What practice would probably NOT reduce the greenhouse effect? A) Increased use of aerosol spray cans. B) Reduced use of forests for timber or farmland. C) The use of nuclear power plants instead of coal power plants. D) Increased dependence on alternative energy sources, instead of gasoline.

Answers

Answer 1

Answer:

The Answer Is A. Increased use of aerosol spray cans.

Explanation:

Aerosol spray cans contribute to the destruction of the ozone layer, but not significantly to the greenhouse effect.

Answer 2

The increased use of aerosol spray cans is unlikely to reduce the greenhouse effect. Hence, option A is the correct answer for the greenhouse effect. Due to this effect, the earth's temperature is rising.

What exactly is the greenhouse effect?

The Greenhouse effect is due to many factors, such as the decline in the number of forests, the increase in industries, and the overproduction of gases such as carbon dioxide, water vapor, etc. Due to the abundance of these gases in the air, radiation can enter the atmosphere but cannot go back.

As these radiations reach the earth and convert into long radiations that cannot return, the temperature rises. Global warming is occurring as a result of rising temperatures, and polar ice is melting. The negative effects affect different species and humans too.

Hence, the increased use of aerosol spray cans is unlikely to reduce the greenhouse effect. Hence, option A is the correct.

Learn more about the greenhouse, here

https://brainly.com/question/13706708

#SPJ5


Related Questions

Identify the transformations of energy that take place in the diagram. Assume the girl in the diagram eats the corn to gain the energy to ride the bike.
chemical energy
to kinetic energy
gravitational potential
energy to kinetic
energy
radiant energy
to chemical energy
kinetic energy to
gravitational
potential energy

Answers

Answer: 1 gravitational potential energy to kinetic energy, 2 kinetic energy to gravitational potential energy ,3  chemical energy to kinetic energy ,4

radiant energy to chemical energy

Explanation:

for the diagram on plato read left to right

The transformation of energy that takes place is in the following sequence:

1. radiant energy to chemical energy.

2. chemical energy to kinetic energy.

3. kinetic energy to gravitational potential energy.

4. gravitational potential energy to kinetic energy.

What is the transformation of energy?

Transformation of energy is the transfer of energy from one form to another form. There are different types of energy are present, they are just transformed from one type to another.

Here, the sun's energy is transformed into chemical energy for food, then bicycling converts that food's energy into kinetic and so on.

The picture is attached below:

Thus, the sequence of transformation of energy is:

1. radiant energy to chemical energy.

2. chemical energy to kinetic energy.

3. kinetic energy to gravitational potential energy.

4. gravitational potential energy to kinetic energy.

Learn more about the transformation of energy, here:

https://brainly.com/question/11657923

#SPJ2

Habituation refers to the __________.
a. awareness that things continue to exist even when not perceived.
b. decreasing responsiveness to a stimulus to which one is repeatedly exposed.
c. adjustment of current thinking to make sense of new information.
d. the tendency to gaze longer at face-like images.

Answers

Answer:

Habituation refers to the  adjustment of current thinking to make sense of new information.

Explanation:

Final answer:

Habituation is the process where there is a decrease in response to a repeatedly presented stimulus, with no rewards or punishments associated with it, and is a form of learning that is long-lasting.

Explanation:

Habituation refers to the decreasing responsiveness to a stimulus to which one is repeatedly exposed. Therefore, the correct answer is (b). This form of learning is seen across various species and is not due to fatigue or sensory adaptation. An example of habituation can be observed when a dog stops responding to a repetitive sound after learning that it has no significant consequence. The process of habituation is long-lasting, and it is considered one of the simplest forms of learning, highlighting an organism's ability to filter out repetitive, inconsequential stimuli over time.

Pathogenic bacteria that succeed in penetrating the wall of the large intestine into the blood circulation are removed or destroyed by

Answers

Intestinal Epithelial Cells (IEC)

Explanation:

Polarized intestinal epithelial cells (IEC), as well as the resident microflora, provide a barrier that guards against microbial invasionThe necessity for the epithelium to maintain an intact barrier between lumen bacteria and the lamina propria is exemplified by the consequences after the barrier function is alteredImpairment of the barrier function of the intestinal epithelium may be a predominant mechanism in the pathogenesis of inflammatory bowel disease (IBD)

The is the sac-like structure that holds the testes is called

Answers

Answer:

The scrotum

Explanation: It is a loose sac which contains the 2 testes. Both the testes are attached to a cord-like structure called spermatic cord which contains testicular artery, vein, nerve and also vas deferens tube which takes sperms from the testes into the penile urethra.

The term transgenes refers to


genes that are transmitted from one generation to the next.


genes that are transferred from the genome of one organism into another.


genes that make trans-double bonds.


gene products that are modified on the trans-face of the Golgi apparatus.

Answers

Answer:

The term transgenes refers to

genes that are transferred from the genome of one organism into another.

Explanation:

(a) Describe the importance of phenotypic variation in louse body color among individuals in a population of lice.

Answers

Answer:

In parasitic insects such as lice, the melanism is an evolutionary strategy of adaptive significance  

Explanation:

In lice, different body colors represent an adaptive advantage because this feature should enable them to host on different hair colors and be undetected by the host. Therefore, different colors confer to this species the capacity to survive in different types of environments (i.e., hair colors)

The importance of phenotypic variations withinside the louse frame shade at on amongst people in a population of lice is the variety in phenotypes that exists in a population.

What is the phenotypic variation?

Phenotypic variation is essential as it became letting them mixed in with the pigeon’s feathers. In parasitic bugs together with lice, melanism is the evolutionary method of adaptive significance.  In Lice, constitute an adaptive gain due to the fact this option ought to permit them to host on unique hair colors and be undetected via way of means of the host.

Therefore, unique colors confer to this species the capability to live to tell the tale in unique styles of environments. (ex. hair colors)

Phenotypes are the developments or traits of organisms that we are able to observe, together with size, shade at on, form capabilities, behaviors, etc. Not all phenotypes can truly be seen.  

For example-humans are available in all shapes and sizes: height, weight, and frame shapes are phenotypes that vary Hair, eye, shade at on, and the potential to roll your tongue is variable phenotypes. All organisms could have phenotype variations.

Therefore, the phenotypic variation is essential in the louse frame shade at on.  

To recognize extra phenotypic variations compile with the link-  https://brainly.com/question/3767260

After watching the squirrels at the local park for several days, Sergei asks his science teacher the following question: "Do more squirrels live in maple trees or oak trees in the city park?”

Is Sergei's question a scientific question? Why or why not?

Answers

Answer:

Sergei's question is a scientific question because it is based on observations and could be answered through an investigation. His question may lead to a testable hypothesis.

Answer:

Sample Response: Sergei's question is a scientific question because it is based on observations and could be answered through an investigation. His question has a narrow focus, addresses a gap in his knowledge, and may lead to a hypothesis that can be tested.

What are the three domains of life?
Plantae, Animalia, and Fungi
class, kingdom, and phylum
Eubacteria, family, and Eukarya
Bacteria, Archaea, and Eukarya

Answers

D. Archaea, bacteria,eukarya
Final answer:

The three domains of life are Bacteria, Archaea, and Eukarya. These cater to different types of life forms based on their cell structure and environments. Bacteria and Archaea are prokaryotes, while Eukarya includes animals, plants, and fungi.

Explanation:

The three domains of life are Bacteria, Archaea, and Eukarya. These domains are a way of grouping life on Earth and are above the Kingdom level in taxonomic ranking. Bacteria and Archaea include various prokaryotic microorganisms, but Archaea are often found in extreme environments. Eukarya consists of organisms whose cells have a nucleus enclosed within membranes, including animals, plants, and fungi, among others.

Learn more about domains of life here:

https://brainly.com/question/32820008

#SPJ12

You have just finished a really long workout at the gym. You are sweating quite a bit and feel thirsty. You have lost a lot of water and some ions while sweating. In response to decreased Na+ in body fluids (Na+ depletion), your kidneys will _____ renin secretion. decrease increase stop

Answers

Answer:

increase

Explanation:

As water and ions are lost through exercise, overall blood volume can decrease. To maintain adequate blood volume and blood pressure, renin is secreted to help in the conversion of angiotensin I to angiotensin II. This will cause vessels to constrict and sodium and water to be retained by the kidneys.

Final answer:

The kidneys will increase renin secretion in response to decreased Na⁺ in body fluids. This is due to activation of the renin-angiotensin-aldosterone system, which restores Na⁺ balance and blood pressure by increasing aldosterone release, leading to reabsorption of sodium and water in the kidneys.

Explanation:

In response to decreased Na⁺ in body fluids (Na⁺ depletion), your kidneys will increase renin secretion. This is because renin activates the renin-angiotensin-aldosterone system (RAAS) which is crucial for regulating blood pressure and fluid balance. When there is a decrease in blood volume, blood pressure, or specifically, Na⁺ levels, the kidneys release more renin. This leads to the formation of angiotensin II, a potent vasoconstrictor that also stimulates the release of aldosterone from the adrenal glands.

Aldosterone plays a key role in directing the kidneys to reabsorb sodium, which in turn causes water to be reabsorbed, thus increasing blood volume and blood pressure. The responses to aldosterone help to restore Na⁺ balance and normalize blood pressure.

What are the two ultimate sources of energy for all the living things on Earth?

Answers

The two ultimate sources of energy for all living things on earth is sun light and certain rich compounds like chemotropes.
the sun is definitely the ultimate source of energy the other possibly cellular respiration which is when the energy in food is converted into energy that can be used by the cells in organisms

is paint a solution​

Answers

Answer:

A paint is either colloid suspension or colloid. In the paint, the pigment is dispersed in the solvent solution but they are not dissolved in it. In oil paints, the hydrocarbon oil is the binding medium which is dissolved in a solution. In Water-based paints the solvent is water.

Explanation:

The suspension is a mixture of two substances where one is dispersed in the other. Particles in suspension can be seen with the naked eyes.

Colloids are a homogeneous mixture of two or more components where particles are not visible to the naked eyes.

No, paint is not a solution.

What is a solution?

A solution refers to a combination of two or more substances that form a mixture. This occurs when one substance is dissolved in another with the dissolved substance known as the solute and the substance that dissolves it called the solvent. In a solution the solute particles are evenly spread throughout the solvent.

Paint however is a mix of pigments, resins and solvents. In paint the pigments are not uniformly spread throughout the solvent. Instead they are suspended within it which means that they are surrounded by molecules but not fully dissolved.

Learn about  solutions here https://brainly.com/question/25326161

#SPJ6

Which ecosystem would scientists consider to be the most stable?
A :a coral reef that is fished by native people several times a day
B : atropical rainforest that is being cut down to make room for farmland
C : a temperate forest where all the tree trunks have been damaged by beetles.
D :a savanna that retains the same number of species even when a drought occurs

Answers

Answer:

B : atropical rainforest that is being cut down to make room for farmland

Explanation:

Below is the double-stranded DNA sequence of part of a hypothetical yeast genome. Within this sequence is a small gene, PICO8, that codes for an 8 amino-acid peptide (assume traditional start codon). Transcription of PICO8 starts at the Transcription Start Site (TSS) after the promoter and proceeds in the direction of the arrow. Transcription stops at the end of the transcription terminator.
5' - CTATAAAGAGCCATGCATATCTAGATAGTAGGCTCTGAGAATTTATCTCACT - 3
3 - GATATTTCTCGGTACGTATAGATCTATCATCCGAGACTCTTAA ATAGAGTGA - 5
promoter terminator
Which strand of DNA is the CODING strand? (TOP OF BOTTOM?) Select only ONE answer choice.
A. Top
B. Bottom
C. Either can serve as the codong strand
D. There isn't enough information to determine which is the coding strand

Answers

Answer:

D. There isn't enough information to determine which is the coding strand

Explanation:

In this protein, it would be necessary to observe a start codon (ATG) and one-stop codon (either TAA, TAG, or TGA) which should be separated by six (6) intern codons. It is not observable this nucleotide sequence in any of both DNA strands.

Transcription and Translation are the two steps of the central dogma, in which genetic information from the DNA is converted into the RNA, then a long chain of polypeptides.

The correct answer is:

Option A. Top

In the given sequence of the hypothetical yeast genome, the PlCO8 gene codes for a small peptide chain of 8 amino acids.

The transcription starts from the traditional start site, in which the nucleotides in the template strand are converted into the corresponding base pair in the mRNA.

In the given sequences of nucleotides, the coding strands will be the strand that runs in the direction of 5'-3'.

The codes from the coding strand are then transcribed into the mRNA, followed by the translation.

Therefore, option A is correct.

To know more about Transcription, refer to the following link:

https://brainly.com/question/14136689

Walking along a beach, you find a section of an adult gray whale's vertebral column with three vertebrae. You saw one of the vertebra in half, revealing a hard outer layer of _____ forming the wall, and a network of _____ with _____ in the center.

Answers

Answer:

Walking along a beach, you find a section of an adult gray whale's vertebral column with three vertebrae. You saw one of the vertebra in half, revealing a hard outer layer of compact bone forming the wall, and a network of spongy bone with trabeculae in the center.

Explanation:

The harder structures of a skeleton are made by the compact bone. Compact bones are dense and rigid. They are non-porous.

Spongy bones are porous bones which are covered by the compact bones as they themselves are not hard. They are also known as cancellous bones.

Trabeculae are thin plates which  give a spongy structure to the spongy bones. The trabeculae are present in the center of the spongy bones.

HELPPPPP WILLL GIVE BRAINLIEST!!!!!RATE!!!!! AND THANKS!!!!! EASY BUT IM DUMB!!!!


What evidence BEST supports the presence of atmospheric oxygen 2.7 billion years ago?
A) organic material in meteorites
B) layered iron rust in rocks
C) fossils found in stomatolites
D) carbon 14 in plants

Answers

Answer:

c

Explanation:

Answer:

D) carbon 14 in plants

Explanation:

Plants fix atmospheric carbon during photosynthesis, so the level of 14C in plants and animals when they die approximately equals the level of 14C in the atmosphere at that time. However, it decreases thereafter from radioactive decay, allowing the date of death or fixation to be estimated.

A computer crossmatch requires that an ABO phenotype be performed on the current specimen and a second phenotype must be performed or available for confirmation of the blood type. The recipient must be negative for clinically significant antibodies both with current sample and historically.
True / False.

Answers

Answer:

True

Explanation:

A computer cross match checks the compatibility of the final ABO in selecting units instead of serologic procedures.

The recipient must not have antibodies or history of it.

Barcodes are used in providing other safety measures. The computer provides the signal to show if the recipient is eligible or not for a computer cross match.

A computer cross match is a computerised way of analysing the compatibility of a donor's cell type with that of the serum or plasma type of the person receiving it. This process is aimed at ensuring that blood sample used for transfusion is compatible with that of the person meant to receive it.

Answer:

True.

Explanation:

Crossmatch or compatibility testing is basically performed to check the compatibility of donor blood (RBCs) to the recipient to prevent the transfusion reaction and to maximize the in-vivo survival of transfused RBCs.

Computer cross match is to counter check the donor blood sample phenotype and recipient phenotype along with any previous transfusion history with antibodies (recipient must not have antibodies against the phenotype of donor blood).

Another feature of computer crossmatch is bar coding. Bar codes detects the recipients eligibility or ineligibility for computer crossmatch by tagging or flag.

5. The measurement of the amount of friction a surface will generate is called the
of friction'.

Answers

j

Answer:

g bmbb.

mom b km

bmIb

m v vbb n bbk

8 m

c

Explanation:

lv..l

mm. n

bl

np

gbm.m.

.

..jxbt98 b. vv

Immunoglobulins that attach to and sensitize mast cells and basophils are

Answers

Answer:

IgE

Explanation:

Immunoglobulins can be described as antibodies that are found in blood and other bodily fluids of humans and other vertebrate animals. And their major function is that they help identify and destroy foreign substances such as microbes such as bacteria and protozoan parasites.

They are known to be produced by produced by plasma cells (white blood cells).

Immunoglobulins are classified into five categories: IgA, IgD, IgE, IgG and IgM. And are distinguished by the type of heavy chain they contain. IgG molecules possess heavy chains known as γ-chains; IgMs have μ-chains; IgAs have α-chains; IgEs have ε-chains; and IgDs have δ-chains.

In this case, IgE is the immunoglobulin that attach to and sensitize mast cells and basophils.

The correct answer is D) IgE, which attaches to and sensitizes mast cells and basophils, playing a significant role in allergic responses and defense against parasitic infections.

The immunoglobulin that attaches to and sensitizes mast cells and basophils is D) IgE. Here's why:

IgE binds to the Fc receptors on the surface of mast cells and basophils.These cells then become sensitized to future exposures of the same allergen.Upon re-exposure to the allergen, IgE triggers these cells to release histamine and other chemicals, leading to an allergic reaction.IgE is involved in defense against parasitic infections, which also relies on its ability to activate mast cells and basophils.Its primary role is mediating immediate hypersensitivity reactions, including allergies like hay fever, asthma, and anaphylaxis.

Compared to other immunoglobulins, IgE is present in very small quantities in the serum but has significant effects on immune response once bound to mast cells and basophils.

Complete question:

Immunoglobulins that attach to and sensitize mast cells and basophils are

A) lg D.

B) lg G.

C) Ig M.

D) lg E.

E) lg A

Proprioceptive neuromuscular facilitation technique requires

Answers

Answer:

A partner

Explanation:

Proprioceptive neuromuscular facilitation technique is a stretching technique that is aimed at rehabilitating or restoring back to health the proprioceptors present in the body also known as sensory organs of the muscles and tendons, bones and joints of the body

Proprioceptive neuromuscular facilitation technique uses stretching techniques involving contraction and relaxation to achieve a maximum flexibility of the muscular system of the body.

Proprioceptive neuromuscular facilitation technique is always done or carried out with a partner or a trainer.

Answer:

The proprioceptive neuromuscular facilitation technique requires organic proprioceptors

Explanation:

Proprioceptive neuromuscular facilitation techniques are therapeutic methods used in order to obtain specific responses of the neuromuscular system from the stimulation of organic proprioceptors.

The four pulmonary veins return oxygenated blood to this chamber. What is this chamber?

Answers

Final answer:

The left atrium receives oxygenated blood from the four pulmonary veins.

Explanation:

The chamber that receives oxygenated blood from the four pulmonary veins is the left atrium.

Learn more about Pulmonary veins and left atrium here:

https://brainly.com/question/34323562

#SPJ6

The ________ routes air and food into their proper channels and plays a role in speech.

Answers

Answer:

Larynx

Explanation:

The Larynx is an organ of the body located at the anterior of the neck. It is also called the glottis or the voice box. The larynx is the air passageway or structure that connects to the trachea, it directs air into the lung and hence aids breathing. This organ is responsible for sound production, breathing and helps to prevent pulmonary aspiration. The larynx comprises of the vocal folds which plays an important role in speech and singing; in making of sounds the larynx muscle regulate the tension and the length of the vocal folds in order to tune the tone and the voice pitches.

Answer:

Larynx

Explanation:

Larynx is also called voice box.

It is an organ that is in tube like shape which is long and about 2.5cm. it is located above the wind pipe or trachea in the neck and food pipe. It houses the vocal folds and manipulate pitch and volume.

It is responsible for breathing, it route air and food in proper direction and protect the trachea against food aspiration.

Selective serotonin reuptake inhibitors a. act to stabilize the mood swings of those with bipolar disorder b. were the first antidepressants to be developed c. may lead to sexual problems d. are more effective than tricyclic antidepressants

Answers

Answer:

B

Explanation:

SSRI stands for Selective Serotonin Reuptake Inhibitor. SSRI antidepressants are a type of antidepressant that work by increasing levels of serotonin within the brain.

A desert ecosystem shows many examples of interactions between biotic and abiotic parts. Describe two biotic and two abiotic parts of the desert ecosystem. Choose one biotic and one abiotic part of the desert ecosystem, and explain the interaction between the two parts.

Answers

Answer:

Biotic Cacti, snakes, cayote, rats

Abiotic Sand, earth, water, caves

Explanation:

Snakes which are biotic live some caves (abiotic)

A desert ecosystem shows many examples of interactions between biotic and abiotic parts and the Biotic components are Cacti, snakes, cayote, rats and the abiotic components are sand, earth, water, caves.

What is abiotic factor?

As we know that our environment is madeup of two components biotic component and abiotic component and the factors which are living are known as biotic components and the factors which are not living are known as abiotic components.So, the non living components are known as abiotic factors and these are sunlight, air etc.

Biodiversity has been consist of all the different kinds of the life living in a particular area like the variety of the animals, plants, fungi and microorganisms like bacteria and virus that plays a the major role in the framing of natural world usually three levels of biodiversity are observed and these are genetic species, and ecosystem diversity.

Therefore, A desert ecosystem shows many examples of interactions between biotic and abiotic parts and the Biotic components are Cacti, snakes, cayote, rats and the abiotic components are sand, earth, water, caves.

Learn more about Biodiversity on:

https://brainly.com/question/13073382

#SPJ5

A nursing student is learning about newborn congenital defects. The defect with symptoms that include a shiny scalp, dilated scalp veins, a bulging anterior fontanelle, and eyes pushed downward with the sclerae visible above the irises is which defect?

Answers

Answer:

The correct answer is hydrocephalus.

Explanation:

The accumulation of fluid within the cavities deep inside the brain is termed as hydrocephalus. This fluid build-up enhances the size of the ventricles and imparts pressure on the brain. This condition eventually makes the head appear larger than normal with broadening cranial sutures. With the enlargement of the head, the distinction of suture lines takes place, creating the spaces through the scalp.  

The skull increases in size, the anterior fontanelle bulges and becomes tense, and the dilation of veins takes place. In certain conditions, with more increase in pressure, the eyes seem to get pushed slightly downward and the sclerae appear over the irises.  

Describe how
Changes to genes can affect the traits of organisms

Answers

   Changes to genes, such as mutations, can alter the sequence of DNA, leading to variations in proteins produced, ultimately impacting the traits of organisms.

    Changes to genes, whether through mutations, genetic recombination, or other genetic mechanisms, can profoundly impact the traits of organisms. Genes are segments of DNA that encode instructions for the synthesis of proteins, which are the building blocks of cells and the functional molecules that carry out biological processes.

    Mutations, which are alterations in the DNA sequence, are a primary driver of genetic variation. Mutations can occur spontaneously due to errors in DNA replication, exposure to mutagenic agents such as radiation or certain chemicals, or through natural processes like transposon activity. These changes can result in different forms of alleles, the alternative versions of a gene, which may lead to variations in traits.

    Mutations can have various effects on genes and subsequently on organismal traits. Some mutations may be silent, meaning they do not alter the amino acid sequence of the resulting protein and therefore have no discernible effect on phenotype. Other mutations, however, can lead to changes in protein structure or function, which may impact the organism's traits in diverse ways. For instance, a mutation may enhance or diminish the activity of an enzyme, affecting metabolic pathways and physiological processes.

    Genetic recombination, which occurs during sexual reproduction, is another mechanism that contributes to genetic diversity. During meiosis, homologous chromosomes exchange genetic material through crossing over, resulting in the shuffling of alleles between chromosomes. This process generates new combinations of alleles, leading to offspring with novel genetic compositions and potentially unique traits.

    The effects of changes to genes on organismal traits can be influenced by various factors, including gene interactions, environmental conditions, and genetic drift. Additionally, the nature of the gene and the specific mutation or recombination event can determine the extent of phenotypic variation. In some cases, changes to genes may confer advantages, increasing an organism's fitness in its environment and leading to evolutionary adaptation. Conversely, deleterious mutations may result in decreased fitness or even lethality, affecting the survival and reproductive success of individuals.

    Overall, changes to genes play a fundamental role in shaping the diversity of traits observed within and among species, driving evolution and contributing to the complexity and adaptability of life on Earth.

Complete Question:

Describe how Changes to genes can affect the traits of organisms

Before leaving the nucleus, the pre-mRNA transcript formed through transcription undergoes a series of enzyme-regulated modifications. Part of the process is illustrated below. Without this modification, why would mRNA be translated into a nonfunctional protein?

Answers

Post transcription

Explanation:

Before leaving the nucleus, the pre-mRNA transcript formed through transcription undergoes a series of enzyme-regulated modifications which includes: 5'capping,splicing,3' cleavage(polyadenylation) and RNA editing

5' capping is the first modification event in the pre mRNA that occurs after 20-30 nucleotide addition,in capping a 7 methyl guanosine(cap) is added to the 5' end of pre-mRNASplicing is the second modification event of pre-mRNA occurs in nucleus just after transcription but before the RNA moves to the cytoplasmIn RNA splicing non coding regions of pre-mRNA called introns are removed and coding regions called exons are religated If this modification does not occur then introns will be copied from DNA that will interrupt the genetic codeMost of mature eukaryotic mRNA have 50-250 adenine residue at the 3'end called Poly A tailThese nucleotides are not encoded by the genome but are added after transcription,process is called polyadenylationPolyadenylation is both template and primer independent process catalysed by polyadenylate polymerase and protects mRNA from exonuclease at 3'end RNA editing is defined as the change of nucleotide sequence of RNA which is carried out in two different ways: site specific base modification and insertional or deletion type of RNA editing

Answer:

Introns are regions of pre-mRNA copied from DNA that interrupt the genetic code.

Explanation:

1. DNA is first transcribed into pre-mRNA, then this pre-mRNA further go series of modification, like 5' capping, 3' polyadenylation and RNA splicing.

2. Through splicing, introns are removed and exons are joined together to form a mature RNA known as mRNA.

3. If without these modifications, RNA is translated, it would encode non-functional protein because all the codons in the pre-mRNA would translated and introns would code a non-functional protein.

Mycorrhizae:
A. are vital for the survival of lichens
B. are vital for the survival of many plants
C. increase the absorptive ability of roots.
D. are used in the production of wine, beer, and bread
E. are vital for the survival of many plants AND increase the absorptive ability of roots.

Answers

Answer:the correct answer would be c

Explanation:I just did it

Answer : C
Explanation: "A mycorrhiza is a symbiotic association between a green plant and a fungus. The plant makes organic molecules such as sugars by photosynthesis and supplies them to the fungus, and the fungus supplies to the plant water and mineral nutrients, such as phosphorus, taken from the soil." I looked it but I mentions the nutrition and on the pictures it made it look like the answer is C

Check all the characteristics below that describe
elements
one type of atom
a pure substance
more than one type of atom
chemically combined elements

Answers

Answer:

The Answer your looking for is A and B

A-one type of atom

B- a pure substance

Explanation:

__________

_____________

The characteristics below that describe elements are: one type of atom and a pure substance. The correct options are A and B.

What is an element?

An element is a kind of atom that contain a specific amount of protons in its nuclei, and they can be a pure species. Chemical elements can be divided any further.

It is clear that the elements are pure substances, and they are one type of atom.

Thus, options A and B are correct regarding the characteristics of elements.

Learn more about an element, here:

https://brainly.com/question/13794764

#SPJ2

In a population of bison,the birth rate over one year is fourteen.No bison immigrate into the population that year. Twenty bison die during the harsh winter, and ten more leave the population in search of more food.What has occurred in this population over one year?The size of the population has increased.The size of he population has decreased.The size of the population has remained the same.

( 1 ) The size of the population has increased.
( 2 ) The size of the population has decreased.
( 3 )The size of the population has remained the same.

Answers

Answer:

The population has decreased. (2)

Explanation:

if the birth rate is 14 and no bison immigrate into the population and the death rate and emigration rate add up to 30, then the population has decreased a total of 16 bison

Answer: B

Explanation:

Just confirming!

When an odorant binds to an olfactory receptor, a cascade event triggers a cellular response, and the organism is able to detect smells. Use the diagram of this process to respond:

A diagram representing the initial cellular response when an odorant molecule binds to a receptor protein. The diagram shows the sequence of events from 1 - the odorant molecule binds to the receptor protein, 2 - the active adenylate cyclase occurs, 3 - the cAMP released opens the active Na+ and Ca2+ channel, 4 - the Ca 2+ ions enter the cell, 5 - the Ca 2+ opens the Cl- channel, 6 - the Ca2+ allows the Na+ to leave via the Na+/Ca2+ exchanger.
© 2012 FLVS

Using the information in the diagram, what is the primary reason the cascade event is occurring in the cell?

ATP is available to provide energy.
There is a greater concentration of calcium ion inside the cell.
There is only one type of receptor protein.
The receptor protein is specific for the odorant molecule.

Answers

Answer:

The receptor protein is specific for the oderant molecule

Final answer:

The cascade event is primarily triggered because the receptor protein on the olfactory cell is specific to the odorant molecule. This specificity initiates a signaling cascade involving cAMP and the opening of ion channels, culminating in a cellular response for smell detection.

Explanation:

The primary reason the cascade event is occurring in the cell is because the receptor protein is specific for the odorant molecule. This specificity ensures that when an odorant binds to its corresponding olfactory receptor, a series of intracellular events is triggered, starting with the activation of a G-protein and leading to the production of cyclic adenosine monophosphate (cAMP) as a second messenger. The cAMP then opens sodium and calcium channels, allowing the influx of calcium ions which further open chloride channels and initiate the sodium/calcium exchange process. This cascade results in a cellular response that enables the organism to detect smells.

The process involves several important steps, each amplifying the signal to cause a significant cellular response from a single molecule of odorant. This includes the activation of protein kinases and other intracellular pathways that lead to physiological responses such as the generation of an action potential.

Other Questions
Naomi works at a doctor's office. She surveyed a random sample of 100 patients and found that 70% of the patients surveyed take a daily vitamin. Naomi wanted to know if it is plausible that 75% of the entire population of the doctor's patients take a daily vitamin.Naomi performed 360 trials of a simulation. Each trial simulated a sample of 100 patients under the assumption that 75% of the population takes a daily vitamin. The dot plot shows the results of the simulations.What is the best conclusion for Naomi to make based on the data? That's when everything I've been holding in since this morning, since when Mrs. Price put the sweater on my desk, finally lets go, and all of a sudden I'm crying in front of everybody. . . . I put my head down on the desk and bury my face in my stupid clown-sweater arms. My face all hot and spit coming out of my mouth because I can't stop the little animal noises from coming out of me, until there aren't any more tears left in my eyes, and it's just my body shaking like when you have the hiccups, and my whole head hurts like when you drink milk too fast.Eleven,Sandra CisnerosWhat does this passage from "Eleven" help to show readers?answer:Sometimes you just need to let your feelings out. Nadia deposited $3000 into an account that earns annual simple interest. 13 pointsAfter 6 years, she had earned $990 in interest. What was the interest rateof the account? *Your answer . The equation d + 6400 = 3/1.3 x 10". 42relates the distance d in kilometers of acertain GPS satellite above the surface ofthe Earth to the number of hours t it takesthe satellite to complete one orbit. Theaverage distance of this satellite above thesurface of the Earth is 20, 100 kilometers.To the nearest hour, how long does ittake the GPS satellite to complete oneorbit of the Earth? You are charged $16.7 in total for a meal. Assuming that the localsales tax is 7.6%, what was the menu price of this item? *How would I work this out I keep getting 15.43 but thats not correct Estimate a 15% tip on a dinner bill of 31.51 by first rounding the bill amount to the nearest ten dollars. What have you learned about Nick Carraway in the first two chapters of the novel? How might his background color the way he tells this story? How trustworthy is Nick? How might the perspective of Chapter 1 change if F. Scott Fitzgerald had chosen to narrate the story in the first person from Daisys sophisticated point of view? We are introduced to the valley of ashes and the Eyes of Dr. T.J. Eckleburg in Chapter II. What do you think they may represent? What do they reveal about the setting of the story? A bag contains white marbles and blue marbles, 54 in total. The number of white marbles is 1 less than 4 times the number of blue marbles. How many white marbles are there? If a car has already traveled 10 miles and then continues foranother 6 hours at a steady rate of 30 miles per hour, howmany total miles will it have traveled?miles Izzy's dog is 10 1/2 years old. Paige's dog is 18 months old. How many years older is Izzy's dog? Evaluate: 20 20.8O 24DONE Closer to a point charge, the electrostatic field created is.A. Stronger b . Weaker Factor the following and remember to factor out any common factors first.x^2+8x+15Enter the factors separated by semicolons. ( ; ) Can someone do 11??? Please help I dont want to fail my class We want to use this information to determine if there is an effect of friendship. In other words, is the mean price when buying from a friend the same as (or different from) the mean price when buying from a stranger? Assume the two groups have the same population standard deviation, and use significance level 0.05. Suppose that mu1 is the true mean price when buying from a friend and mu2 is the true mean price when buying from a stranger. (a) What are the null and alternative hypotheses? Which of the following is most often associated with an authoritarian government? A. a multiple political party system B. censorship and control C. freedom of speech and the press D. open and fair elections What is the mean of the following numbers?5, 7, 2,9,5 A group formed to campaign against poverty and racism that spoke out against the war What happens FIRST in the movie Pilots Luck? A)Vivian explores the previous few days. B)Vivian locates her beloved photograph. C)Vivian prepares for her upcoming flight. D)Vivian finds that the picture is missing. at the end of the year dahir incorporated's balance of allowance for uncollectible accounts is $2700 (credit) before adjustment. the company estimates future uncollectible accounts to be $13500. what adjustment would dahir record for allowance for uncollectible accounts?