. colectiv amandoi sa aiba valoare adj.omplement indirect in dativc) nr. card. al doilea sa aiba fs. de CCL . Given sin x = 0.9 , what is cos x ? Enter your answer as a decimal in the box. Round only your final answer to the nearest hundredth. When a patient is dying, he or she may experience regression. this is most accurately defined as:? Kyle bought a pair of socks for $6. Last month, his friends bought the same socks for $5. What is the percent increase in the price of the socks?