What is the measure of ∠C?

What Is The Measure Of C?

Answers

Answer 1
all the angles in a triangle add up to 180 degrees and a right angle is 90 degrees. This leaves 90 degrees and 90-47=43. Angle C=43 degrees
Answer 2

The measure of ∠C in the triangle, ΔCDE, in the given figure, is 43°.

A triangle is a geometric figure with three sides, three angles, and three vertices. The sum of all the angles of a triangle is 180°. It is one of the most elementary geometric figures.

As it is known that the sum of all angles of a triangle is 180°,

∠C + ∠D + ∠E = 180°

∠C = 180° - ∠D - ∠E

∠C = 180° - 90° - 47°

∠C = 180° - 137°

∠C = 43°

Thus, the measure of ∠C is 43°.

Learn more about Triangle here:

https://brainly.com/question/2773823

#SPJ3


Related Questions

how can I compare two fractions with the same numerator

Answers

You first have to see if they have the same common denominators. If they do then the operation as in addition you add the numerator and denominator together and she if it can be reduced into a smaller number

Select linear or nonlinear to correctly classify each function.

Function.

(y - 4 = -8 (x - 1) A or B

(y = x to the 4th power) A or B

(y - x to the 2nd power = 4.5) A or B

(3x + 5y = 15) A or B

A) Linear

B) NON-Linear

Answers

1) y-4 = -8(x-1)
    y-4 = -8x+8
    y = 12-8x 
    It's Linear

2) y= x⁴
    It's non-linear

3)y-x² = 4.5
   y = 4.5+x²
   It's non-linear

4)3x+5y=15
   3x=15-5y
   It's Linear.

So, Among your all parts of the question, 
 Linear equations are:          1st & 4th
 Non-Linear equations are:  2nd & 3rd

Hope this helps!

Using the porpotions: WHIP= (Walks+Hits) divide by Innings Pitched. The pitcher wants to lower his WHIP from 1.53 to 1.3. How many more innings would he have to pitch without any walks or hits? Is this a reasonable goal? Explain your reasoning.

Answers

this relates to ur previous question....there were 85 innings last question and 130 walks + hits which gave a whip score of 1.53......so if he wants to lower his whip (without changing his walks or hits) to 1.3....
130 / (85 + x) = 1.3....multiply both sides by (85 + x)
130 = 1.3(85 + x)
130 = 110.50 + 1.3x
130 - 110.50 = 1.3x
19.5 = 1.3x
19.5 / 1.3 = x
15 = x

he would have to pitch 15 more innings without any walks or hits to reach a goal of 1.3 whip score. This is not a reasonable goal.....have u ever seen a baseball game where a pitcher pitched 15 innings without any walks or hits ? And since a game consists of 9 innings....he would be 3 innings short of 2 games (thats if they dont go into overtime), and he would have to pitch a no hitter....and that is highly unlikely.

There were 85 innings last question and 130 walks + hits which gave a whip score of 1.53 if  WHIP= (Walks+Hits).

What is an arithmetic operation?

It is defined as the operation in which we do the addition of numbers, subtraction, multiplication, and division. It has a basic four operators that is +, -, ×, and ÷.

It is given that:

Using the portions: WHIP= (Walks+Hits) divide by Innings Pitched. The pitcher wants to lower his WHIP from 1.53 to 1.3.

From the question:

130 / (85 + x) = 1.3

After solving:

19.5 = 1.3x

x = 15

To achieve a target of 1.3 whip score, he would need to pitch 15 more innings without issuing any walks or hits.

Thus, there were 85 innings last question and 130 walks + hits which gave a whip score of 1.53 if  WHIP= (Walks+Hits).

Learn more about the arithmetic operation here:

brainly.com/question/20595275

#SPJ3

A clipboard cost $2.23.It cost $0.58 more than a notebook.Lisa bought two clipboards and one notebook.She paid with a ten dollar bill.How much change does Lisa get?Use a tape diagram to show your thinking.

Answers

First you'd subtract .58 from 2.23 to get the price of the notebook.

2.23 - .58 = 1.65

(2.23×2)+1.65= 6.11

Now subtract 6.11 from ten to figure out the change amount.

10 - 6.11 = 3.89

Lisa gets a change amount of [tex]\fbox {\begin\ \bf \$ 3.89\\\end{minispace}}[/tex] when she pays a ten-dollar bill for two clipboards and a notebook.

Further explanation:

It is given that the cost of a clipboard is [tex]\$\ 2.23[/tex].

Also, it is known that the clipboard costs [tex]\$\text{ }0.58[/tex] more than a notebook so the cost of one notebook is calculated as,

[tex]\fbox {\begin\\\\\begin{aligned}\text{Cost of a notebook}&= 2.23-0.58\\&=1.65\end{aligned}\end{minispace}}[/tex]

Lisa bought two clipboards and one notebook then the total cost for items bought is obtained as the sum of cost of two clipboard and cost of one notebook.

[tex]\fbox {\begin\\\\\begin{aligned}\text{Total cost of two clipboard and one notebook}&= 2.23+2.23+1.65\\&=6.11\end{aligned}\end{minispace}}[/tex]

Lisa paid a ten dollar bill for the purchase of two clipboard and one notebook, so the total change she should get back is obtained as the difference of total cost of two clipboard and one notebook from the total paid price.

The tape diagram for the price paid for two clipboards and one notebook that Lisa bought is as shown in Figure 1 (attached at the end).

Therefore, the change that Lisa gets back is calculated as,

[tex]\boxed{\begin{aligned}\text{Change that Lisa gets}&= 10-6.11\\&=3.89\end{aligned}}[/tex]

Thus, the change amount that Lisa gets after she paid ten dollar for two clipboard and one notebook is [tex]\fbox {\begin\ \bf \$ 3.89\\\end{minispace}}[/tex].

Learn more:  

1. Linear equation application https://brainly.com/question/788903

2. To solve one variable linear equation https://brainly.com/question/1682776

3. Fractional expression simplification https://brainly.com/question/894273

Answer details

Grade: Middle school  

Subject: Mathematics  

Chapter: Simplification

Keywords: notebook, clipboard, ten-dollar bill, paid, costs, Lisa, bought, $2.23, $0.58, $4.46, change amount, total cost, amount, two clipboards.

A student tries out for the track team and runs a lap in 45 seconds. The coach tells her she will have to cut her time by 50% to make the team. How fast must she run a lap to make the team?

Answers

Cutting her time by 50% means reducing her time by half. Half of 45 seconds is 22.5 seconds. Therefore, to make the team, she must run a lap in 22.5 seconds.

1. You have $18 to buy peppers. Peppers cost $1.50 each. Write and solve and inequality that represents the number of peppers you can buy.
2. You have a gift card worth $90. You want to buy several movies that cost $12 each. Write and solve an inequality that represents the number of movies that you can buy and still have at least $30 on the gift card.
3. Your class sells boxes of oranges to raise $500 for a field trip. You earn $6.25 for each box of oranges sold. Write and solve an inequality that represents the number of boxes your class must sell to meet of exceed the fundraising goal.
4. You want to put up a fence that encloses a triangular region with an area greater than of equal to 60 square feet. What is the least possible value of c? Explain.

Answers

1.12 peppers
2.5 movies
3.80 boxes 

an elevator has a maximum lift of 2000 pounds you're moving 55 pound boxes of books write an equation and estimate how many boxes you can safely place on an elevator

Answers

36 boxes at 55 pounds u have to divide 2000 to 55
The answer is 2000/55, hence 36.3636363636 repeating.


luke is making 4 first aid kits. he wants to put 3 large and 4 small bandages in each kit. how many bandages does he need for the kits? Show your work.

Answers

(3+4) x 4
7x4= 28 he needs 28 bandages

Jade and five friends had three oranges they shared the oranges equally how much of an orange did Jade and her friends each get

Answers

Everyone would get 0.6 oranges.
ok so 6 Friends and 3 oranges Three Plus Three is Six so u Take the Three oranges and Cut them into a half. and Theres ur anwser. each get One half get it

Jayla buys and sells vintage clothing. She bought two blouses for $25.00 each and later sold them for $38.00 each. She bought three skirts for $15.00 each and later sold them for $26.00 each. She bought five pairs of pants for $30.00 each and later sold them for $65.00 each.
Jayla’s expenses for purchasing the items were
Jayla’s revenue from the sale of the items was
Jayla’s total profit was

Answers

Total expenses: $245.00
Total revenue: $479.00
Total profit $234.00

Answer: Total expenses = $ 225

Total revenue = $479

Total profit = $254

Step-by-step explanation:

Since we have given that

Cost price of each blouse = $25.00

Cost price of two blouses is given by

[tex]25\times 2=\$50[/tex]

Cost price of skirts = $15.00

Cost price of 3 skirts is given by

[tex]3\times 15\\\\=\$45.00[/tex]

Cost price of pairs of pants = $30.00

Cost price of five pairs of pants is given by

[tex]30\times 5\\\\=\$150[/tex]

so, Total expenses for purchasing the items were

Price of 2 blouses +Price of 3 skirts +Price of 5 pairs of pants

[tex]\$50+\$45+\$150\\\\=\$245[/tex]

Selling price of each blouse = $38.00

Selling price of 2 blouses is given by

[tex]38\times 2\\\\=$76[/tex]

Selling price of each skirt = $26.00

Selling price of 3 skirts is given by

[tex]26\times 3\\\\=\$78[/tex]

Selling price of each pair of pants = $ 65.00

Selling price of 5 pairs of pants is given by

[tex]65\times 5\\\\=\$325[/tex]

Total revenue from the sale of the items were

Sale of 2 blouses + Sale of 3 skirts +Sale of 5 pants

[tex]\$76+\$78+\$325\\\\=\$479[/tex]

Total profit was

Total Revenue - Total Expenses

[tex]\$479-\$245\\\\=\$234[/tex]

what is 55>-7v+6 help me

Answers

     Pull out like factors :

   49 + 7v  =   7 • (v + 7) 
    
    Divide both sides by  7 

     Subtract  7  from both sides
 v > -7

Inequality plot for

7.000 X + 49.000 > 0

 and it equals    v > -7

The sales tax for the food Jordan bought is 0.87 she has a coupon for 1.75 off any purchase use your answer for exercise 16 to find the final amount Jordan needs to pay?

Answers

The problem starts with 

1.8 x $3.95 = $ 7.11 (ham)
2.15 x $0.89 =  $1.91 (onion)
8 x $1.05 = $8.04 (soup)

tax $0.87

add it all together = $17.93

coupon $ 1.75

subtract coupon = $16.18

The cost of peanuts varies directly with the number of pounds. If 3 pounds of peanuts cost $6.30, what is the cost of 4.5 pounds

Answers

The cost would be 9.45 for 4 pounds .
you have to divide 6.30 by 3 for the price per pound, then you multiply the product by 4.5 thus you get your answer 9.45 pounds.

what is the decimal numeral for ten and five hundredths?

Answers

Ten and five hundredths in decimal form is 10.05

subtract the product of x and y from 58

Answers

I am sorry but this question is not specific XD. Sorry.

-2x-5y=10 find the slope of the line descibes by each equation

Answers

the goal is to get y by itself so that the equation can be in slope intercept (y = mx + b) form where m is the slope.

What is bigger pint or quart

Answers

Quarts are bigger than pints 

A quart is larger than a pint, as 1 quart equals 2 pints or 4 cups.

In the US customary system of measurement, both pints and quarts are units of volume. Here's the relationship between them:

1 pint = 2 cups

1 quart = 2 pints

To compare the two, let's convert them to a common unit, such as cups:

1 quart = 2 pints = 2 * 2 cups = 4 cups

Since 1 quart equals 4 cups and 1 pint equals 2 cups, it is evident that a quart is larger than a pint. It contains twice the volume of a pint.

To know more about quart, refer here:

https://brainly.com/question/11610829

#SPJ6

Jenny wants to paint the ceiling of her restaurant. The ceiling is in the shape of a square. Its side lengths are 55 feet. Suppose each can of paint will cover 275 square feet. How many cans will she need to paint the ceiling?

Answers

She will need 11 cans of paint to paint the ceiling. Hope this helps! :)

what is the relationship between 0.7 and 0.07

Answers

Well there are a number of relationships, I'll name a few:

1) .7 > .07 (.7 is Greater than .07)
2) .07 < .7 (.07 is Less than .7)
3) .7 is ten times greater than .007

Try to put both fractions in fraction form:

0.7 = 7/10
0.07 = 7/100

You can see that 7/10 is ten times as much as 7/100, therefore, it is the greater number.

In this case, 0.7 is greater than 0.07 (0.7 > 0.07)

what is another way to express 16

Answers

We can express 16 as
1) 4²
2) 2

Hope this helps!
128/8
16.0
6+10
8*2
123456789-123456773

39 divided by 5 remainder

Answers

7.8 is the answer :)

A system of equations is graphed on the coordinate plane.

y=−6x−3 y=−x+2

What is the solution to the system of equations?

Enter the coordinates of the solution in the boxes.

Answers

6x-3 is going to be 9x and then add x+2 then it equals 11x :)

Answer:

6x-3 is going to be 9x and then add x+2 then it equals 11x :)

Step-by-step explanation:

Can you help me w/ #6 plz

Answers

the vaule of d is the answer to 3

Please help with this math question!

James plays win the backfield of the big town football team. He made "gains" measured in yards of 3, 4, 1, and 5. What were his average yards per gain? Round your answer to the nearest tenth of a yard

Answers

The average in this case is 3 + 4 + 1 + 5÷ 4
so the answer is 3.3 if rounded to the nearest tenth

What is the answer to 43.42 divided 2.6. Need the steps to it

Answers

Not too many steps to it...
43.42 / 2.6 = 16.7
Answer:

Value of 43.42 divided by 2.6 is:

16.7

Step-by-step explanation:

We have to find the value of:

43.42/2.6

Dividing the numerator and denominator by 2, we get

= 21.71/1.3

Now, removing the decimals from numerator and denominator, we get

= 2171/130

Dividing the numerator and denominator by 13, we get

= 167/10

Now, dividing numerator and denominator by 10, we get

= 16.7

Hence, Value of 43.42 divided by 2.6 is:

16.7

Dagney read 120 pages in three hours. Write two rates implied by the statement. How long would it take Dagney to read a 560 page novel at the same rate?

Answers

dagney reads at 40 pages an hour, or .75 pages a minute.

it would take 4.5 hours to read the novel

What is an equation for the linear function whose graph contains the points (2, 5) and (3, 0) ?

Enter your answers in the boxes.

y- = (x-2)

Answers

(2,5)(3,0)
slope = (0 - 5) / (3 - 2) = -5/1 or just -5

y = mx + b
slope(m) = -5
use either of ur points...(2,5)...x = 2 and y = 5
now we sub and find b, the y int
5 = -5(2) + b
5 = -10 + b
5 + 10 = b
15 = b

so ur equation is : y = -5x + 15

or if u need it in point slope form
y - y1 = m(x - x1)
slope(m) = -5
(2,5)...x1 = 2 and y1 = 5
now we sub
y - 5 = -5(x - 2)

Answer:

the answer is y-5=-5(x-2)

Step-by-step explanation:

I got a one hundred on my quiz so I know for sure this is correct. Also It make sense when you do the math. brainiest pls

Please answer all of the questions and please explain need help ASAP PLEASE ps do the even number questions PLEASE HELP ASAP and EXPlAIN !!!!!!!!

Answers

I wasn't sure what properties the assignment was looking for... Let me know if you have any other questions!

A pipe that is 3.1 meters long is placed vertically in a pond. Its lowest point is 1.5 meters under the water surface. How far above the water surface is the top of the pipe?

Answers

Answer

Find out the  how far above the water surface is the top of the pipe .

To prove

As given

A pipe that is 3.1 meters long is placed vertically in a pond.

Its lowest point is 1.5 meters under the water surface.

thus

The  top of the pipe far above the water surface = 3.1 - 1.5

                                                                                = 1.6 meter

Therefore the   top of the pipe far above the water surface is 1.6 meter .

                                                                             


What is the change in elevation from 134 feet below sea level to 29 feet above sea level?

Answers

Answer:its 163 or -163

Step-by-step explanation:

Other Questions
How did airports encourage city growth ?a. they promoted the building of hotels, restaurants,services and rapid transit to accommodate travelers b. they are so big and require so much land that they need a larger population to be sustained c. they limit the effects of gridlock and make travel more pleasantd. they were responsible for transporting over 13 billion tons of materials Second grade homework easy!!!! Plz answer 15 pointsThx "lucy owns a bakery in 2006 she sold pies for $9.50 each in 2010 she sold pies for $17.50. Find the rate of change for the price of a pie from 2006 to 2010" Si te gusta estudiar, leer y escribir cuentos eres write 2.18 as a mixed number in simplest form Find the Nth term of the following sequence...7, 27, 47, 67, ..... Marvin is trying to finish 1/2 of his test every 2/3 hour. How many hours will it take Marvin to complete his whole test List the integers between the square root of 15 and the square root of 48 ? Why is radium valuable what is 3400 as a decimal answer asap Solve the given differential equation dN/dt=kN, (k=constant) ...? The trash, located by the sink, is always taken out at least once a week to keep the kitchen from smelling. What is the dangling modifier in this sentence? Given the ip address 192.168.112.0. each network requires between 35 and 60 hosts. what is the broadcast address of the first available subnet? 30 POINTS DONT ANSWER IF YOU DONT KNOW THE ANSWER FOR SUREIn the gene TATTCATTGTTATGATTTATTCG, CATTGTTA encodes for pepsin, a digestive enzyme. The rest of the sequence doesnt code for any protein. Which sequence contains a mutation that will affect the formation of pepsin?A. TATTCATTCATTATGATTTATTCGB. TATTCATTGTTATGACTTTATTCGC. TATTCATTGTTATGATTTATTGGCGD. TATTCATTGTTATGATATTCGE. TGCATTCATTGTTATGATTTATTCG A box is given a push so that it slides across the floor. How far will it go, given that the coefficient of kinetic friction is 0.15 and the push imparts an initial speed of 3.5m/s? When was the u.s. constitution written? what is bulimia? can someone explain it to me. Which items describe people's interactions with their environment?Technology does not affect the earth's environment.People adapt to their environment.People adapt their environment.Population growth and the environment are unrelated.Changes to the earth's environment rarely matter.Changes to the earth's environment can be harmful.Changes to the earth's environment can be beneficial. Choose the sentence that has the correct form of the verb ser. Ellas es muy inteligentes. Clara no es cubana. Nosotros son amigos. Yo eres serio. A rate that describes how much smaller or larger the scale drawing is than the real object