Answer:
B. a place where wind energy is harvested
Explanation:
Thermal pollution kills fish primarily because _____.
all fish need cool water
fish eggs overheat
fish swim too close to pipes
warm water holds less oxygen
Answer:
Warm water holds less oxygen
Explanation:
Thermal pollution may be defined as the cahnge in the ambient water temperature that can degrade the water quality. Main cause of thermal pollution is the use of water as coolant in industries.
Thermal pollution is harmful for aquatic life. Fish and other aquatic organismsm dies because thermal pollution increases the temperature of water. This warm water has less ability to hold oxygen and fishes die due to the lack of oxygen in water.
Thus, the correct answer is option 4.
As a "rule of thumb" estimate, athletes who wish to increase muscle mass should increase daily energy intake by approximately ____ kcal.
What role do hydrogen bonds play in the dna molecule?
Final answer:
Hydrogen bonds within the DNA molecule stabilize its double helix structure, facilitate genetic fidelity, and allow for DNA replication and transcription by easily 'unzipping' due to their relative weakness compared to covalent bonds. These bonds are crucial for the DNA's stable yet flexible structure.
Explanation:
The hydrogen bonds play a crucial role in the structure and function of deoxyribonucleic acid (DNA). According to the Watson-Crick model, DNA's double helix structure is primarily stabilized by the hydrogen bonds that form between the base pairs on the opposing strands. These hydrogen bonds occur between the nitrogenous bases of nucleotides: adenine pairs with thymine through two hydrogen bonds, while cytosine pairs with guanine through three hydrogen bonds. The precise alignment and pairing ensure the double helix's stability and play a significant role in genetic fidelity during DNA replication and transcription.
Hydrogen bonds are not exclusive to interactions between DNA strands. They can also occur within a single large biomolecule, affecting the three-dimensional structure and function of proteins. It's important to note that, while strong in their cumulative effect, individual hydrogen bonds are weaker than covalent bonds. This relative weakness allows the two DNA strands to “unzip” easily during the replication process, enabling each strand to serve as a template for creating a new complementary strand.
The hydrogen bonds, along with van der Waals interactions, contribute to the DNA's shape and structure, which is essential for its function in living organisms. The cumulative effect of millions of hydrogen bonds holding the DNA strands together is integral for the molecule's stability, yet it still allows for the necessary flexibility for replication and transcription processes that are vital for life.
When westerners are asked to recall autobiographical memories, this part of their brain is activated. temporal lobe motor cortex medial frontal cortex occipital lobe?
The medial temporal lobe, including the hippocampus and amygdala, is activated when recalling autobiographical memories, and is essential for memory storage and recall.
When westerners are asked to recall autobiographical memories, a key area of the brain that becomes activated is the medial temporal lobe. This part of the brain, along with structures such as the hippocampus and amygdala, is critical for the storage of memories. The case of patient HM, who had both medial temporal lobes removed, has provided substantive insights into the role of these brain structures in memory formation and recall. Specifically, the medial temporal lobe functions as the short-term storage site for memories, which over time, may relocate to other brain areas outside of the medial temporal lobe, indicating the involvement of a network of cortical and subcortical areas in memory processing.
Which set of legs appears best adapted to carry an incubating egg mass?
Cherry cells have 32 chromosomes. how many chromosomes do each of the daughter cells produced by mitosis have?
Answer:
Each of the daughter cells has 32 chromosomes.
Explanation:
Mitosis is a process of continuous cell division where one cell gives rise to two other cells. Mitosis happens in most cells of our body. From an initial cell, two identical cells with the same number of chromosomes are formed. This is because, prior to cell division, the genetic material of the cell (on chromosomes) is duplicated.
Thus, we can conclude that if a mother cell has 32 chromosomes, with mitosis, two daughter cells of 32 chromosomes will be generated.
A one-way relationship in which one species benefits and directly hurts the other is called
Transport a victim of heat exhaustion to a medical facility if no improvement is seen within:
The Sun is the primary source of energy that drives all the biogeochemical cycles on Earth. Which statement best describes how the Sun’s energy powers the water cycle?
1.Plants require energy from the Sun to perform photosynthesis.
2.The Sun's heat reflects off ice sheets near the polar caps, reducing the overall temperature of Earth.
3.Heat from the Sun drives evaporation, turning water on Earth's surface into water vapor.
4.Energy from the Sun provides the warmth necessary for cold-blooded animals to survive.
Answer:
3. Heat from the Sun drives evaporation, turning water on Earth's surface into water vapor.
Explanation:
Water cycle starts with evaporation of water from water bodies which includes transition of water into water vapor by heat of sunlight. The water vapor rises up in the sky and gets condensed to form clouds. This is followed by precipitation and collection of water into the water bodies again through surface run off. Hence, the very first step of water cycle, that is, evaporation is driven by energy from Sun.
In a human eye, there are three types of cones that allow us to see colors. the three different types are most sensitive to red, green, and blue light, respectively. all three contain retinal bonded to a large protein. the way that retinal bonds to the protein can change the length of the potential well within which the electrons are confined. how would the length have to change from that given in the introduction to make the molecule more sensitive to blue or red light? view available hint(s)
The answer is ‘the molecule would have to be longer to be more sensitive to red light and shorter to be more sensitive to blue light.’The cones change shape and vary their length once they absorb a photon. This change is transduced, through biochemical pathways, into nerve impulse and carried to the brain.
To make the retinal molecule more sensitive to blue light, the potential well's length should be decreased. To make it more sensitive to red light, the potential well's length should be increased.
In the human eye, the three types of cones are sensitive to blue, green, and red light, corresponding to short, medium, and long wavelengths respectively. These cones contain retinal bonded to a large protein, and the way retinal bonds to the protein changes the length of the potential well within which the electrons are confined. To make the molecule more sensitive to blue light, the potential well's length must be decreased, as shorter wavelengths (blue light) require higher energy levels. Conversely, to make the molecule more sensitive to red light, the potential well's length must be increased to respond to longer wavelengths (red light) which have lower energy levels.
The greenhouse effect is caused by the burning of fossil fuels and deforestation.
a. True
b. False
Answer:
False, the greenhouse effect is not caused by the burning of fossil fuels and deforestation.
Explanation:
The greenhouse effect is not caused by the burning of fossil fuels or deforestation. It was Global warming which is caused due to the burning of Fossil fuels and deforestation.The greenhouse effect is caused by the Trap heat from the sun. the greenhouse effect is important also because without this effect the earth's atmosphere becomes too cold and may cause problems to animals, plants, and Humans.
Water would be considered a _______.
Answer:
The answer is Water is a Chemical Compound.
Explanation:
Water is a compound that is formed from the union, by covalent bonds, of two hydrogen atoms and one of oxygen; Its molecular formula is H2O and it is a very stable molecule. Water is a fairly common substance on earth, where it is mainly in the form of steam or ice. It is essential for the origin and survival of the vast majority of all known life forms.
In which kingdom are the organisms represented in the cartoon classified?
Some structures related to fungi include hyphae and mycellium. Which statement BEST explains how these structures are related?
A) Hyphae hold mushrooms and other fungi upright by attaching to a mycellium.
B) Hyphae absorb water under ground and the mycellium absorbs water above ground.
C) Hyphae are long, threadlike structures that create a network called a mycellium.
D) Hyphae absorb nutrients from the soil that the mycellium converts into carbon dioxide.
Answer:
The correct answer would be option C.
Mycelium refers to the vegetative part of a fungus which is formed by the mass of branching, thread-like hyphae.
It helps in the absorption of nutrients from the surrounding environment. The biological polymers are first converted or digested into monomers with the help of enzymes secreted by the hyphae.
These monomer units are then absorbed by the mycelium either through facilitated diffusion or active transport.
In a nuclear fusion reaction, the mass of the products is less than the mass of the reactants. What happens to this "missing mass"? A. It turns into matter. B. It turns into energy. C. It turns into antimatter. D. It turns into matter and antimatter.
Answer: Option B; it turns into energy
In a nuclear fusion reaction, two reactants combine, and form new products. But the mass of the products is less than total mass of the reactants. This is because a part of mass is lost as energy. This can be seen in an example shown below. You can see that mass is of the products is less than that of the reactants.
Suppose nicole recently learned that she inherited a mutant brca1 allele from her mother, who had breast cancer. brca1 is a tumor suppressor gene that is related to breast cancer. why would nicole be at higher risk for getting breast cancer at an earlier age than her sister, tiffany, who inherited a normal brca1 allele from their mother?
The answer is a mutation in her normal. Device of cancer caused by loss of BRCA1, BRCA2 gene function identified. BRCA1 allele may lead to cancer, while a normal individual would have to acquire two mutations (one in each allele) to develop cancer.
Answer:
Normal tumor suppressor gene controls excessive cell division
Explanation:
A normal tumor suppressor gene releases proteins that are essential to control and regulate the cell division. However, if this gene gets mutated then it may lead to uncontrolled cell division and hence forth cause cancer or tumor. Since Nicole got this mutant gene, hence her ability to suppress uncontrolled cell division does not work and hence she may get cancer as compared to her elder sister who received normal allele.
what do bottom dwelling fish,sponges and corals have in common
Bottom dwelling fish, sponges, and corals share common ecological interactions and relationships in marine ecosystems. Sponges provide shelter and nutrients to various species, including fish, while corals have symbiotic associations with algae called zooxanthellae. Bottom dwelling fish, like parrotfish, contribute to reef ecosystems through their feeding behavior, which aids in sediment production and nutrient cycling.
Which of the following is NOT a characterisitic of all plants? a They produce seeds b They have cell walls of cellulose c They are eukaryotic d They are multicellular
Rna plays important roles in many cellular processes, particularly those associated with protein synthesis: transcription, rna processing, and translation. drag the labels to the appropriate bins to identify the step in protein synthesis where each type of rna first plays a role. if an rna does not play a role in protein synthesis, drag it to the "not used in protein synthesis" bin. view available hint(s)
The three types of RNA involved in protein synthesis are messenger RNA (mRNA), transfer RNA (tRNA), and ribosomal RNA (rRNA). They play roles in transcription, RNA processing, and translation, respectively. Other types of RNA, like microRNAs and small interfering RNAs, do not have a direct role in protein synthesis.
Transcription: During transcription, a type of RNA called messenger RNA (mRNA) plays a role. mRNA carries the genetic information from DNA to the ribosomes.
RNA processing: Another type of RNA called transfer RNA (tRNA) first plays a role during RNA processing. tRNA transfers the amino acids to the ribosomes during translation.
Translation: The third type of RNA involved in protein synthesis is ribosomal RNA (rRNA). rRNA is a component of the ribosomes, where translation takes place.
Not used in protein synthesis: Regulatory RNAs, such as microRNAs (miRNAs) and small interfering RNAs (siRNAs), do not play a direct role in protein synthesis but regulate gene expression.
Learn more about Protein Synthesis here:
https://brainly.com/question/32660015
#SPJ6
An increase in the nfp would result in a(n) _______________ in the gfr.
The increase in the NFP would result in an increase in the GFR.
NFP stands for Net Filtration Pressure and GFR stands for Glomerular Filtration Rate. The two quantities are associated with the process of blood filtration and urination process in the kidney. When the blood vessels leading to the kidney expand and the blood vessels leading out of the kidney shrink, it leads to the build up of the GFR in glomerulus. This leads to the increase in the process of the blood filtration and thus increases the NFP.
If i have stress fracture of my radius bone what part of my body i have broken
What is the purpose of the coronary artery and what results if there is blockage in this vessel ? cousrse hero?
Final answer:
The purpose of the coronary artery is to supply oxygen and nutrients to the heart muscle, while blockage in this vessel can result in severe pain and potentially a heart attack.
Explanation:
The purpose of the coronary artery:
The coronary artery supplies oxygen and nutrients to the heart muscle. It branches from the aorta and surrounds the outer surface of the heart like a crown, providing a steady blood flow that keeps the heart functioning properly.
Results of blockage in the coronary artery:
If there is a blockage in the coronary artery, oxygen supply to the heart muscle is stopped. This can lead to severe pain known as angina, and if the blockage is not treated, it can result in myocardial infarction, commonly known as a heart attack. The blocked artery prevents oxygen from reaching the areas of the heart that depend on it, causing damage to the cardiac muscle tissue.
In DNA, which of the following determines the traits of an organism?
Answer: Nitrogenous Bases
Explanation:
The deoxy ribonucleic acid is made of nitrogenous bases, phosphate and deoxy ribose sugar.
The nitrogenous bases in the DNA determines the traits of the individuals which is carried from one generation to another.
These bases determines the type of protein which is produced. The A, T, G, C combines and forms triplet code and based on that protein synthesis takes place which decides the trait of the person.
Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3')? view available hint(s) where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3')? it would not bind the target dna. ttttagccatttacgattaatcg ttttagccatttacgattaatcg ttttagccatttacgattaatcg?
What did Watson and Crick’s model of DNA show?
A. two nucleotide strands wound in a double helix
B. sugars and phosphates on the inside
C. nitrogenous bases on the outside
D. a single nucleotide strand twisted in a spiral
A is most definitely the answer
you can properly find algae____
- that conduct photosynthesis
- in polar regions or hot springs
- on your dinner plate
- all of the above
You can probably find algae in d) all of the above.
Like other plants, algae have chlorophyll. There are the so-called ice algae found in the polar regions while Thermophilic algae are abundant in hot springs. Edible seaweeds found in your plate are algae also.
Genetic disorders caused by multiple genes interacting with the environment are called
Multifactorial disorder
Multifactorial disorders are disorders that involve variations in multiple genes joined with environmental causes. Diseases such as heart disease, type 2 diabetes, and obesity are multifactorial disorder as they do not have single genetic cause but are caused by a combination of environmental factors and life style with mutations in multiple genes.
Every individual, including young people, can make decisions to use resources wisely. Use the terms reduce, reuse, and recycle to explain how the students in the image above can help minimize solid waste.
Answer:
3R's i.e reduce, reuse, and recycle can help the solve the problem os solid waste
Explanation:
All solid waste that is generated at a city level can be dealt with the utilization of concept of three R’s.
First R is the reduction of waste generation; All individuals must try to reduce the waste generated at his/her level so that the total quantum of waste get reduced.
Second R stands for Reuse. All individuals must try to use the item again and again if it is in condition of being reused such as plastic containers, bottles etc.
Third R stands for Recycle. All the waste that can be recycled must be recycled so that it can be reused again without producing new items that further adds to the total waste generated.
the body loses water and satas in sweat explain why drinking large volumes of plain water after excersicing may affect the salta balance in the body
How do the number of muscles in a cow eye compare with that of a human eye, and what does this mean for each organism?