What is the main reason that the Constitution did not proclaim that all men were born free and equal in their rights?

Answers

Answer 1
Some states still had slaves, and would not of ratified the constitution if it said all men were born free and equal 
Answer 2

It is said that the founding fathers of the country were most likely slave owners, including George Washington himself. It is also said that the Southern States opposed to such a thing to be added in the constitution and the Founding Fathers couldn't risk losing their support.


Related Questions

Scientists in ancient Greece believed that

the study of science was connected to feeling and emotion.
the study of science was connected to magic and mysticism.
everything in the world could be explained by logic and reason.
everything in the world could be explained by faith and religion.

Answers

Everything in the world could be explained by Logic and reason.

I believe the answer is: Everything in the world could be explained by Logic and reason.

This belief later adopted by other countries in Europe led to the age of enlightenment, when people start to abandon superstition and start to pursue scientific knowledge to address the problems that people have.

Inventions to make people's life easier and the creation of social system that transfer the power from the monarchs to the people start to gradually arise ever since.

Freedom of speech disappeared during WW I for anyone critical of the war effort.


True Or False? ...?

Answers

True, freedom of speech disappeared during WWl for anyone critical of the war effort.
For example, the Choctaw code talkers (Native Americans that helped in communication so the enemy couldn't decipher what American troops' orders were) were heavily guarded and were ordered to commit suicide should capture be inevitable. Their purpose left them confined.

1. Which of the following effects of the French and Indian War most contributed to smuggling in the colonies? (1 point)

increased taxes from the crown
enforcement of the Navigation Acts
presence of British soldiers in the colonies
removal of the Spanish from Florida

2. Which economic system did British policies after the French and Indian War support? (1 point)

mercantilism
free market
command
traditional

Answers

1. The enforcement of the Navigation acts

2. Mercantilism

Which of these was a DIRECT result of the failed slave revolt of Nat Turner in 1831?
A)
Southern legislatures reexamined the moral foundation of keeping millions of blacks as slaves.
B)
Congress passed a law that would phase out the importation of African slaves in the coming decade.
C)
Laws greatly restricting the legal rights of free blacks and slaves were passed throughout the South.
D)
President Lincoln dedicated the remainder of his presidency to eliminating slavery from the United States. ...?

Answers

C)

Laws greatly restricting the legal rights of free blacks and slaves were passed throughout the South.

The direct result of the failed slave revolt of Nat Turner in 1831 was that laws greatly restricting the legal rights of free blacks and slaves were passed throughout the South.

Nat Turner's Rebellion, also regarded to as the Southampton Insurrection, constituted a slave rebellion that occured in Southampton County, Virginia, in August 1831, conducted by Nat Turner. Rebel slaves murdered from 55 to 65 people, at least 51 being white.

If a central government runs a nation, it is called a

Answers

Democratic government. 

A unitary government is one of the forms of government. In this form of government, a state is administered as a separate entity in which the supreme authority lies in the hand of the central government. In the Unitary government, the central government can form (or eliminate) regulatory divisions. Such units operate only the authorities that the central government fancies transferring.

Which Mongolian leader seized control of the Chinese Empire, ruled the Yuan Dynasty, and promoted trade along the Silk Road?
A: Khabul Khan
B: Kublai Khan
C: Genghis Khan
D: Altan Khan

Answers

The answer to your question is B

which statement best describes the unique qualities of islamic art

Answers

Are there any options?

Answer:

It uses natural motifs in religious art.

Explanation:

Artists avoided picturing God or Muhammed. Calligraphy and geometrical shapes, arabesques, and/or flowered patterns added beauty to their works.   The Muslim style of religious art used in mosques was decorated with elaborate abstract, geometric patterns. Human and animal figures were used in non-religious art.

The economies of the western african civilization of ghana,mali and songhai relied on

Answers

The economies of the western African civilizations of Ghana, Mali, and Songhai relied on: trans-Saharan trade routes.

The correct option is (D).

The western African civilizations of Ghana, Mali, and Songhai flourished during the medieval period, between the 9th and 16th centuries. These civilizations were situated in the Sahel region of West Africa, strategically positioned along the trans-Saharan trade routes. The trans-Saharan trade routes facilitated the exchange of goods, commodities, and ideas between West Africa and North Africa, as well as with the Mediterranean and Middle Eastern regions.

The economies of Ghana, Mali, and Songhai were heavily dependent on the trans-Saharan trade routes for their prosperity and development. These civilizations controlled key trade centers and benefited from the trade of gold, salt, ivory, slaves, and other commodities. Gold, in particular, was a highly prized commodity exported from West Africa to North Africa and beyond, while salt was imported from North Africa to West Africa to meet the region's dietary and economic needs.

The wealth generated from trans-Saharan trade allowed these civilizations to establish powerful empires and engage in cultural, artistic, and architectural achievements. It also facilitated the growth of urban centers, the development of sophisticated trading networks, and the accumulation of political and military power.

complete question given below:

The economies of the western African civilizations of Ghana, Mali, and Songhai relied on

A. industrial growth

B. shipbuilding

C. textile production

D. trans-Saharan trade routes

How did the industrial revolution lead to imperialism

Answers

The technological advances of theIndustrial Revolution caused an increased need for raw materials that encouraged the rise of European imperialism. The colonies also provided captive markets for manufactured goods.
Final answer:

The Industrial Revolution led to imperialism as industrialized countries sought raw materials and markets for their goods. Technological advances in transportation and communication enabled these nations to conquer and colonize regions in Africa, Asia, and the Pacific, establishing colonial empires and dominating international trade.

Explanation:How the Industrial Revolution Led to Imperialism

The Industrial Revolution marked a period of major industrial expansion that began in Europe in the late 18th century and spread to other parts of the world. This transformation led to the Second Industrial Revolution, which saw the development and spread of technological innovations such as modern steel, electrical generators, and new means of transportation and communication. These technologies created an unprecedented demand for raw materials like rubber, mineral ores, and cotton; materials that were often located in regions outside of the industrializing countries.

Industrialized nations, including Britain, France, and the newly emerging Germany and the United States, sought to secure a consistent supply of these crucial resources. In their search for raw materials and new markets for their mass-produced goods, European nations engaged in imperialism, conquering and colonizing regions across Africa, Asia, and the Pacific. Advancements in transportation, communication, weaponry, and medicine facilitated the imperialistic practices of these nations as they established colonial empires to extract resources, find new markets, and sometimes spread Western culture and Christianity.

Furthermore, the output of factories produced more goods than European consumers could purchase, necessitating the search for new markets. The combined need for raw materials and new markets, along with the technological capability to reach and control distant territories, empowered these nations to establish and maintain overseas empires, creating an international system dominated by Europe.

Learn more about Industrial Revolution and Imperialism here:

https://brainly.com/question/26300026

#SPJ6

The wording of the Constitution is...

Answers

The wording of the Constitution is intentionally vague for it to allow the document to survive changes in society.

I wish you the best of luck~ Sans
Final answer:

The U.S. Constitution is a brief document that serves as a blueprint for how the American government operates and the Preamble, articles, and amendments are different parts of it.

Explanation:

The U.S. Constitution is a brief document that serves as a blueprint for how the American government operates. The Preamble sets the tone for the Constitution, outlining the purposes of government. The articles divide the government into its three branches - legislative, executive, and judicial - and outline the system of federalism. The amendments allow for formal changes to the Constitution. Overall, the Constitution is a living document that incorporates both ideas from previous governments and uniquely American concepts.

(1) All of the following were reasons why the American colonists were angry with the England during and after the French and Indian War EXCEPT

A.the British government ordered the British Army to permanently seize land from the colonists in order to pay for war expenses.
B.the British government forced colonists to feed and house British soldiers.
C.the British Army impressed many colonists into military service.
D.British soldiers ridiculed the skills of the colonial militias.



(2) Why did many consider the Native Americans to be to the most negatively affected by the French and Indian War?

A.They all fell under the control of the Iroquois Confederacy and were forced to bow down to the demands of the British.
B.The French had abandoned them to the British and they were forced to make a pact with Spain.
C.They lost their French allies and trading partners in the Great Lakes and were even more divided after the war.
D.The British force them to signed a treaty handing over the lands of the Great Lakes to the American colonists.

(3) Why did the English government begin to directly tax the North American colonies after the French and Indian War?

A.England had a large war debt and was overwhelmed by the high cost of administering the colonies
B.England felt that is was time for the colonists to get used to being directly taxed.
C.The Parliament felt that taxing the colonists would help the colonial economies.
D.The king wanted to punish the colonists for their not cooperating during the war.

Answers

Answer:

lemme help you out

Question 1: A

Question 2: C

Question 3: A

Explanation:

Final answer:

After the French and Indian War, the colonists were not permanently stripped of their land to pay war debts, making option A the incorrect choice. Native Americans suffered greatly post-war, losing allies and trade partners. England taxed the colonies to address war debts and administrative costs.

Explanation:

The reasons why American colonists were angry with England after the French and Indian War are nuanced and multifaceted. First, the British government did order colonists to feed and house British soldiers, known as quartering, which was burdensome and intrusive. Secondly, the British Army was known to belittle the skills of the colonial militias, which created resentment. However, the British government did not order the British Army to permanently seize land from colonists to pay for war expenses, which is the incorrect option (A) among the given choices. As for the British Army impressing colonists into service, while impressment was more commonly associated with the British Navy, there is less direct evidence of widespread impressment by the Army during this period.

Many consider the Native Americans to be the most negatively affected by the French and Indian War because they lost their French allies and trading partners, leaving them even more divided after the war (option C). With the French gone, they had fewer options for alliances and trade, which weakened their position.

The English government began to directly tax the North American colonies after the war largely because England had a large war debt and was overwhelmed by the costs of administering the colonies (option A). Taxes like the Stamp Act and the Townshend Acts were imposed to help pay for these expenses, leading to growing resentment among the colonists who had no direct representation in the British Parliament.

What group of people served in the Tribal Assembly?

A. women
B. slaves
C. plebeians
D. patrician

Answers

The correct answer is C.

the founding fathers felt it was important that the government:
A. established a natural religion.
B. protected the rights of the majority. not the minority.
C. was representitive.
D. told people what to do.

Answers

C. Freedom of Religion, so can't be A. They believed in protecting all people So not B. And they don't think it was a good thing to tell people what to do. Can't be D. So C is the answer.

The correct answer is C) was representative.

The founding fathers felt it was important that the government was representative.

The founding fathers of the United States were businessmen, writers, leaders, and plantation owners that united the American colonies to fight for liberty and independence from England. They elaborated important documents that were the foundation of the country. Among the main founders were Thomas Jefferson, Benjamin Franklin, Alexander Hamilton, George Washington, Samuel Adams, James Madison, John Jay, and John Adams. They considered that it was important that the new, independent government was representative.

. What did ancient Mesopotamia offer early people that encouraged them to settle and build civilizations?
A) abundant plant and wildlife
B) natural barriers against attack
C) rivers and fertile land
D) valuable mineral resources

Answers

The best and most correct answer among the choices provided by the question is the third choice or letter C.

Rivers and fertile lands were what ancient Mesopotamia offer early people that encouraged them to settle and build civilizations.

I hope my answer has come to your help. God bless and have a nice day ahead!

Answer:

c

Explanation:

that is what I got on the test

laborers who built the central Pacific Railroad were immigrants from what country

Answers

China my dude.....................

Answer:

China

Explanation:

what other cultures influenced minoan civilization

Answers

The only culture that influenced the minoan civilization was Egypt and their influence was in early art, and, later, export trade. I hope this helps.

Answer

Ancient Egypt and Mesopotamia

Explanation

The Minoans were a people of Eastern Mediterranean origins who settled the island of Crete. They were olive-skinned. That is  they were not black i.e Not Africans.. Their Civilization Originated in Europe Their commercial contact with ancient Egypt and Mesopotamia undeniably influenced their own culture, and the Minoan civilization in turn appeared as the forerunner of the Greek civilization. With their unique art and architecture, and the spread of their ideas through contact with other cultures across the Aegean, the Minoans made a significant contribution to the development of Western European civilization as it is known today.

The following text refers to a book used by the ancient Egyptians. What does this book suggest about Egyptian beliefs?

"To survive the dangerous journey through the underworld, Egyptiabs relied on the Book of the Dead. It containe spells, charms, and formulas for the dead to use in the afterlife."

Egyptians believed in a sage, comfortable afterlife
Egyptians believed their efforts in life had little or no effect on the afterlife
Egyptians believed that time had no reality in the afterlife
Egyptians believed that charms protect people in the afterlife

Answers

I believe that the Egyptians was people who believed in magic

Answer:     Egyptians believed that charms protect people in the afterlife

Explanation:  The Book of the Dead is a collection of spells that, according to the Egyptian belief, help the deceased on his way through the underworld to eternal life, light. The content of the book, that is, the collection of charms and magic spells, presents the funeral texts that were painted earlier in the coffins and on the pyramids, that is, in the tombs. After collecting these funeral texts, a book of the dead was made, which when buried, would be put together with the deceased in a coffin.

Which of the following describes the encomienda system set up by the Spanish? A system allowing landowners to grant portions of their land to the slaves who worked it after a certain amount of time had passed A system that allowed officials to take care of Indians in exchange for labor, but often became enslavement A system that imported African slaves to farm tobacco plantations in the North America A system that rewarded certain Native American slaves who performed well by granting them pardons

Answers

Answer:

B on FLVS

Explanation:

Just did the assignment

When the Nubian civilization lost control of ancient Egypt and moved to Meroë, the Nubians retained many Egyptian cultural influences in the areas of art and architecture. They stopped using Egyptian hieroglyphics, however, and developed their own alphabet script for the Meroitic language instead. How does this compare to what happened when the Bantu peoples moved south of the equator?

Answers

It's a bit different because while the Nubians kept the culture, they developed their own language. Unlike them, the Bantu people retained their language, but they developed their culture further.

Which of the following explains an incentive for an indentured servant to come to America?
Answer
A:overpopulation in the New World
B:scarcity of resources in the New World
C:high wages for labor in New World
D:opportunity for passage to America

Answers

An incentive for an indentured servant to come to America would be the opportunity for passage to America. They would sign a contract and would agree to work in Virginia for a set number of years.

The one which explains an incentive for an indentured servant to come to America is opportunity for passage to America Option(d) is correct. There are numerous interior prizes, for instance, taking part in exercises can fulfill individuals' pride and bring them sure feelings.

What is an incentive?

By and large, incentives are whatever convince an individual to change their way of behaving.

Incentives can be separated into two classifications; inborn incentives and extraneous incentives. The inspiration of individuals' conduct comes from the inside. In exercises, they are much of the time persuaded by the actual errand or the inner award as opposed to the outer prize.

A characteristic incentive is the point at which an individual is spurred to act with a specific goal in mind for their very own fulfillment This implies that when an individual is naturally, they play out a specific undertaking to satisfy themselves and are not looking for any outside remuneration, nor confronting any outer strain to play out the errand.

Then again, an extraneous incentive is the point at which an individual has outside pressure convincing them to act with a certain goal in mind. The outer tension could incorporate either a prize for following through with the responsibility or could be a type of discipline or result in the event that the errand isn't finished.

Therefore Option(d) is correct.

Learn more about Incentive here:

brainly.com/question/12530175

#SPJ2

What institutions of European society were brought to the Americans by European missionaries?

Answers

Parishes, schools, hospitals, religion, language, culture, and government

Over which area inside the church is bernini's baldacchino placed?

Answers

I would suggest posting this again :)

Why did Germany strongly oppose the terms of the Treaty of Versailles?

The terms outlined severe economic consequences for Germany.
The United Nations had not gained the support of its member nations for this treaty.
Objection stemmed from the fact that the United States would not ratify the treaty.
Germany denied its use of submarine warfare during World War I.

Answers

The terms outlined severe economic consequences for Germany.

One of those conditions was they had to pay severe reparations (ie a lot of money) to the winning side. 

Option 1: The terms outlined severe economic consequences for Germany.

Germany agreed to sign the Treaty of Versailles in June 28, 1919, because it had no other option at the moment, but it demanded terms that outlined severe economic consequences for them.

The treaty set Germany as the aggressor and responsible in the war and consequently, it was demanded to pay for the losses and damage caused to the Allies, the winning side, in the WWI (1914-18).

Germans also had to cede the territories they had obtained during the war, which reduced Germany's population and territory by about 10 percent, and they were demanded a series of measures aiming to prevent that they never again pose a military threat to the rest of Europe, such as the restriction of its army to 100,000 men, the elimination of the general staff, the manufacture of armored cars, tanks, submarines, airplanes, and poison gas was, etc.

The restrictions imposed on Germany, along with other punitive actions, contributed to weakening Germany's economy severely.

Which of the following best completes the chart?(chart is in the comments ^__^)
A. Persian language and culture
B. Egyptian language and culture
C. Babylonian language and culture
D. Greek language and culture

Answers

The best and most correct answer among the choices provided by your question is the fourth choice or letter D.

The information that best completes the chart, under the Byzantine Empire, is the "Greek language and culture."


I hope my answer has come to your help. Thank you for posting your question here in Brainly. We hope to answer more of your questions and inquiries soon. Have a nice day ahead!

Answer:

Greek language and culture

Explanation:

What was NOT one of the major factors of the victory of America in the Revolutionary War?

the courage of the Continental soldiers,
the leadership of George Washington,
aid from foreign countries,
or the superior training of the Continental soldiers?

Answers

the one that was not a major factor of the victory of America in the revolutionary war is :
The superior training of the continental soldiers
Most of the continental soldiers had very little training and experience when they join the revolutionary war

hope this helps

The superior training of the Continental soldiers was not one of the major factors of the victory of America in the Revolutionary War.

Which of the following events immediately followed the Battle of San Jacinto?
A. Sam Houston surrendered to Santa Anna.
B. Santa Anna signed a treaty with Texas.
C. Mexico annexed Texas and took it over.
D. Texas was annexed by the United States.

Answers

Answer:

B

Explanation:

Edge 2021

The event that immediately followed the Battle of San Jacinto was that Santa Anna signed a treaty with Texas. Therefore, option B is correct.

The Battle of San Jacinto was the decisive battle of the Texas Revolution. It was fought between the Texan army, led by General Sam Houston, and the Mexican army, led by General Santa Anna, on April 21, 1836. Under the command of General Samuel Houston, the Texan Army fought and swiftly routed the Mexican army under General Antonio López de Santa Anna.

On April 25, 1836, General Houston penned a thorough, first-person account of the combat from the Texan Army's headquarters in San Jacinto. There have been many subsequent secondary analyses and interpretations.

The battle resulted in a victory for the Texan army. Santa Anna was captured, and on May 14, 1836, he signed the Treaty of Velasco, which granted Texas its independence.

To learn more on Battle of San Jacinto, here:

https://brainly.com/question/29361525

#SPJ2

The Sumerians of Mesopotamia were the earliest known civilization. They have been given credit for inventing the cart, the wagon, the chariot, and a new type of pottery. All these inventions are related to which general invention?

Answers

The answer to your question is the wheel. The cart, wagon, and the chariot all contain a wheel to function. The pottery wheel was also one of these examples.


Answer:

The Wheel

Explanation:

According to the archaeologist, the wheel was first used by Mesopotamian in 3500 BC. The earliest wheel was used in pottery making, later it was used in the chariot in 3200 BC. The Sumerians used the wheel for carrying goods and from one place to another. Sumerians also used the wheel in battles where chariots were pulled by donkeys.

what were the social characteristics of colonial Latin America

Answers

They established major cities, and treated the natives with no respect.

Final answer:

Colonial Latin America's social structure was based on a caste system dominated by peninsulares and criollos, leading to a strongly divided society with a wealthy elite and marginalized lower classes. The legacy of colonial social systems is still evident today, with persistent inequalities in wealth and land distribution.

Explanation:

Social Characteristics of Colonial Latin America

The social structure of colonial Latin America was deeply stratified by race, class, and ancestry. At the pinnacle of this social class system were the peninsulares, Spaniards born on the Iberian Peninsula, who held key government and church positions. Below them were the criollos (creoles), people of European descent born in the Americas, who were primarily the local landed elite and merchant class. The social hierarchy followed with mestizos (mixed European and indigenous ancestry), indigenous people, and Africans and their descendants, who occupied the lower social echelons.

Haciendas, plantations, and mines were the mainstay of the colonial economies, and these institutions perpetuated a dual-class system with a small wealthy class and a large impoverished working class. Post-independence, the lack of significant change in the social order meant that the descendants of colonial elites maintained their power and wealth, while the poor remained marginalized. The repercussions of these colonial social systems are still evident in modern Latin American societies.

Colonial rule also led to urban developments and the establishment of rural estates geared towards enriching the colonizers, often at the expense of the indigenous population. This created a legacy of inequality and development that varied greatly across regions, with many rural areas continuing to struggle with isolation and poverty today.

The first time that representatives from all the thirteen colonies met together was at the

Answers

First Continental Congress, I believe

Based on the Tokugawa Laws of Japan and in 1634, how did the Tokugawa government in Japan view foreigners?

Answers

Final answer:

The Tokugawa government in Japan viewed foreigners with suspicion and implemented strict laws to limit their influence and presence in the country. They banned missionaries, prohibited Japanese from leaving the country, and restricted trade.

Explanation:

In 1634, the Tokugawa government in Japan viewed foreigners with suspicion and enacted strict laws to limit their influence and presence in the country. The government banned the entry of Portuguese and Spanish missionaries, and prohibited Japanese from leaving the country except for special missions. They also restricted trade to specific ports and confined foreign merchants, such as the Dutch, to isolated settlements.

This policy of isolation was aimed at maintaining stability and control within Japan, as well as preserving traditional cultural and social structures. The government feared that foreign influences, particularly Christianity, would undermine their authority and lead to potential rebellions. The Tokugawa government's view of foreigners as a potential threat resulted in a period of isolationism that lasted until the mid-19th century.

Other Questions
Second grade homework easy!!!! Plz answer 15 pointsThx "lucy owns a bakery in 2006 she sold pies for $9.50 each in 2010 she sold pies for $17.50. Find the rate of change for the price of a pie from 2006 to 2010" Si te gusta estudiar, leer y escribir cuentos eres write 2.18 as a mixed number in simplest form Find the Nth term of the following sequence...7, 27, 47, 67, ..... Marvin is trying to finish 1/2 of his test every 2/3 hour. How many hours will it take Marvin to complete his whole test List the integers between the square root of 15 and the square root of 48 ? Why is radium valuable what is 3400 as a decimal answer asap Solve the given differential equation dN/dt=kN, (k=constant) ...? The trash, located by the sink, is always taken out at least once a week to keep the kitchen from smelling. What is the dangling modifier in this sentence? Given the ip address 192.168.112.0. each network requires between 35 and 60 hosts. what is the broadcast address of the first available subnet? 30 POINTS DONT ANSWER IF YOU DONT KNOW THE ANSWER FOR SUREIn the gene TATTCATTGTTATGATTTATTCG, CATTGTTA encodes for pepsin, a digestive enzyme. The rest of the sequence doesnt code for any protein. Which sequence contains a mutation that will affect the formation of pepsin?A. TATTCATTCATTATGATTTATTCGB. TATTCATTGTTATGACTTTATTCGC. TATTCATTGTTATGATTTATTGGCGD. TATTCATTGTTATGATATTCGE. TGCATTCATTGTTATGATTTATTCG A box is given a push so that it slides across the floor. How far will it go, given that the coefficient of kinetic friction is 0.15 and the push imparts an initial speed of 3.5m/s? When was the u.s. constitution written? what is bulimia? can someone explain it to me. Which items describe people's interactions with their environment?Technology does not affect the earth's environment.People adapt to their environment.People adapt their environment.Population growth and the environment are unrelated.Changes to the earth's environment rarely matter.Changes to the earth's environment can be harmful.Changes to the earth's environment can be beneficial. Choose the sentence that has the correct form of the verb ser. Ellas es muy inteligentes. Clara no es cubana. Nosotros son amigos. Yo eres serio. A rate that describes how much smaller or larger the scale drawing is than the real object Write 6% as a decimal.