What type of bond occurs between the nucleotide bases in the codon and the anticodon?
a. ionic
b. covalent
c. hydrogen
d. disulfide bridges
e. peptide

Answers

Answer 1

Answer:

C. Hydrogen bonds

Explanation:

Anticodon refers to the set of three nucleotides present in tRNA. The anticodon is complementary to the codon of mRNA. The nucleotide bases of anticodon and mRNA codons are paired by hydrogen bonds.

Here, the adenine of anticodon makes the hydrogen bond with the uracil base of codon while the guanine base of anticodon forms the hydrogen bond with the cytosine base of the codon.

There is a specific tRNA with an anticodon complementary to the mRNA codon for each amino acid. For example, the tRNA for phenylalanine has an anticodon 3' AAG 5' and binds to the complementary mRNA codon base via hydrogen bonds.


Related Questions

What does it mean to say that double-stranded nucleic acids are
antiparallel?

Answers

Answer:

DNA is the genetic material of all the living organism except some viruses. The structure and the characteristics of the DNA was well explained by Watson and Crick.

DNA is a double stranded molecule in which nitrogenous bases are linked together. Watson and crick explained that DNA strand are antiparallel. The antiparallel nature of the strand means one DNA gas a polarity of 5' to 3' direction whereas the another strand of the DNA gas polarity of 3' to 5' direction. These two strands has opposite polarity and runs in anti parallel directions. Thus, the DNA strand known as antiparallel strands.

Which (if any) of the following statements regarding staphylococcal food-borne illness is not correct? If all of the statements are correct, choose the final answer.
a. the disease is caused by ingestion of a toxin
b. the bacterium that causes the disease is often normal flora in the nose of asymptomatic carriers.
c. the bacterium that causes the disease also causes pus forming wound infections, which can transmit the disease to food.
d. cooking contaminated food to kill the bacteria will prevent transmission of the disease
e. all of the above statements regarding staphylococcal food-borne illness are correct

Answers

Answer:

d. cooking contaminated food to kill the bacteria will prevent transmission of the disease

Explanation:

Staphylococcus is an opportunistic pathogen that normally inhabits our skin and respiratory tract. When this bacteria grows in food it produces different enterotoxins, which are stable at high temperatures. That is why if a food is contaminated with this bacterium, it is possible that it already contains enterotoxin and when it is reheated or cooked, even though the bacteria is killed, the toxin will remain active and will generate the disease.

Scientists discovered a new species of freshwater fish that lives in a pond with a very low O2 level. When they measured the oxygen extraction efficiency of the fish, it was twice as high as that of closely-related fresh water fish. Propose a hypothesis to explain how the fish achieve a high O2 extraction efficiency

Answers

Answer:

In order to propose a hypothesis, there is a need to first see the function of gills in fishes. The gills of fishes comprise blood vessels that exhibit inherited tendencies of getting oxygen out of the water, which was consumed by fishes from their mouths. These gills also comprise thin walls, and when water moves over these walls of blood vessels, the oxygen from water moves into the blood, and then this oxygen-enriched blood goes to various organs.  

Thus, one of the hypotheses in the given case, can be the number of blood vessels, which are found in the gills of the mentioned freshwater fish to be higher in comparison to the blood vessels found in the normal fishes, and apart from this, the surface area of the thin walls, which are found in the gills is also more in the new species of freshwater fish.  

Explain how we know that DNA breaks and rejoins during recombination.

Answers

Answer:

It occurs through homologous recombination

Explanation:

GENERAL RECOMBINATION OR HOMOLOGIST

           Previously we defined its general characteristics. We will now describe a molecular model of this recombination, based on the classic Meselson and Radding, modified with the latest advances. Do not forget that we are facing a model, that is, a hypothetical proposal to explain a set of experimental data. Not all points of this model are fully clarified or demonstrated:

           Suppose we have an exogenote and an endogenote, both consisting of double helices. In recombination models, the exogenote is usually referred to as donor DNA, and the endogenote as recipient DNA.

1) Start of recombination: Homologous recombination begins with an endonucleotide incision in one of the donor double helix chains. Responsible for this process is the nuclease RecBCD (= nuclease V), which acts as follows: it is randomly attached to the donor's DNA, and moves along the double helix until it finds a characteristic sequence called c

Once the sequence is recognized, the RecBCD nuclease cuts to 4-6 bases to the right (3 'side) of the upper chain (as we have written above). Then, this same protein, acting now as a helicase, unrolls the cut chain, causing a zone of single-stranded DNA (c.s. DNA) to move with its 3 ’free end

2) The gap left by the displaced portion of the donor cut chain is filled by reparative DNA synthesis.

3) The displaced single chain zone of the donor DNA is coated by subunits of the RecA protein (at the rate of one RecA monomer per 5-10 bases). Thus, that simple chain adopts an extended helical configuration.

4) Assimilation or synapse: This is the key moment of action of RecA. Somehow, the DNA-bound RecA c.s. The donor facilitates the encounter of the latter with the complementary double helix part of the recipient, so that in principle a triple helix is formed. Then, with the hydrolysis of ATP, RecA facilitates that the donor chain moves to the homologous chain of the receptor, and therefore matches the complementary one of that receptor. In this process, the chain portion of the donor's homologous receptor is displaced, causing the so-called "D-structure".

It is important to highlight that this process promoted by RecA depends on the donor and the recipient having great sequence homology (from 100 to 95%), and that these homology segments are more than 100 bases in length.

Note that this synapse involves the formation of a portion of heteroduplex in the double receptor helix: there is an area where each chain comes from a DNA c.d. different parental (donor and recipient).

5) It is assumed that the newly displaced chain of the recipient DNA (D-structure) is digested by nucleases.

6) Covalent union of the ends originating in the two homologous chains. This results in a simple cross-linking whereby the two double helices are "tied." The resulting global structure is called the Holliday structure or joint.

7) Migration of the branches: a complex formed by the RuvA and RuvB proteins is attached to the crossing point of the Holliday structure, which with ATP hydrolysis achieve the displacement of the Hollyday crossing point: in this way the portion of heteroduplex in both double helices.

8) Isomerization: to easily visualize it, imagine that we rotate the two segments of one of the DNA c.d. 180o with respect to the cross-linking point, to generate a flat structure that is isomeric from the previous one ("X structure").

9) Resolution of this structure: this step is catalyzed by the RuvC protein, which cuts and splices two of the chains cross-linked at the Hollyday junction. The result of the resolution may vary depending on whether the chains that were not previously involved in the cross-linking are cut and spliced, or that they are again involved in this second cutting and sealing operation:

a) If the cuts and splices affect the DNA chains that were not previously involved in the cross-linking, the result will be two reciprocal recombinant molecules, where each of the 4 chains are recombinant (there has been an exchange of markers between donor and recipient)

b) If the cuts and splices affect the same chains that had already participated in the first cross-linking, the result will consist of two double helices that present only two portions of heteroduplex DNA.

Final answer:

DNA breaks and rejoins during recombination to exchange genetic material between chromosomes and create genetic diversity in species.

Explanation:

During recombination, DNA breaks and rejoins to exchange genetic material between homologous chromosomes. This process occurs during meiosis and involves the breakage and rejoining of parental chromosomes. It leads to the generation of novel chromosomes that share DNA from both parents, resulting in genetic diversity in species. The repair of DNA breaks during recombination is essential for accurate DNA repair and the survival of species.

Science depends on ___________________.
A. practice
B. beliefs
C. reasoning
D. evidence
E. luck

Answers

Answer:

The correct answer is option D. Evidence.

Explanation:

Science is the quest and application of understanding and getting information of natural world and some time social world that is obtained by following a systematic procedure that is based on evidence.

Science is established by scientific method which include; observation, evidence, experiment, analysis, and conclusion. All these steps are mandatory to follow scientific method in order.

Thus, the correct answer is option D. Evidence.

why is it important to stain youngcultures of bacteria with
the grain stain?

Answers

Answer:

Because older cultures of gram-positive bacteria tend to lose their ability to retain crystal-violet in the peptidoglycan of their cell walls and can be confused with gram-negative bacteria.

Explanation:

Gram staining is used to differentiate between two major groups of bacteria. Gram-positive and gram-negative, these bacteria differ in the amount of peptidoglycan in their cell walls. Gram-positive bacteria have a higher amount of peptidoglycan, which absorbs the violet crystal complex used in gram staining, staining them purple/violet. Old cultures of gram-positive bacteria tend to lose the ability to retain the violet crystal and are stained by safranine, staining them red/pink and appear to be gram-negative.

Diagram the forces and structures that dictate chromosomal movement during mitosis.

Answers

Answer:

Mitosis  is the biological process by which cell division occurs

Explanation:

-in interphase the nucleolus and its cell membrane are differentiated, and the chromosomes are in the form of chromatin

- in prophase the chromosomes are condensed, and the chromatin is no longer visible

-in metaphase the rolled chromosomes each with their chromatids line up in the metaphase plate

in anaphase the chromatids of each chromosome separate and move towards the poles

in telophase the chromosomes are in each pole, the cell membrane forms again and the cytoplasm is divided.

Finally in cytokinesis cell division is completed

Drag each unit to the correct location.

Identify each unit as belonging to Sl units or US Customary units

gallon

mile

meter

pound

kilogram

degrees Fahrenheit

Kelvin

SI Unit

US Customary Unit

Answers

Answer:

United States (US) customary units is a system of measurement that is used in the United States of America.

International System of Units is the latest most widely used system of measurement. It is abbreviated as SI units.

Gallon (gal): It is a US customary unit used for measuring volume.

Mile (mi): It is a US customary unit used for measuring length.

Meter (m) : It is the SI unit used of length.

Pound (lb): It is a US customary unit used for measuring mass.

Kilogram (kg): It is the SI unit of mass.

Degrees Fahrenheit (‎°F)  : It is a US customary unit used for measuring temperatures.

Kelvin (K): It is the SI unit of temperature.

Non-coding DNA that lies between genes:
a. regulatory regions
b. exons
c. intergenic regions
d. introns

Answers

Answer:

Introns.

Explanation:

The RNA transcript consists of the both the exons and the introns region. The exons are the coding region of the RNA that codes for the particular amino acids.

The introns are the interrupted sequences between the exon. These sequences does not code for any proteins but helps in the alternative splicing. The introns are not present in case of prokaryotes.

Thus, the correct answer is option (d).

Bowman’s capsule is part of the nephron where filtration happens.
a. True
b. False

Answers

Answer: True

Explanation:

The kidneys are the two blood purifying and excretory organs. These discharge excess water, waste metabolites, excess sugars and salts from the body. The nephron is the unit which performs the filtration process in each kidney. The bowman's capsule is the cup like structure inside the tubular part of the nephron. It performs the process of filtration of blood so as to form urine.

Which statements is true of all atoms that are anions?
a. The atom has more electrons than protons.
b. The atom has more protons than electrons.
c. The atom has fewer protons than does a neutral atom of the same element.
d. The atom has more neutrons than protons.

Answers

Answer:

The atom has more electrons than protons.

Explanation:

Ions may be defined as the element that contains either positive or negative charge over it. Two types of ions are cations and the anions. The charge on the species is obtained by the loss or gain of electron.

Anions carry negative charge over them. Negative charge occurs by gaining of the electrons from its neighboring atoms. The number of protons and electrons are equal in neutral atom. Since, the ions gain the electron and hence it carries more protons.

Thus, the correct answer is option (a).

Final answer:

An anion is an atom that has gained electrons and has more electrons than protons.

Explanation:

The correct statement among the options is a. The atom has more electrons than protons.

An anion is a negatively charged ion, which means it has gained one or more electrons. This results in the atom having more electrons than protons, giving it a net negative charge.

For example, consider the chloride ion (Cl-) in table salt. It has 17 protons and 18 electrons, so it has one extra electron, making it a negatively charged anion.

Learn more about Anions here:

https://brainly.com/question/20781422

#SPJ6

Genetically modified food is unsafe because it contains viruses and bacteria that may cause disease.
a. True
b. False

Answers

Answer: False

Explanation:

The genetically modified crops does not contains viruses and bacteria in it. The genetically modified crops has the desired genes that produces protein according to our will.

There are many genetically modified crops that is found today, like Bt brinjal, Bt tomato, Bt cotton and many more.

These crops are rich in minerals and vitamins and has the ability to kill the insects feeding on them.

So, it does not contains any viruses and bacteria that may cause disease.

How might a bacterium resist thekilling effects of a phagolysosome?

Answers

Answer:

There are several mechanisms, like resistance to antimicrobial agents, encapsulation or secretation of proteins that affects and might destroy the phagocyte

Explanation:

Some leukocytes in our body perform phagocytosis as a defense mechanism against the pathogenic bacterium. These phagocytes contain lysosomes, intracellular granules that possess bactericidal substances (especially toxic oxygen species, such as H2O2) and enzymes (proteases, lipases, etc.). When the phagocyte ingests the pathogen, a phagosome is formed, which merges with the lysosome, forming the phagolysosome, which is where toxic substances and enzymes kill the ingested microorganism.

There are several mechanisms by which a microorganism can survive this process:

-Resistance to antimicrobial agents. Some bacteria use phenolic glycolipids from their cell wall, to eliminate toxic oxygen compounds (i.e Staphylococcus aureus and mycobacterium tuberculosis).

-Some pathogens produce a protein called leukocidin, a cytotoxin that destroys the phagocyte and the pathogen is free. Generally, these bacteria are the generators of pus, like Streptococcus pyogenes.

- There are bacteria whose mechanism is encapsulation, increasing their resistance to phagocytosis (i.e Streptococcus pneumoniae). Some even secrete substances on their surfaces, called M proteins, that prevents phagocytosis from completing

Answer: Through the inhibition of the fusion between the phagosome and the lysosome.

Explanation:

Bacteria are pathogens recognized by the immune system. When one of them enters the body, cells of the innate immune system such as dendritic cells or macrophages recognize them and phagocyte them. These bacteria, once inside the immune system cell (called phagocyte), are housed in vesicles called phagosomes. They eventually fuse with lysosomes, which are organelles containing hydrolytic enzymes for the degradation of componentens. When the phagosome, which contains the bacteria, fuses with the lysosome, the bacteria are degraded.

The bacteria may be able to survive inside of phagosomes because they prevent the fusion of the phagosome with the lysosome. And this prevents the discharge of lysosomal enzymes into the phagosome.

This strategy is employed, for example, by M. tuberculosis and Salmonella. This can be achieved through the release of sulfates which are bacterial cell wall components. Those sulfates modify the lysosomal membrane and this inhibits the fusion.

-

Which of the following metabolic processes can occur without a net influx of energy from some other process
a. ADP + P -> ATP + H2O
b. C6H12O6 + 6O2 -> 6CO2 + 6H2O
c. 6CO2 + 6H2O -> C6H12O6 + 6O2
d. Amino acids -> Protein

Answers

Answer: The correct answer is option b

Explanation:

It is the reaction of cellular respiration in which glucose is oxidized to produce energy (ATP). Carbon dioxide and water are produced as byproducts.

It is the reaction which produces energy for all other cellular functions. One molecule of glucose yields around 36-38 ATP molecules.

Rest other reactions such formation of ATP (ADP + P = ATP) gets energy from chemiosmosis produced by cellular respiration. Formation of sugars from carbon dioxide and water (option c) gets energy from solar energy (photolysis). Formation of proteins (amino acids to proteins) or translation is also an energy-driven process. It gets energy from hydrolysis of ATP.

Thus, the correct answer is option b.

Final answer:

The conversion of glucose (C6H12O6) and oxygen (6O2) to carbon dioxide (6CO2) and water (6H2O) can occur without a net influx of energy from some other process. This process, known as cellular respiration, is exothermic and releases energy. Other listed processes (options a, c, d), including creating ATP, photosynthesis, and protein synthesis, require the influx of energy.

Explanation:

The metabolic process that can occur without a net influx of energy from some other process is option b, that is, the conversion of glucose (C6H12O6) and oxygen (6O2) into carbon dioxide (6CO2) and water (6H2O). This process is known as cellular respiration, which is an exothermic reaction that releases energy.

The other processes listed need an influx of energy from another process. For instance, the conversion of ADP + P to ATP + H2O (option a) requires energy. The process by which 6CO2 + 6H2O is converted to C6H12O6 + 6O2 (option c) is photosynthesis, which requires energy from sunlight. Lastly, the conversion of amino acids into protein (option d) is a process called protein synthesis also requires energy.

Learn more about Metabolic Processes here:

https://brainly.com/question/32423707

#SPJ3

What is the difference between Southern and Northern hybridizations?
a. southern blots hybridize a DNA probe to a digested DNA sample but northern blots hybridize a DNA probe to, usually, mRNA
b. southern blots use an RNA probe to hybridize to DNA but northern blots use an RNA probe to hybridize to RNA
c. southern blots determine if a particular gene is being expressed but northern blots determina the homology between mRNA and a DNA probe
d. southern blots determine the homology between mRNA and a DNA probe but northern blots determine if a particular gene is being expressed
e. southern and northern blots are essentially the same technique performed in different hemispheres of the world.

Answers

Answer:

a. southern blots hybridize a DNA probe to a digested DNA sample but northern blots hybridize a DNA probe to, usually, mRNA

Explanation:

Both techniques are quite similar. The main objective of this technique is to identified specific either DNA or mRNA molecules. Hybridization is the process of forming a double - stranded DNA molecule between a single-stranded DNA probe and a single-stranded target DNA (which is the fragment that wants to be found.  Northern blotting targets mRNA while Southern blotting targets DNA sequences.  

Which of the following is not a characteristic that distinguishes gymnosperms and angiosperms from other plants?
a. dependent gametophytes
b. ovules
c. pollen
d. alternation of generations

Answers

Answer:

d. alternation of generations

Explanation:

The alternation of generations is when an organisms lives a part of its life cycle being diploid and other part being haploid in a multicellular state. Plants such us as ferns (Pteridophyte) also have alternation of generations.

Final answer:

Alternation of generations is not a characteristic that distinguishes gymnosperms and angiosperms from other plants, because it is a feature common to all land plants. The other options listed, dependent gametophytes, ovules, and pollen, are unique to gymnosperms and angiosperms.

Explanation:

All of the options listed are characteristics that generally distinguish gymnosperms and angiosperms from other plants, but one of them is also characteristic for most plants: the alternation of generations.

Dependent gametophytes, ovules, and pollen are unique to gymnosperms and angiosperms, serve as distinguishing features. The gymnosperms and angiosperms have a distinctive reproductive strategy involving dependent gametophytes, which are reduced in size and rely on the parental sporophyte, enclosed ovules, and pollen as a transport mechanism for male gametes.

Alternation of generations refers to a life cycle that includes both a multicellular diploid phase (the sporophyte) and a multicellular haploid phase (the gametophyte). This cycle is not unique to gymnosperms and angiosperms and is, in fact, a characteristic of all land plants.

Learn more about Gymnosperms and Angiosperms here:

https://brainly.com/question/30647145

#SPJ3

Discuss the major cell and tissue types found in thetypical animal
body.

Answers

Answer:

Explanation:

The animal body consists of different types of cells. The cells have arisen from unspecialized cells such as stem cells. The stem cells are the totipotent cells that have the capacity of producing different types of cells. The cells are grouped to perform a particular function and called tissues.

The tissues are an aggregation of cells having a similar structure and function. There are mainly 4 types of tissues epithelial tissue, connective tissue, muscular tissue, nervous tissue.  

The epithelial tissues are also 2 types are single epithelial, compound epithelium. The simple epithelial tissues are single-layered cells, and compound epithelial tissue is multilayered cells.

The simple epithelial cells are squamous epithelium, cuboidal epithelium, columnar epithelium, pseudostratified epithelium.  

Connective tissues: These are binding tissues, connect different tissues with the body parts. These tissues consist of cellular parts and ground substances. The connective tissues are 3 types - connective tissue proper, skeletal tissues (bone and cartilage), vascular (blood and lymph).

Muscular tissue :  

These are the specialized tissues meant for contraction and relaxation. Muscular tissue contains 2 contractile tissues - actin and myosin. Muscular tissue is types - striated muscle, smooth muscle, and cardiac muscle.

Nervous tissue: These are highly excitable cells, carry impulse. These include the neurons. Nervous tissues arise from the ectoderm.

RNA is translated into protein by using ______________
a. monosaccharide language
b. nucleotide language
c. fatty acid language
d. amino acid language

Answers

D I believe that’s the answer

When the his—Salmonella strain used in the Ames test is exposed to substance X, no his+ revertants are seen. If, however, rat liver supernatant is added to the cells along with substance X, revertants do occur. Is substance X a potential carcinogen for human cells? Explain.

Answers

Answer:

The test, which is used to examine the tendency of generating mutagens by a chemical is termed as the Ames test. The procedure is primarily used in bacteria to see whether the given chemical results in mutations in the DNA of the organism being examined.  

The positive test demonstrates that the chemical is mutagenic and can function as a carcinogen, this is due to the fact that cancer is associated with the mutation. The performed experiment in the given case indicates that substance X is a potential carcinogen.  

As the rat liver supernatant exhibited the enzymes, which transformed the substance X into mutagen. This led to the origination of his + revertants. The human liver possesses identical enzymes, which process the substance and transforms them into other components. This can cause mutation in human cells and can result in cancer.  

If substance X does not cause his+ revertants in the Ames test alone but does when rat liver supernatant is added, it suggests substance X is metabolized to a mutagenic or potentially carcinogenic form. Hence, substance X could be a potential carcinogen for human cells.

In the Ames test, the his—Salmonella strain is used to test the mutagenicity or potential carcinogenicity of substances. If substance X does not cause any his+ revertants in the presence of the Salmonella strain alone but does when rat liver supernatant is added, it suggests that substance X is being metabolized by the liver enzymes to a mutagenic or potentially carcinogenic form. Therefore, substance X could be a potential carcinogen for human cells as well.

Learn more about carcinogenicity of substance X here:

https://brainly.com/question/32416264

#SPJ3

__________ play(s) an important role in both humoral and cell-mediated immunity.
a. killer cytotoxic (CD8+) T cells
b. neutrophils
c. B lymphocytes
d. Helper T cells (CD4+)
e. all of the above play an important role in both humoral and cell-mediated immunity

Answers

Answer:

d. Helper T cells (CD4+)

Explanation:

There are two kinds of immune responses, innate and adaptative (humoral and cell-mediated):

Innate immunity is the first barries the body has against invaders, most of their responses are non-specific and non-induced, but some use pattern recognition receptor to recognize invaders, some of the leucocytes that are involved in this response are neutrophils, macrophages, and NK killers.

Adaptative immunity

Cell-mediated immunity (CMI) refers to protective mechanisms that are not characterized by antibody, this kind of immunity is responsible for detecting and destroying intracellular pathogens, tumor cells and delayed-type hypersensitivity reactions. This CMI is mediated by lymphocytes T, T helpers identifying endogenous antigens and stimulating Killer cytotoxic (CD8+) T cells that liberate perforating enzymes into the infected cells causing lysis.

Humoral immunity describes the kind of immunity in which antibodies are produced by B lymphocytes to target exogenous antigens. In this kind of response Helper T cells also play a role secreting cytokines to activate the appropriate B lymphocyte.

Hope you find this information useful! good luck!

Answer:

Helper T cells (CD4+)

Explanation:

In the case of hummoral immunity, Helper T cells help in the differentiation of B cells into plasma B cells . The plasma B cells are then involved in the production of antibodies for specific kind of antigens. In the case of cell-mediated immunity helper T cells are involved in releasing cytokines and help differentiate the T cells into cytotoxic T cells. In the case of cell mediated immunity, the affected cell undergoes the process of lysis.

The unit of genetic material not divisible by recombination or mutation is the:
a. coding region of DNA
b. intron
c. exon
d. single nucleotide pair
e. codon

Answers

Answer:

Single nucleotide pair.

Explanation:

DNA is present as genetic material in all the living organism except some viruses. DNA is made of nitrogenous base, pentose sugar and the phosphate group.

DNA can be hydrolyzed further into the single sub units of the nucleotide. The single nucleotide pair unit of the DNA consists of a single nucleotide that can not be broken down further. Mutation or even recombination is not enough for the division of single nucleotide pair.

Thus, the correct answer is option (d).

How are restriction enzymes and ligase used in biotechnology?
a. restriction enzymes cut DNA at specific locations, producing ends that can be ligated back together with ligase
b. only restriction enzymes that produce blunt ends after cutting DNA can be ligated with ligase
c. only restriction enzymes that produce sticky ends on the DNA can be ligated with ligase
d. restriction enzymes can both cut DNA at specific sites and ligate them back together
e. restriction enzymes randomly cut DNA, and the cut fragments can be ligated back together with ligase

Answers

Answer:

A. Restriction enzymes cut DNA at specific locations, producing ends that can be ligated back together with ligase.

Explanation:

Restriction enzymes are one of the endonucleases that cut the DNA at specific base sequences. The base sequences recognized and cut by the  restriction enzymes are known as restriction sites.

Restriction enzymes are used in recombinant DNA technology to cut the DNA at specific sites. Restriction enzymes can produce DNA fragments with sticky ends or blunt ends. These DNA fragments are joined together by DNA ligase enzyme.

For example, the donor DNA and the vector DNA are cut at specific sites using a particular restriction enzyme. The resultant DNA fragments have complementary ends that are ligated together by the action of a DNA ligase enzyme. The result is the insertion of a gene of interest into the vector DNA.

In mitochondria, exergonic redox reactions
a. are the source of energy driving prokaryotic ATP synthesis.
b. provide the energy that establishes the proton gradient.
c. reduce carbon atoms to carbon dioxide.
d. are coupled via phosphorylated intermediates to endergonic processes.

Answers

Final answer:

In mitochondria, exergonic redox reactions mainly provide the energy that establishes the proton gradient necessary for ATP synthesis. These reactions play a crucial role during cellular respiration processes.

Explanation:

In mitochondria, exergonic redox reactions perform multiple roles. The statement that is most accurate is option 'b' - exergonic redox reactions provide the energy that establishes the proton gradient. During processes of cellular respiration such as the Electron Transport Chain (ETC), the energy from these reactions leads to the pumping of protons across the mitochondrial membrane. This creates a concentration gradient which is critical for ATP synthesis. Something important to note is that while these reactions are key for ATP synthesis, mitochondria are typically found in eukaryotes rather than prokaryotes (option 'a').

Learn more about Exergonic Redox Reactions here:

https://brainly.com/question/33587111

#SPJ6

The exergonic redox reactions in mitochondria [Option b] provide the energy needed to establish a proton gradient. This gradient drives ATP synthesis through oxidative phosphorylation.

In mitochondria, exergonic redox responses are a piece of oxidative phosphorylation, which includes the electron transport chain (And so on). Through a series of complexes, electrons are moved from electron donors like NADH and FADH2 to oxygen during this process. The proton motive force is an electrochemical gradient that results from this electron transfer driving the active transport of protons (H+) across the inner mitochondrial membrane. The energy put away in this slope is then used to orchestrate ATP, the principal energy money of cells, through ATP synthase.

Describe why oxygen moves from the air to the blood in the alveolar capillaries and again why oxygen moves from the blood to the interstitial fluid in the body tissues. Why is the partial pressure (concentration) of oxygen so low in the interstitial fluid?

Answers

Answer:

Higher partial pressure of oxygen in alveolar air than that of alveolar capillaries drives the diffusion of oxygen gas from air to the blood.

Higher partial pressure of oxygen in blood at tissue level as compared to the interstitial fluid drives diffusion of oxygen from blood to the tissue fluid.

Consumption of oxygen for cellular respiration in cells reduces the its concentration in the interstitial fluid.

Explanation:

Gaseous exchange in the body occurs through the process of diffusion wherein respiratory gases are exchanges down the concentration gradient.

Since the alveolar air has a higher partial pressure of oxygen than that of blood present in the surrounding blood capillaries, oxygen diffuses from the alveolar air to the blood making the blood oxygen-rich.

As the oxygen-rich blood reaches the body tissues, oxygen is diffused from the blood into the interstitial fluid since the later has lower oxygen concentration.

The supply of oxygen from the blood to the body tissues is required as the cells consume the oxygen to perform aerobic respiration and retrieve energy from the nutrients.

Final answer:

Oxygen moves from the air to the blood and from the blood to the interstitial fluid due to differences in partial pressure, with oxygen continuously diffusing from areas of higher to lower concentration.

Explanation:

Oxygen Movement from Air to Blood and Tissues


The movement of oxygen from the air to the blood in the alveolar capillaries and from the blood to the interstitial fluid in the body tissues is driven by a gradient in partial pressure. Gases like oxygen diffuse from areas of high concentration to areas of low concentration according to Henry's Law. In the lungs, the partial pressure of oxygen is high in the alveoli (around 100 mm Hg) and low in the blood of the pulmonary capillaries (around 40 mm Hg). As a result, there is a strong gradient that drives oxygen diffusion across the respiratory membrane from the alveoli into the blood.

Once in the blood, oxygen binds to hemoglobin in red blood cells (RBCs), which transport it to the tissues. In the body tissues, the partial pressure of oxygen in the blood is higher than that in the interstitial fluid, causing oxygen to diffuse into the interstitial fluid and then into the cells of the tissues where it is used for cellular respiration. The partial pressure of oxygen is so low in the interstitial fluid because oxygen is continuously being consumed by the cells, thereby maintaining the pressure gradient necessary for diffusion.

One of the side effects of anabolic steroids in girls is irregular periods.
a. True
b. False

Answers

Answer:

True.

Explanation:

Anabolic steroids may be defined as the hormones that are taken in the forms of pill or can be directly injected into the body. The muscle mass of the body can be increased by the anabolic steroids.

Anabolic steroids can have negative effects on both the male and females. The anabolic steroids effects on female causes irregular menstrual cycle, moustache and the development of broad shoulders.

Thus, the answer is true.

What is normally present in urine? How does the filtration barrier function to prevent things from entering the filtrate? What does it prevent from entering?

Answers

Answer:

Generally urine comprises about 95 percent water, 2 percent electrolytes, that is, ions of salts, primarily sulphates, chlorides, potassium, bicarbonates of sodium, and others, 2.6 percent urea, 0.3 percent uric acid, and small quantities of ammonia, creatinine, hormones, some of the pigments, hippuric acid, and allantoin.  

The filtration barrier comprises of the glomerular capillaries fenestrated endothelium, the filtration slits of the podocytes, and the fused basal lamina of the podocytes and the endothelial cells. The barrier allows the entry of water, small molecules, and ions from the bloodstream into the space of Bowman capsule.  

The barrier restricts passing of negatively charged and/or large proteins like albumin. The basal lamina of the filtration barrier comprises three layers. Any small molecules like glucose, water, salt, urea, and amino acids can pass freely into the Bowman's space, however, the cells, large proteins, and platelets do not.  

Diferentiate between embryonic stem cells and adult stem cells. In what way are the ethical dilemmas associated with the use of embryonic stem cells different than those posed by the use of adult stem cells?

Answers

Answer:

Explanation:

Embryonic stem cells

These stem cells come from eggs that have been fertilized in vitro during IVF procedure, and were donated for research with the consent of the donors.

They are pluripotent: they have the potential to differentiate into almost any cell in the body.

Adult stem cells

Found in most organs in an individual who has already been born, they are responsible for tissue renewal or repair of damage. They can renew themselves or differentiate into the cell types of the tissue of origin.

They are multipotent, thus limited in their ability to differentiate: they will only produce specific cell types (e.g. neural stem cells produce neurons and glia).

Ethical concerns

The research with embryonic stem cells starts with an embryo in its early stages that can't develop outside the womb. Some people consider this early embryo a human being and are against scientific research with it, while others think that it's not a human being yet and research is not harmful because it couldn't survive unless implanted. In addition, experimentation with embryos could induce unplanned genetic mutations that could cause clinical aberrations if the embryo were implanted and allowed to develop into an adult individual.

In contrast, adult stem cells are not really controversial as they are cells derived from tissues from grown individuals. The main ethical issues are related to donor consent to obtain the cells.

Final answer:

Embryonic stem cells are pluripotent cells derived from early-stage embryos, capable of differentiating into any type of cell. Adult stem cells are multipotent and found in mature tissues, limited to certain cell types. Ethical dilemmas differ due to the source of the cells, with embryonic stem cells being associated with concerns over embryo destruction.

Explanation:

Difference Between Embryonic and Adult Stem Cells

Embryonic stem cells (ESCs) and adult stem cells (also known as somatic stem cells) are both integral to developmental biology and medical research. However, they possess distinct characteristics and capabilities.

Embryonic stem cells are derived from the inner cell mass of a blastocyst, an early-stage pre-implantation embryo. They are pluripotent, which means they have the ability to differentiate into any cell type of the body. In contrast, adult stem cells are found in various tissues of an already developed organism and are multipotent, restricted to becoming a limited range of cell types that are related to their tissue of origin.

The ethical dilemmas surrounding the use of embryonic stem cells mainly revolve around the destruction of human embryos, which raises significant concerns for many individuals and groups. In contrast, adult stem cells raise fewer ethical issues because their harvesting generally does not involve the destruction of an embryo and can sometimes be collected from the patient themselves, offering a more ethical and immune-compatible treatment option. The use of induced pluripotent stem cells (iPSCs) stands as an advancement in the field that circumvents many of these ethical concerns as they are adult cells genetically reprogrammed to behave like their embryonic counterparts.

In humans, a dimple in the chin is a dominant characteristic. a. A man who does not have a chin dimple has children with a woman with a chin dimple whose mother lacked the dimple. What proportion of their children would be expected to have a chin dimple? b. A man with a chin dimple and a woman who lacks the dimple produce a child who lacks a dimple. What is the man's genotype? c. A man with a chin dimple and a non-dimpled woman produce eight children, all having the chin dimple. Can you be certain of the man's genotype? Why or why not? What genotype is more likely, and why?

Answers

A.

Answer:

Let's assign the dominant allele for dimples as - D - and the recessive as – d.

Based on the description, the woman must be heterozygous (Dd) for the dimple allele while the man is homozygous recessive (dd).

For the woman, her mother never had dimples meaning she was homozygous recessive (dd). This means the woman got a dominant allele from his father’s side and one recessive from the mother.

The man and the woman will, therefore, have the chances of bearing offspring as shown in the punnet square below;

50% will have dimples while 50% will not.

B.

Answer:

The same as above (and punnet square attached) because there is merely a switch of genotypes between the sexes as per the description.

C.

Answer:

Yes because in such case, the man is homozygous dominant (DD) for dimple allele. This way all offspring will be heterozygous dominant meaning they'll all have dimples. See the next punnet square (attached)

Final answer:

Dimple in chin is a dominant trait controlled by genes. The children produced by mixed genotypes parents have certain percentages for expressing either trait typically. However, probability may not always translate into real world results due to luck.

Explanation:

In genetics, traits like a chin dimple are controlled by genes. The term genotype refers to the genes of an individual that determine traits. The dominant trait (like a chin dimple in this case) can be denoted by 'B', while the recessive trait (like a smooth chin) is denoted by 'b'. Dominant traits only require one gene (either from the father or mother) to be expressed, while recessive traits require both parent genes to be expressed.

(a) A woman with a chin dimple (B) paired with a man without a chin dimple (b) would result in children who have a 50% chance of having a dimple (Bb), given that the woman would be carrying the recessive trait from her mother.

(b) If a man with a chin dimple (B) and a woman without one (b) produce a child without a chin dimple, it means that the man must have been heterozygous for the trait (Bb), otherwise all the children would have had chin dimples.

(c) If a man with a chin dimple and a woman without one produce all children with chin dimples, the man's genotype is most likely BB. This is because, if it were Bb, there would have been a 25% chance at least one child being without a chin dimple (bb), but if all children have chin dimples, it's more likely that the man is BB.

Learn more about Genetics and Genotypes here:

https://brainly.com/question/9654797

#SPJ3

Skeletal muscles are arranged in antagonistic pairs. What does this mean and what is an example?
A. There are always paired tendons and ligaments; the hip joint.
B. When one sarcomere contracts, the neighboring one relaxes; triceps and biceps.
C. One is under conscious control and one is not; the diaphragm and ribs.
D. There is always paired cartilage and muscle tissue; the knee joint.
E. When one contracts, the other relaxes and this allows the bones to move; triceps and biceps.

Answers

Answer: E. When one contracts, the other relaxes and this allows the bones to move; triceps and biceps.

Explanation:

Antagonistic action occurs between the two pairs of muscles. In this action one muscle while contracts other muscle relaxes. The example of antagonistic pair is of biceps and triceps. The triceps remain in the relax phase while the biceps contracts so as to lift the arm.

Assume that genes A and B are 50 map units apart on the same chromosome. An animal heterozygous at both loci is crossed with one that is homozygous recessive at both loci. What percentage of the offspring will show recombinant phenotypes? Without knowing that these genes are on the same chromosome, how would you interpret the results of this cross?

Answers

Answer:

Explanation:

The homozygous recessive individual can only produce 1 type of gamete (aabb).

The heterozygous individual can produce 8 types of gametes, of which 2 are parental and the rest are recombinant.

Genetic distance (m.u.) = Frequency of Recombination (%)

If the distance between genes A and B is 50 m.u., 50% of the gametes produced by the heterozygous individual, and therefore the offspring, will have recombinant phenotypes.

Without knowing that the genes are located on the same chromosomes, I'd think they are on different chromosomes, because you would get the same result: 50% recombinant offspring.

Whenever the genes on the same chromosome are separated by at least 50 m.u., or they are in different chromosomes, crossing over between them can happen with no restrictions and they will behave as independent of one another.

Final answer:

Given a genetic distance of 50 map units (centimorgans, cM), we would expect to see approximately 50% of offspring expressing recombinant phenotypes due to recombination or crossover events. This rate corresponds to a 50% recombination frequency. If we didn't know the genes resided on the same chromosome, we'd expect a Mendelian ratio assuming independent assortment.

Explanation:

Given the genetic distance of 50 map units or centimorgans (cM) apart, genes A and B indicate that they are far apart on the same chromosome. Thus, the likelihood of recombination or crossover events between these genes resulting in recombinant phenotypes is high. Specifically, the recombination frequency corresponds to the genetic distance, meaning that with a distance of 50 cM, we expect about 50% of the offspring to express recombinant phenotypes.

Since you asked how one might interpret this information without knowledge of these genes being on the same chromosome, it is important to mention that if we didn't know this, we would expect to see Mendelian ratios assuming independent assortment of the genes. That is, the appearance of recombinant and parental types would be approximately equal, again indicative of a 50% recombination frequency.

This is due to the random segregation during the formation of gametes, where it's equally likely that either allele from one parent will be passed on to the offspring. This recombination frequency therefore, indicates that every type of allele combination is represented with equal frequency or 50 percent of offspring are recombinants. The other 50 percent retain the original, parental combinations of traits.

Learn more about Genetics here:

https://brainly.com/question/30459739

#SPJ11

Other Questions
While you are returning from lunch, a frantic woman flags you down and states that she just found a young child on the roadside who appears to have been hit by a car. She is not sure if the child is breathing. You should immediately:A) inform the woman that she will need to calm down.B) advise dispatch that you have been flagged down for a possible emergency.C) grab equipment and get to the child's location.D) call for paramedic assistance and await their arrival. Kyle, a 5-year-old boy, has been growing by leaps and bounds; his height is 100% above normal for his age. He has been complaining of headaches and vision problems. A CT scan reveals a large pituitary tumor. A) Which hormone is being secreted in excess? B) Which condition will Kyle exhibit if corrective measures are not taken? C) What is the probable cause of the headaches and visual problems? What is the most important use of repetition in poetry? What is the root word for spherical? A. sphere B. here or C. her? 4y+2x=180 solve for x and y Distinguish between sister chromatids and non-sister chromatids. The speed of light in a vacuum is 2.998 x 108 m/s. What is its speed in kilometers per hour (km/h)? K speed = What is its speed in miles per minute (mi/min)? speed = mi/min How many core electrons does magnesium (Mg) have? Human-centered technology often recommends _______aoto computer designers and manufacturers, telling them how to make systems and the devices that support them more user-friendly. What impact would low blood pressure have on kidneys? What symptoms might you expect with a decrease in kidney functions? Molteni Motors Inc. recently reported $3.25 million of net income. Its EBIT was $6.25 million, and its tax rate was 35%. What was its interest expense? (Hint: Write out the headings for an income statement and then fill in the known values. Then divide $3.25 million net income by 1 T = 0.65 to find the pre-tax income. The difference between EBIT and taxable income must be the interest expense.) Enter your answer in dollars. For example, an answer of $1.2 million should be entered as 1,200,000. Round your answer to the nearest dollar. What are the three main types of money?A) credit, commodity, representativeB) fiat, commodity, creditC) representative, credit, fiatD) commodity, representative, fiat How much exercise should teens do daily Fiona shares an office with her exminushusband. Her share of the rent and utilities is $625 per month. She is considering moving to a home office which she will not have to share with anyone. The home office will not cost her anything as far as extra rent or utilities. Recently, you ran into Fiona at the gym and she tells you that she has moved into her home office. Fiona is as rational as any other person. As an economics major, you rightly conclude that ______ Can someone help me with this problem? It has to be in PEMDAS order. 16+(4*2/2)-4 I think it's 18 but I'm not sure The bases of one of the strands of DNA in a region where DNA replication begins are shown here. What is the sequence of the primer that is synthesized complementary to the bases in bold? (Indicate the 5' and 3' ends of the sequence.) 5' AGGCCTCGAATTCGTATAGCTTTCAGAAA 3' what is 3.149 rounded to the nearest hundredth What did the Gestapo and SS do? What is different about the number of course options kids get in virtual schools compared to typical schools? I don't know how to solve this: In a pair of complementary angles, one angle measures 18* less than three times the other angle. Find the measure of each angle.