What is the direct object in the sentence?

The sailors rescued the passengers from the stranded ship.

A.
passengers

B.
ship

C.
rescued

D.
sailors

Answers

Answer 1
B. Ship- In the above sentence the direct object is the ship.

Related Questions

Which lines in this excerpt from Leo Tolstoy’s The Death of Ivan Ilyich reflects the author’s opinion that the members of the medical profession don’t really care about their patients?

A: Oh yes, my medicine." "Peter, give me my medicine." "Why not? Perhaps it may still do some good." He took a spoonful and swallowed it.
B:It's all tomfoolery, all deception," he decided as soon as he became aware of the familiar, sickly, hopeless taste.
C:…Her attitude towards him and his diseases is still the same.
D:"You see he doesn't listen to me and doesn't take his medicine at the proper time

Answers

The best and most correct answer among the choices provided by the question is the first choice or letter A.

The lines "Oh yes, my medicine." "Peter, give me my medicine." "Why not? Perhaps it may still do some good." He took a spoonful and swallowed it." from Leo Tolstoy’s The Death of Ivan Ilyich reflects the author’s opinion that the members of the medical profession don’t really care about their patients

I hope my answers has come to your help. God bless and have a nice day ahead!
Final answer:

The question seeks a line in The Death of Ivan Ilyich that shows Tolstoy's opinion of medical professionals' indifference to patients. While no quoted line clearly makes this point, option B implies dissatisfaction with medical treatment, subtly hinting at medical professionals' possible uncaring attitude.

Explanation:

The quoted lines in the question are from Leo Tolstoy’s The Death of Ivan Ilyich. None of the options distinctly show Leo Tolstoy's opinion that members of the medical profession are indifferent to their patients. However, option B: 'It's all tomfoolery, all deception,' he decided as soon as he became aware of the familiar, sickly, hopeless taste', can imply dissatisfaction or disappointment with the treatment received from the doctors which can broadly suggest a sentiment that doctors are not genuinely concerned about their patients. Yet, it is more an expression of Ivan Ilyich's subjective experience and feelings, not an explicit authorial opinion.

Learn more about Literary Interpretation here:

https://brainly.com/question/30186383

#SPJ12

HELPP I WILL UPVOTE

Read this excerpt from Journey to the Center of the Earth.

Another peculiarity of his was, that he always stepped on yard at a time, clenched his fists as if he were going to hit you, and was, when in one of his peculiar humors, far from a pleasant companion.

Who is being characterized in this passage?

Professor Hardwigg
Harry
Gretchen
Hans

Answers

The correct answer is Professor Hardwigg.
The answer would be Hardwigg.

Which types of multimedia have you previously used or created? Check all that apply.



video


audio


graphic images


slide presentations


charts and graphs


Answers

The three types of multimedia we've used or created so far use videos of volunteers singing songs, telling stories, and playing games with their seniors.

Which of the following multimedia types applies?

1 Text, images, and audio are all multimedia components.

How can multimedia help you during your research?

According to a study, one of the benefits of multimedia learning is to leverage the brain's ability to connect linguistic and visual representations of content to deepen understanding and help transfer what is learned to other situations. Is to do.

for more information on multimedia used or created earlier See

https://brainly.com/question/19538931

#SPJ2


how would you write the sentence "you need to study for english class" in spanish?

Answers

Tienes que estudiar para clase de ingles

The sentence "You need to study for English class" can be written in Spanish as "Necesitas estudiar para la clase de inglés."

How  is this so?

In this translation, "necesitas" corresponds to "you need," "estudiar" means "to study," "para" means "for," and "la clase de inglés" translates to "English class."

When translating, it is important to consider the proper conjugation of verbs and the correct word order to convey the meaning accurately in the target language.

Learn more about Spanish at:

https://brainly.com/question/24126663

#SPJ6

What important fact about Ichabod Crane comes to light in the passage? Ichabod was a just teacher who treated his students impartially. Ichabod was a good teacher who tried to do right by his students. Ichabod was a fair teacher who was misunderstood by his students. Ichabod was an unjust teacher who punished his students with prejudice.

Answers

The important fact about Ichabod Crane that comes to light in the passage is the last one - Ichabod was an unjust teacher who punished his students with prejudice.
He punished those he did not like or considered could take the blame or burden for somebody else. He chose wisely whom to punish. 

The important fact about Ichabod Crane that comes to light in the passage is the last one :

Ichabod was an unjust teacher who punished his students with prejudice.

He punished those he did not like or considered could take the blame or burden for somebody else. He chose wisely whom to punish. 

Explanation:

Ichabod Crane is a fictional figure and the protagonist in Washington Irving's short story, "The Legend of Sleepy Hollow", first written in 1820. In traditional society, this story is seldom retitled as "The Headless Horseman."According to a system by Irving and a certification written in longhand by Martin Van Buren, the 'pattern' for the cast of Ichabod Crane was based on the original Kinderhook schoolmaster named Jesse Merwin born in Connecticut whom Irving converted friends within Kinderhook, New York, in 1809.

What does the phrase "purpled thy nail" refer to in this excerpt from "The Flea" by John Donne?

Cruel and sudden, hast thou since
Purpled thy nail in blood of innocence?

an injury the speaker's beloved incurred as he wooed her

the shared blood of the speaker and his beloved in the flea

the loss of the beloved's innocence symbolized by the flea

the beloved's sudden cruel treatment of the speaker

Answers

The phrase "purpled thy nail" from John Donne's "The Flea" symbolizes the act of the beloved killing the flea, which has metaphorically commingled the speaker's and the beloved's blood, therefore staining her nail with the 'blood of innocence'.

The phrase "purpled thy nail" from the poem The Flea by John Donne is a metaphorical expression that refers to the act of the speaker's beloved killing the flea, which has metaphorically mingled their blood by biting both of them. By squashing the flea, the beloved's nail is stained with the blood of the flea, which is also considered the blood of innocence because it represents their union that the speaker is arguing for. Thus, the phrase signifies the shared blood of the speaker and his beloved in the flea, symbolizing the intimate connection that the flea has briefly created between them.

summary for poem "i am the land"

Answers

Introduction :

' I Am The Land ' is a very short and thoughtful poem written by ' Marina De Bellagenta ' . She is the famous writer throughout the Europe and popular for her feminist thoughts. She was born near Milan, Italy in 1949 .

In this poem the poetess expresses her concern on exploitation of land in excessive manner.

Explanation :

The speaker in this poem is ' the land ' itself which is concerned for her present condition. People use to say that they own the land but they aren't the owners . They also quarrels over it . The land here is mocking over their childishness. The land sustains 'new life' like plants, trees, etc. It is the support system of human beings. However, in return the land receives the domination and exploitation from human beings and feels the pressure. At the end, the land protested against such domination that says it's impossible and not right to put the mother earth into any bounds by fencing  it and choking its way.

Learn more:

1. Sentence punctuation https://brainly.com/question/1461188

2. Paradox example https://brainly.com/question/8707309

3. Inductive reasoning https://brainly.com/question/1168411

Answer details

Grade: High school

Subject: English

Chapter: Literature (Poem)

Keywords: land, poor, hungry, grass, wind, priest, pages of history, people of the world, nuns, children, poet, grass growing land sustains, mocking over their childishness, mother earth.

"I Am The Land" is a short poem wherein the artist has exemplified land and it underlines the way that man attempts to overwhelm land, however he doesn't possess it. He invests wholeheartedly in having the land, purchases and sells it. The lyric finishes with an intriguing stanza that questions 'Would you be able to fence the planet earth?  

Further Explanation:  

Introduction:

' I Am The Land ' is an extremely short and insightful lyric composed by ' Marina De Bellagenta ' . She is the well known essayist all through the Europe and prominent for her women's activist contemplations. She was brought into the world close Milan, Italy in 1949 .  

About poem:  

The speaker in this poem is ' the land ' itself which is worried for her current condition. Individuals use to state that they claim the land yet they aren't the proprietors . They additionally squabbles about it . The land here is ridiculing over their whimsicalness. The land continues 'new life' like plants, trees, etc.It is the emotionally supportive network of individuals. Be that as it may, consequently the land gets the mastery and misuse from individuals and feels the weight.  

End of poem:  

Toward the end, the land challenged such mastery that says it's unimaginable and not appropriate to put the mother earth into any limits by fencing it and stifling its direction.

Subject: English

Level: High School

Keywords: Introduction, about poem, end of poem.

Related links:

Learn more about evolution on

https://brainly.com/question/758865

https://brainly.com/question/2065713

1. The bird is losing the feathers that help to keep it warm.

Which subject agrees with the verb help?


that
feathers
bird
it

2. Each of the guests wore _____ finest clothes when attending the wedding.

Which pronoun agrees with the underlined indefinite pronoun?


his or her
their
his
its

Answers

1.feathers 2.their.  this is all
Here are the answers to the given questions above.
1. Based on the given sentence, the  subject that agrees with the verb help would be the word FEATHERS.
2. The  pronoun that agrees with the underlined indefinite pronoun would be his or her.
Hope this answers your question. 

As Aunt Alexandra settles in to Maycomb, her opinion of the trial is representative of

Answers

Aunt Alexandra's opinion of the trial is not stated in the book, however, she did mention she didn't approve of it (however, she didn't state her opinion on whether Tom Robinson is innocent or guilty), yet she was hurt when she saw the way the people of Maycomb treated Atticus. The way she kept her opinion to herself is representative of her will to censor her opinion for the well-being of Atticus and the children. Hope this helps! :)

Answer:

the people who wished Atticus would just decline to help

Explanation:

how does drama compare to film?

Answers

This is basic, but drama is live, while film is recorded. There can be connections with the audience in dramas. There's usually more (or better) intimacy in dramas. In films, intimacy is usually from a close-up view.
Hope that helped!

Explain who is most responsible for the deaths of romeo and juliet

Answers

Mercutio can be blamed, to some degree. He was the one who got Romeo to go to the ball. When Mercutio was killed, Romeo avenged his death, and ended up having to leave Verona instead of staying with Juliet.

Match the themes from Mark Twain's "The £1,000,000 Bank-Note" with the excerpts they represent.

Answers

"The fact had all gone abroad..." is rags to riches.
The quote describes how the eating house went from "being a poor, struggling...enterprise" to being "celebrated, overcrowded with customers.

"Why, it isn't six months..." is also rags to riches.
He is described at first as sitting up nights on extra allowance to being a millionaire.

"When the crash should come..." is impending doom.
The very beginning indicates that something bad (the crash) is coming. This quote also mentions total destruction.

"Please get those things off..." is rags to riches.
He literally changes his clothes from something ordinary to clothes that were made to order for a prince.

"Deep in debt, not a cent" is wealth worship.
In this quote, he is wishing for a salary that may never materialize.
Final answer:

Mark Twain's 'The £1,000,000 Bank-Note' touches on themes of self-reliance, economic disparity, and personal growth. These themes are evident through the conflicts Twain's characters face and the vivid descriptions used to emphasize key messages within the narrative.

Explanation:

The student's question involves matching themes from Mark Twain's The £1,000,000 Bank-Note with specific excerpts from the text. From the provided information, we can determine several themes related to the conflicts and messages present within Twain's work. We can analyze each excerpt for its thematic content and directly relate it to a theme.

Themes and ExcerptsSelf-doubt versus self-reliance: The conflict arises when Twain's character starts to second-guess his abilities in the face of others' influence. This reflects the theme that it is essential to trust one's own knowledge and training instead of succumbing to fear.Social commentary on economic systems: Imagery of Confederate banknotes and descriptions of the hardships faced by workers illustrate themes surrounding the economic struggles and disparities of the era.The transformative power of experience: The vivid descriptions provided by Twain as he learns to pilot a steamboat serve to immerse the reader in the experience and suggest that personal growth often comes from direct engagement with challenges.

By interpreting these excerpts, we can see how Twain used his literature to explore themes such as personal growth, trust in one's abilities, and criticism of social and economic systems. These themes are prevalent not only in The £1,000,000 Bank-Note but across many of his works.

Learn more about Themes in Twain's Work here:

https://brainly.com/question/8227317

#SPJ3

In literature, symbolism is the use of a word to represent something else such as an idea. true or false.

Answers

True, although it can be more than one word.
True! Symbolism can be a word, a character, etc. to represent a concept. I hope I helped! :)

eulogy speech about decaying animals

Answers

Final answer:

The subject of decaying animals primarily pertains to the biological process of decomposition, where scavengers and decomposers play crucial roles in nutrient cycling and disease control in ecosystems.

Explanation:

The question touches on the role and significance of the decomposition process in the ecosystem, particularly focusing on how decomposers and scavengers contribute to nutrient cycling and disease control by consuming the remains of dead animals. This natural process, while often viewed in a negative light, plays a critical role in maintaining ecological balance. The examples provided range from the historical and cultural perspectives on decay, such as the Zoroastrian practice of leaving dead bodies to decompose naturally, to the ecological roles of scavengers and decomposers in preventing diseases and recycling nutrients back into the earth.

The discussion can extend into the importance of these processes in different contexts, including the symbolic significance of decay in human cultures, the ecological necessity of decomposition, and the practical applications of understanding these processes in fields such as forensics and environmental science.

Which sentences are punctuated correctly? Check all that apply.
a.The circus featured four clowns, three acrobats, and a tightrope walker.
b.We will bring a flashlight, sleeping bags and a tent on the camping trip.
c.The recipe calls for two eggs; a cup of flour; salt and baking soda.
d.I wrote poems about my best friends, the queen of England and the tooth fairy.
e.The flags are blue and white; red, white, and blue; and red, white, and green.

MORE THEN ONE AWNSER!!! :)

Answers

A-The circus features four clowns, three acrobats, and a tightrope walker.
E-The flags are blue and white; red, white, and blue; and red, white, and green.

The answer to your question would be that the sentences that are punctuated correctly are the following ones: The circus featured four clowns, three acrobatas, and a tightrope walker and the flags are blue and white; red, white and blue; and red, white, and green. That is, your answers woud be A and E.

The comma used in these sentences is known as the Oxford comma. This comma is the final comma in a list of things. The use of the Oxford comma is up to you. Still, omitting it can cause misunderstandings, such as in D.

d) I wrote poems about my best friends, the queen of England and the tooth fairy

D is understood as if the speaker's best friends were the queen and the tooth fairy.

Why did Churchill replace Chamberlain as Britain's new prime minister shortly after World War II began?

Answers

Because Chamberlain was diplomatic instead of forceful with Hitler

There should have been options to choose from for this question. I found the options elsewhere and the correct answer would be because Churchill had a better understanding of the situation with Hitler than Chamberlain did.

Churchill knew that diplomacy would not work with Hitler and the only way to reach a resolution was through military force and tactics.

. It is fortunate that you are able to fix the faucet because we need to use the water. Does anything need fixed in this sentece? It is fortunate that you are able to fix the faucet because we need to use the water. Does anything need fixed in this sentence?

Answers

The sentence "It is fortunate that you are able to fix the faucet because we need to use the water. " looks great just as it is to me.

Thank you for posting your question here at brainly. I hope the answer will help you. Feel free to ask more questions.

The sentence should be corrected by changing 'need fixed' to 'need to be fixed'. The revised sentence reads: 'It is fortunate that you are able to fix the faucet because the water needs to be used.'

The sentence 'It is fortunate that you are able to fix the faucet because we need to use the water.' is generally correct, but it can be improved for clarity. The main issue is the use of the phrase 'need fixed' which is a regional dialect. The correct phrase should be 'need to be fixed'. Therefore, the sentence should read: 'It is fortunate that you are able to fix the faucet because we need to use the water.' To fix this, change the phrase to: 'It is fortunate that you are able to fix the faucet because the water needs to be used.'

According to "The Philosophy of Composition," which of these approaches to writing would Poe think is best?

A.Starting in the middle and working forward and backward from there

B.Writing the opening first and making it the stanza with the greatest effect

C.Writing the climax first and establishing the rhythm and meter

D.Starting with an outline of the poem before writing any stanzas

Answers

According to "The Philosophy of Composition," this one C.Writing the climax first and establishing the rhythm and meter best approaches to writing would Poe.

Someone who talks constantly about nothing very significant or in particular is best described as

Answers

I'm thinking the word you're looking for is irrelevant

Which statement best conveys the central idea of this excerpt from act IV of Romeo and Juliet?

Juliet is willing to trust Friar Laurence to reunite her with Romeo.
Juliet wants to defy her family by killing herself.
Juliet is willing to face her worst fears to be with Romeo.
Juliet believes death is the only way to remain faithful to Romeo.
NextReset

Answers

Juliet is willing to trust Friar Laurence to reunite her with Romeo.

The correct answer is "Juliet is willing to trust Friar Laurence to reunite her with Romeo."

In act IV, Juliet confesses Friar Lawrence that she would kill herself before marrying Paris, showing him a knife. After Friar Lawrence is convinced about Juliets determination to be with Romeo, he offers her a sleeping potion that will make her look as she were dead. Under this estate, she would be transferred to the Capulet tomb, where Romeo, after receiving the message, will retrieve her and they could both escape and live happily. She immediately accepts this offer.

What type of verse form is used in Walt Whitman's "I Hear America Singing" and in Langston Hughes's "I, Too"?
1. heroic couplet
2.free verse
3.blank verse
4.sonnet
4. haiku

Answers

Looking comparatively at the poems I would say:

3.blank verse

Which branch of musicology approaches music from a scientific or philosophical perspective?

music theory

systematic musicology

historical musicology

ethnomusicology

Answers

systematic musicology is the branch 

why do you think sir gawain flinched when the green knight brought his ax down but the green knight did not flinch when he was in the same position?

Answers

Because the green knight knew that he would not die, and Sir Gawain knew he would die if the axe was brought down upon him.

Answer:

Hi! I'm afraid your question is incomplete, you don't mention which text are you talking about, nor even the author. Anyways, I did a little research on the Internet and I found out that this tasks refers to a text called Sir Gawain and The Green Knight, written by the so called Pearl-Poet. I'll try to give a precise answer with the information I found.

I think that Sir Gawain flinched when the Green Knight brought his axe down because he was afraid he could die, but the Green Knight did not because he knew he wasn't going to die.

Explanation:

The reason for Gawain's behaviour was his fear; he knew he could die if he was touched by the axe. On the other hand, the Green Knight knew he couldn't, so he was fearless. The Green Knight was testing Gawain, he didn't care about the axe because he knew it couldn't hurt him.

Scrooge asks himself, “Was it a dream or not?” Does he think it is or isn’t? Explain your answer and cite examples from the text.

Answers

This is a question that Scrooge asks after the visit of each ghost. Scrooge is not sure but after the Ghost of Cheistmas past, Scrooge accepts that there is more to his experiences than simply a dream.

I hope my answer has come to your help. God bless and have a nice day ahead!

Which of the following would most likely be an entry in a sentence outline? A. Education as a tool B. Education beyond high school versus education beyond college C. Education as a pathway D. Education can change a person's life.

Answers

D. Education can change a person's life.

"Education can change a person's life" would most likely be an entry in a sentence outline.

There exist two types of outline classification in English grammar. On the one hand, the topic outline, and on the other hand, the sentence outline. The main difference between this two types of outline is that while the expression in the topic outline is mainly a phrase or a word, the sentence outline headings consist of one complete sentence containing a subject along with a predicate.


a culture where men and women share equal responsibility for household chores would most likely be considereda) competitive b) transgender c) individualistic d) cooperative e) collectivist

Answers

---------------cooperative
d) cooperative
-----------------------------------------------
A culture where men and women share equal responsibility for household chores would most likely be cooperative 

What is elisa's reaction after the stranger leaves in the chrysanthemums?

Answers

Final answer:

Elisa's reaction after the stranger leaves in "The Chrysanthemums" is a combination of excitement and disappointment. She initially feels seen and appreciated but becomes disheartened and rejected when the stranger refuses her offer. His departure leaves her longing for a connection.

Explanation:

In "The Chrysanthemums," Elisa's reaction after the stranger leaves is a combination of excitement and disappointment. Initially, Elisa is thrilled by the stranger's interest in her chrysanthemums and his compliments. She feels seen and appreciated. However, when the stranger rejects her offer to give him some of the chrysanthemum sprouts, she becomes disheartened and feels rejected. The stranger's departure leaves Elisa feeling empty and longing for a connection that she did not receive.

In "The Chrysanthemums" by John Steinbeck, Elisa's reaction after the stranger leaves is a mixture of disappointment, realization, and a subtle sense of empowerment.

Initially, Elisa is intrigued and excited by the stranger's interest in her chrysanthemums, as it offers her a rare opportunity for connection and validation of her passion for gardening.

However, when she realizes that the stranger merely sees the chrysanthemums as a means to an end – a gift for someone else – her enthusiasm wanes, and she feels deflated.

This encounter serves as a catalyst for Elisa's introspection, prompting her to confront the limitations of her role as a woman in society and the lack of fulfillment in her life.

Although she experiences a sense of disillusionment, Elisa also gains a newfound awareness of her own desires and the possibility of pursuing a more fulfilling existence beyond the confines of her domestic sphere.

Alliteration, repetition, parallelism, metaphor, and allusion are which of the following? Select all that apply.

literary as well as rhetorical devices
ways of adding meaning or emphasis in writing
elements of historical and cultural context
elements of grammar

Answers

Alliteration, repetition, parallelism, metaphor, and allusion are the following:

Literary as well as rhetorical devices.Ways of adding meaning or emphasis in writing. Elements of grammar.

Alliteration, repetition, parallelism, metaphor and allusion are rhetorical devices. They are used by the author in order to add meaning and convey a message. These are also elements of grammar.

Alliteration- intentionally repeating the same letter or sound at the beginning of various words. Repetition- repeating words or phrases throughout a textParallelism- using the same sentence structure several timesMetaphor- stating something in words of another thingAllusion- indirect reference

Answer:

Literary as well as rhetorical devices.

Ways of adding meaning or emphasis in writing.

Elements of grammar.

Explanation:

Since they are used to convince the reader of something, they are rhetorical devices.

Since they are repeating the same word, sound or letter, this helps creates emphasis

Finally, this is obviously grammar, i mean common.

One reason Virgil is qualified to guide Dante on his decent through hell is because he...

a) had described Aeneas' journey to the underworld

b) is a pagan

c) knows the way through all three regions of the afterlife

d) can pay the ferryman Charon

Answers

I believe it is A because B was incorrect.


Answer:

a) had described Aeneas' journey to the underworld  

Explanation:

Dante picks Virgil as his guide for the underworld since he realized Dante was a regarded author and trusted individuals would consider his words astutely.

The setting in Dante's story resembles an augmentation of the Aeneid in Virgil's book six of a similar name. So one reason Virgil is fit the bill to control Dante on his plummet through descent is that he had portrayed Aenea's voyage to the underworld.

Which is a disadvantage of speaking? A. It takes time to organize your thoughts and words. B. The words and ideas are short-lived and disappear quickly. C. You get immediate feedback from your audience. D. The audience isn't able to ask you any questions.

Answers

The answer best fit for this question would be D. "The audience isn't able to ask you any questions."
A. That's not a bad thing to organize yourself and message

B. Some words live on for a long long time (eg: Martin Luther King's "I have a dream speech"). Not all speeches are the same of course

C. Not a bad thing to get feedback

D. This seems like the only possible drawback. When you're speaking, the audience can't ask questions

So that's why I'm thinking the answer is D
Other Questions
Marvin is trying to finish 1/2 of his test every 2/3 hour. How many hours will it take Marvin to complete his whole test List the integers between the square root of 15 and the square root of 48 ? Why is radium valuable what is 3400 as a decimal answer asap Solve the given differential equation dN/dt=kN, (k=constant) ...? The trash, located by the sink, is always taken out at least once a week to keep the kitchen from smelling. What is the dangling modifier in this sentence? Given the ip address 192.168.112.0. each network requires between 35 and 60 hosts. what is the broadcast address of the first available subnet? 30 POINTS DONT ANSWER IF YOU DONT KNOW THE ANSWER FOR SUREIn the gene TATTCATTGTTATGATTTATTCG, CATTGTTA encodes for pepsin, a digestive enzyme. The rest of the sequence doesnt code for any protein. Which sequence contains a mutation that will affect the formation of pepsin?A. TATTCATTCATTATGATTTATTCGB. TATTCATTGTTATGACTTTATTCGC. TATTCATTGTTATGATTTATTGGCGD. TATTCATTGTTATGATATTCGE. TGCATTCATTGTTATGATTTATTCG A box is given a push so that it slides across the floor. How far will it go, given that the coefficient of kinetic friction is 0.15 and the push imparts an initial speed of 3.5m/s? When was the u.s. constitution written? what is bulimia? can someone explain it to me. Which items describe people's interactions with their environment?Technology does not affect the earth's environment.People adapt to their environment.People adapt their environment.Population growth and the environment are unrelated.Changes to the earth's environment rarely matter.Changes to the earth's environment can be harmful.Changes to the earth's environment can be beneficial. Choose the sentence that has the correct form of the verb ser. Ellas es muy inteligentes. Clara no es cubana. Nosotros son amigos. Yo eres serio. A rate that describes how much smaller or larger the scale drawing is than the real object Write 6% as a decimal. There are two main functions for polysaccharides in living things. Discuss these two functions, and how the structures of polysaccharide molecules support these functions.Now I know that all polysaccharides are made up of the same monomer, glucose. Is this question essentially asking me the use of glucose throughout different organisms? Which of the following represents the graph of f(x) = 2x + 2? algebra help?write a function rule for the area of a triangle with a base of 3 cm greater than 5 times its height. what is the area of a triangle when its height is 6 cm? 6 letter word: a stack of thylakoids in a chloroplast Explain how the powers of the Supreme Court and federal law were extended by significant court cases during the period