What type of transport does not require energy to move molecules across the plasma membrane?

concentration gradient

passive

bilayer

active

Answers

Answer 1

Answer:

Passive transport

Explanation:

Passive transport can easily be described as transport of atoms, molecules or ions across the cell membrane without requiring energy. The capability of a system towards growing in entropy is the reason that passive transport does not require any cellular energy, unlike the active transport. The permeability of the cell membrane depicts the rate of transfer of molecules, ions or atoms by passive transport, into and out of the cell.

Answer 2

Answer:

I just did the test and answer is passive transport

Explanation:


Related Questions

What is the first step of the Calvin-Benson cycle?

ATP and NADPH combine to make G3P.

G3P is used to make glucose and other
compounds.

ATP and G3P combine to make RuBP.

Carbon dioxide and RuBP combine to make PGA.

Answers

Final answer:

The first step of the Calvin cycle is the combination of carbon dioxide with RuBP to produce PGA. This step is catalyzed by the enzyme RuBisCO and is the initial act of carbon fixation in the photosynthetic process of converting atmospheric carbon dioxide into glucose.

Explanation:

The first step of the Calvin-Benson cycle, also known simply as the Calvin cycle, involves the enzyme RuBisCO fixing carbon dioxide to a five-carbon molecule called ribulose biphosphate (RuBP). This reaction produces two molecules of 3-phosphoglycerate (PGA). Therefore, the correct first step of the Calvin-Benson cycle is: Carbon dioxide and RuBP combine to make PGA.

The Calvin cycle is a process of photosynthesis where ATP and NADPH, produced in the light-dependent reactions, provide the energy to convert carbon dioxide from the atmosphere into organic compounds like glucose. Throughout the cycle, the energy is used to regenerate RuBP, allowing the cycle to prepare for more carbon fixation and continue the process of photosynthesis.

if the results of an experiment do not support a scientist’s hypothesis, what should the scientist conclude?

A. her hypothesis was bad.

B. she must have made a mistake or forgotten something.

C. she should give up on research.

D. she may want to alter some aspects of the experiment and try again.

Answers

Answer:

D

Explanation:

because there is no bad hypothesis,

mistakes happena and thats why she should try again,

never give up

D is only logicall

If the results of an experiment do not support a scientist's hypothesis, the scientist should conclude B. She must have made a mistake or forgotten something.

What can be concluded

Scientists understand that experiments can yield unexpected results due to various factors such as errors in the experimental procedure, flawed equipment, or unaccounted variables.

Therefore, the scientist should consider the possibility of errors or overlooked factors before drawing any definitive conclusions about the hypothesis. This is a fundamental principle of scientific inquiry and methodology.

Read more on scientist’s hypothesis  here https://brainly.com/question/606806

#SPJ3

What results from the oxygen atom being at one end of a water molecule and the hydrogen atoms being at the other end?

Answers

Answer:

The unequal sharing of electrons gives the water molecule a slight negative charge near its oxygen atom and a slight positive charge near its hydrogen atoms. When a neutral molecule has a positive area at one end and a negative area at the other, it is a polar molecule.

Explanation:

Final answer:

The water molecule's polarity results from the oxygen atom having a partial negative charge and the hydrogen atoms a partial positive charge, leading to unique properties like hydrogen bonding and high boiling and melting points.

Explanation:

The arrangement of two hydrogen atoms and one oxygen atom in a water molecule leads to a molecular geometry where the hydrogen atoms are on one side and the oxygen atom is on the other. This geometry creates a polar molecule due to the uneven distribution of electronic charge. Oxygen is more electronegative, meaning it has a greater ability to attract electrons towards itself, resulting in a partial negative charge on the oxygen end, while the hydrogen ends hold a partial positive charge.

Because of this separation of charges, the water molecule has a net dipole moment, with the dipole pointing from the hydrogen atoms towards the oxygen atom. This dipole-dipole characteristic gives water its unique properties, such as its ability to dissolve many substances and its high boiling and melting points in comparison to molecules of similar size. Furthermore, the polar nature of water facilitates the formation of hydrogen bonds between adjacent water molecules, which is essential to many of water's characteristics necessary for life.

Describe the genotype ration for their offspring

Answers

Offspring is coming back from the genome ration

Answer: The Genotypic Ratio describes that the number of times a genotype would appear in offspring after a test cross. Take this for example. A test cross that is between two organisms with the SAME Genotype, Rr, for a Heterozygous dominant trait, it will result in the offspring with the Genotypes...RR, Rr, & rr. This is also a ratio that of all possible gene combos that are all based on the alleles, they are contributed with their parents. We don't really often see this Genotypic ration when we look at an organism, we only see the results of its affects.

I hope this helps you!

The tilting or folding of horizontal layers must occur _____. A. after the layers have formed B. before the layers have formed C. during the formation of the layers

Answers

Answer: A

YYYYYYYEEEEEETTTT

Answer:

Option (A)

Explanation:

The layers that creates folding or tilting are found in the sedimentary rocks. These rocks are formed due to the compaction and lithification of sediments. For example, sandstone, shale and mudstone.

This rocks when deposited over one another, it forms layers. These layers are then subjected to folding or tilting due to the compressional stress (tectonic forces).

Before forming the layers, if the rock is subjected to compressional stress, then the sediments will not form layers and there occurs no folding. Whereas it will shatter the rock.

Thus, the correct answer is option (A).

If you were to place the bear into the energy pyramid, the bear would go on level _____ and have ________ amount of energy available to it.

Answers

Answer:

The greatest in the first blank

the least in the second blank

Explanation:

In the energy pyramid, bears would be placed as tertiary consumers (or higher) and would have about 10 percent of the energy available from the trophic level below them, which is considerably less than what is available at the base of the pyramid.

If you were to place the bear into the energy pyramid, the bear would go on level tertiary consumer (or higher, depending on the specific diet of the bear) and have approximately 10 percent of the energy available to it from the level below.

Bears are typically classified as omnivores or occasionally as carnivores, depending on their diet. Assuming that producers in this pyramid have 1,000,000 kilocalories of energy, primary consumers would have 10 percent of that, which is 100,000 kilocalories. Since energy transfer between trophic levels is about 10 percent, the energy available to secondary consumers would be 10,000 kilocalories (10 percent of primary consumers), and the tertiary consumers would have approximately 1,000 kilocalories available to them (10 percent of secondary consumers). Bears, being tertiary consumers or sometimes quaternary when consuming other carnivores, would fall into the category with significantly less energy availability compared to the bottom of the pyramid.

What makes a solid different than a liquid

Answers

A solid is different than a liquid because of it's "molecules." A solid molecules aren't moving they are compacting and shaking, while liquid molecules are slowly moving around but aren't compacted together. Also solids are different then liquids because of "shape, and size." Solids have a shape while liquids do not just like how size is different also.

Hope this helps.

Final answer:

A solid differs from a liquid in terms of their particle arrangement and movement. Solids have closely packed particles in a regular pattern, while liquids have particles that can move past each other and flow.

Explanation:

A solid and a liquid are two states of matter that differ in their particle arrangement and movement. In a solid, the particles are closely packed together in a regular pattern and vibrate but do not move past each other. This allows solids to maintain their shape and volume. On the other hand, liquids have particles that are close together but are not in a regular pattern. These particles can move past each other, allowing liquids to flow and take the shape of their container.

Learn more about Difference between solid and liquid here:

https://brainly.com/question/34445511

#SPJ2

What atoms make up sugar molecules, amino acids, and fatty acids?

Answers

Sugar molecules make up carbohydrates, amino acids are responsible for protein and fatty acids are makeup lipids or fats.

Sugar molecules are simple carbohydrates called monosaccharides and are structural units of all the carbohydrates by link with one another like a chain. The three important sugar molecules are Glucose, fructose, and galactose provide nutrition.

Amino acids are hundreds or thousands of smaller units that bind with one another in a chain-like structure called a polypeptide chain that is a form of Proteins. There are 20 types of amino acids that link together in a different sequence to form various proteins.

Fatty acids are a straight chain of an even number of carbon atoms, smaller units of lipids or fatty acids that binds in huge number with one another.

All three are the essential for nutrition of organisms, therefore, the correct answer is -carbohydrates, protein, and lipids.

Learn more about:

https://brainly.com/question/14101979

Final answer:

Sugar molecules, amino acids, and fatty acids all contain carbon, hydrogen, and oxygen. Sugars have a ring structure, amino acids a central carbon with an amino group, carboxyl group, and R group; and fatty acids a carbon chain with a carboxyl group.

Explanation:

Sugar molecules, amino acids, and fatty acids are all vital biological molecules composed of carbon, hydrogen, and oxygen atoms. Sugars like glucose have a ring structure with multiple hydroxyl groups, amino acids have a central carbon atom (alpha carbon) bonded to an amino group (NH₂), a carboxyl group (COOH), a hydrogen atom, and a variable R group which defines the amino acid. Fatty acids are long chains of carbon atoms with a carboxyl group at one end. Each type of molecule plays a crucial role in the structure and function of living organisms.

Fatty acids differ slightly because they aren't linked together in long chains like proteins or polysaccharides, but rather, they are commonly found in groups of three attached to a glycerol molecule to form triglycerides, which are a type of fat.

Which of the following describes a medical drug

Answers

Assuming A.L,

Which of the following describes a medical drug?

A) A bacterium that causes a human disease

B) A virus that is passed from person to person

C) A physiological symptom related to a sickness

D) A chemical substance used to treat disease

The correct answer is D) A chemical substance used to treat disease.

A chemical substance used to treat disease.

A medicine (also called medicament, medicinal drug, pharmaceutical drug, remedy, or definitely drug) is a drug used to diagnose, remedy, deal with, or prevent sickness.

What are the 7 types of drugs?

Central Nervous System (CNS) Depressants. CNS Stimulants. Hallucinogens. Dissociative Anesthetics. Narcotic Analgesics. Inhalants. Cannabis.

Learn more about medical drugs here https://brainly.com/question/26254731

#SPJ2

Describe how the branches on a cladogram show the relationships among organisms.

Answers

Answer:

relationships among organisms and evolutionary relationships for organisms with a shared common ancestor.

Final answer:

Cladograms use branches to show evolutionary relationships by illustrating how species diverged from common ancestors, with nodes representing the emergence of new traits.

Explanation:

The branches on a cladogram illustrate the evolutionary relationships among organisms by showing how groups of organisms diverged from common ancestors over time. Each branch or node represents a point where a new trait emerged, distinguishing one group from others, thereby forming a new clade. The length of the branches can indicate the amount of molecular changes that have occurred over time. As organisms evolve, they might acquire unique traits that set them apart from their ancestors, and these traits can also be represented on the cladogram.

For instance, in a cladogram that includes mammals, reptiles, and birds, the reptile clade includes birds, indicating that birds evolved from reptiles, contradicting the separate classification by Linnaeus. By observing the branching patterns and the traits at each node, we can interpret phylogenetic relationships and hypothesize how different species are related by descent.

If you look at the sky and see the Moon as
a half-circle, what do you expect should be
true about the tides that day?
A. The low tides will be much lower than
usual.
B. The high tides will be much higher
than usual.
C. There will be no tides that day.
D. There will be little difference between
low and high tide.

Answers

Answer:

answer is Bthe high tides will be much higher than usual


What term describes the ability of an animal to know the meaning of the signals it sends and receives?

behavior

instinct

communication

cognition

Answers

Answer:

I am thinking it is cognition..

cognition-the mental action or process of acquiring knowledge and understanding through thought, experience, and the senses.

If not it will be instinct

Explanation:

Answer:

The correct answer is cognition.

Explanation:

Cognition in animals is a process by which animals get information and learning by using their experience, senses, intelligence, perception, memory.

It gives the ability of an animal to know the meaning of the signal it sends and receives by using its senses and experience. The ability of cognition is very much important for animals because it helps them to differentiate between dangerous and non-dangerous chemical signals.

It also helps them to know their territory by marking through chemical signals in their territory and getting their mates. Therefore the correct answer is cognition.

The invention of which instrument allowed scientists to discover cells?
a. eyeglasses
b. magnifying glass
c. microscope
d. telescope

Answers

C. Microscope
They were able to get magnification like never before

The invention of microscope allowed scientists to discover cells.

As a microscope we call an instrument that is used for the observation of objects too small (such as cells) to be seen with the naked eye.

The microscope is an optical instrument that increases the capacity of observation to levels of close-up such that it even makes possible the analysis of particles.

This instrument was invented by Zacharias Janssen in the year 1590.

In 1665, the research carried out by William Harvey on blood circulation appeared, by analyzing blood capillaries.

From then on, technical progress has been made by increasing the magnification level of microscopes, and this in turn, making the study of cells possible.

In the middle of the 20th century, the invention of the electron microscope made it possible to know the three-dimensionality of cell structures and the spatial distribution of the molecular components within them.

Therefore, we can conclude that the invention of microscope allowed scientists to discover cells.

Learn more here: https://brainly.com/question/19314250

What mass of water in grams will fill a fish tank 100 cm long, 50 cm wide, and 30 cm high?

Answers

Answer:

150,000cm^3, or 1,500m^3

Explanation:

The question is basically asking the volume of this rectangular tank.

The formula to find the volume is length x width x height.

This is because we're trying to find the area of the base (length x width), and then we're multiplying the base times the height, to get how much of the base area can fit in the height of the rectangle.

So, the answer is 100cm x 50cm x 30cm = 150,000cm^3, or 1,500m^3, because 1 meter = 100 centimeters.

Relate Locard's Principle of Exchange to trace fiber evidence.

Answers

Answer:

Person to person contact, person to item contact, direct transfer and secondary transfer

Explanation:

Final answer:

Locard's Principle of Exchange states that contact between two objects always results in an exchange of materials, which in forensic science is used to link suspects to crime scenes or victims through trace fiber evidence.

Explanation:

Locard's Principle of Exchange is crucial in forensic science. It states that when two objects come into contact, there is always a transfer of material. When relating this to trace fiber evidence, it implies that fibers from a suspect's clothing may be transferred to a victim or crime scene, and vice versa. This trace evidence can be collected and analyzed to establish a connection between individuals and locations involved in a crime. Therefore, just as particle exchange signifies the transfer of elementary particles between entities, the transfer of fibers is evidence of physical contact in a legal context, embodying the principles set forth by Edmond Locard.

The purpose of a taxonomic system is to allow for a scientific _____________ throughout the world.

Answers

Answer:

Standard

Explanation:

The purpose of a taxonomic system is to allow for a scientific Standard throughout the world

Water's high heat of vaporization allows it to cool us off when we sweat.
True
False

Answers

False.

You’re body uses sweat to cool off in high temperatures. I don’t think vaporization has anything to go with it. Also, the water wouldn’t be hot since you’re cooling off by using it.

Answer:

false

Explanation:

Isabelle decides to shave a 1 x 2-inch patch of her hair and the same-sized patch of her

dog's hair. She then measures the growth every day for three weeks.

i 7) What question is Isabelle trying to answer?

Answers

Final answer:

Isabelle is trying to answer the question: how does the hair of both herself and her dog grow over the course of three weeks after shaving a 1 x 2-inch patch?

Explanation:

Isabelle is trying to answer the question: how does the hair of both herself and her dog grow over the course of three weeks after shaving a 1 x 2-inch patch? By measuring the hair growth every day, Isabelle can observe how much the hair has grown and analyze any differences in growth between her and her dog. This experiment can provide insights into the hair growth cycle and factors that affect it.

Learn more about hair growth here:

https://brainly.com/question/32285260

#SPJ12

Isabelle's experiment involves studying the effect of species on hair growth. Key variables include the species as the independent variable and hair growth as the dependent variable.

Isabelle's experiment on hair growth involves multiple factors that need to be classified correctly:

Problem Question: What is the effect of species on hair growth?Independent Variables: The species (human vs dog)Dependent Variables: The length of hair or the amount of growthControlled Variables: Size of shaved patch; length of time hair growsExtraneous Variables: The dog might not let her be measured; different human hairs grow at different rates; this is not accounted forWays to Perform Experiment: Shave patches of her hair and her dog's hair and then measure the growth of hair in those patches with a ruler every day for 3 weeksThings to be Done to Improve This Experiment: Add a control group; include more subjects, humans, and more dogs of the same breed; increase the length of time the experiment is conducted

The effect of species on hair growth can be studied by shaving patches of hair from both humans and dogs, measuring the growth over three weeks, and accounting for various controlled and extraneous variables.

Complete question: Match with appropi]riate classifications: Isabelle decides to shave a 1 x 2-inch patch of her hair and the same-sized patch of her dog's hair. She then measures the growth every day for three weeks.
Column A: What is the effect of species on hair growth? Shave patches of her hair and her dog's hair and then measure the growth of hair in those patches with a ruler every day for 3 weeks. The species The length of hair or the amount of growth Size of shaved patch; length of time hair grows The dog might not let her be measured. Different human hairs grow at different rates; this is not accounted for Add a control group; include more subjects, humans and more dogs at the same breed; increase the length of time the experiment is conducted.
Column B: Dependant variable, ways to perform experiment,extraneous varible, things to be done to improve this experiment, problem question, controlled variables, independant variables.


When you place a ball at the top of a hill and it accelerates toward the bottom
of the hill, it probably also experiences both
and
O
A. sliding friction, rolling friction
O
B. rolling friction, air resistance
O
c. sliding friction, air resistance
O
D. rolling friction, sliding friction

Answers

Answer: rolling friction, air resistance.

Explanation:I just took the test on apex

Answer:

Rolling Friction and Air Resistance

what does the chloroplast produce during the light independent reactions of photosynthesis?

a. NADPH molecules

b. ATP molecules

c. carbohydrate molecules

d. chlorophyll molecules

Answers

Answer:  c.- Carbohydrate molecules

Explanation:

-The light-independent reactions, or dark reactions, of photosynthesis are chemical reactions that convert carbon dioxide and other compounds into glucose. These reactions occur in the stroma, the fluid-filled area of a chloroplast outside the thylakoid membranes.

-These reactions use the ATP and NADPH synthesized during the exergonic light-dependent reactions to provide the energy for the synthesis of glucose and other organic molecules from inorganic carbon dioxide and water.

1. What is the usual cause of a harmful increase in the nutrients in a freshwater lake?
a. Global Warming
b. Runoff of fertilizers and sewage
c. Loss of biodiversity
d. Seasonal variations in rainfall.

Answers

Answer:

B

Explanation:

The purpose of a taxonomic system is to allow for a scientific _____________ throughout the world.

Answers

Final answer:

The purpose of a taxonomic system is to allow for a scientific classification throughout the world.

Explanation:

Taxonomy, sometimes referred to as the Linnaean system, is the science of naming and grouping species to construct an internationally shared classification system.

This system uses a hierarchical model which includes a series of nested groups, akin to directories on a computer, or the organization of a grocery store from departments down to individual products. This hierarchical structure begins with three large categories known as domains: Bacteria, Archaea, and Eukarya, and continues with increasingly specific categories: kingdom, phylum, class, order, family, genus, and species.

Scientists in the field of systematics provide crucial information on how organisms are similar or different, and this contributes to building, updating, and maintaining the "tree of life". As new species and character information are discovered by scientists, these taxonomic trees evolve to reflect more accurate data and to provide a consistent framework for classification across the world.

The purpose of a taxonomic system is to allow for a scientific classification throughout the world.

A taxonomic system is a method by which scientists classify and categorize organisms based on shared characteristics. The term classification refers to the process of arranging organisms into groups or categories based on their similarities and differences. This system enables scientists to organize the vast diversity of life into a hierarchical structure, which includes domains, kingdoms, phyla, classes, orders, families, genera, and species.

The taxonomic system is crucial for several reasons:

1. Identification: It provides a way to identify organisms and assign them to specific groups. This is important for communication among scientists and for keeping track of the world's biodiversity.

2. Understanding Relationships: By classifying organisms, we can understand their evolutionary relationships and how they are related to one another. This can provide insights into the mechanisms of evolution and the history of life on Earth.

3. Scientific Research: Classification helps researchers to focus on specific groups of organisms and understand their unique characteristics, behaviours, and ecological roles.

4. Conservation: It aids in the identification of species that are endangered or in need of protection, which is essential for conservation efforts.

5. Resource Management: Taxonomy is used in the management of natural resources, including agriculture, forestry, and fisheries, by helping to identify and manage pests, beneficial organisms, and economically important species.

6. Global Standardization: A standardized taxonomic system allows for consistency in naming and classifying organisms across different countries and languages, facilitating international collaboration and data sharing in biological research.

The taxonomic system is dynamic and can change as new information becomes available, particularly with advances in molecular biology and genetics that provide new insights into the relationships among organisms.

Name the 4 types of bonds carbon can form

Answers

Answer and Explanation: Carbon can form single bonds (sharing of 2 electrons), double bonds (sharing of 4 electrons), and/or a triple bond (sharing of 6 electrons

Answer:Single, double, triple, and quadruple form

Explanation:

Water has many unique properties attributed to its polarity. Which correctly pairs the water property with a correct example of the property. A) A solid (ice) is more dense than a liquid (water) so it sinks. B) Surface tension is caused by the cohesion or "stickiness" of water molecules. C) Due to cohesion, water is the universal solvent, dissolving most nonpolar substances. D) Due to water's high specific heat, the temperature of water rises and falls very quickly allowing bodies of water to moderate air temperat

Answers

Answer:

b

Explanation:

because i said so

Answer:

Option B, Surface tension is caused by the cohesion or "stickiness" of water molecules.

Explanation:

The water molecules have a unique property of attracting each other resulting into surface tension. Hence option B is correct

Option A is incorrect because solid water i.e ice is 9 % less dense than the liquid water and hence it floats on water

Option C is incorrect because water is  considered as a good solvent because of its polarity .

Option D is incorrect because water takes time to get heated due to its high specific heat.

Explain what would happen to the population of frogs if:.
a) Grasshoppers were to be killed by an insecticide? (2 marks)​

Answers

Some species are more likely to perish but, the most healthy frogs will most likely evolve and find something else to eat.

The killing of grasshoppers by an insecticide would likely lead to a decline in the frog population due to decreased food availability, with potential ecosystem-wide effects. Frogs might suffer from nutritional shortages and be forced to seek out less suitable food sources, affecting their reproductive success and survival.

If grasshoppers were to be killed by an insecticide, we could predict several effects on the population of frogs that feed on these insects. First, the immediate availability of food for frogs would decrease, potentially leading to a decline in their numbers due to starvation or poor nutrition. This could put pressure on the frogs to find alternative food sources, which might not be as nutritious or abundant as grasshoppers. Additionally, the loss of grasshoppers could disrupt the local ecosystem since grasshoppers often play a role in plant pollination and the cycling of nutrients. The ecosystem dynamics could shift, causing further indirect effects on the frog population and other species within the food web. If grasshoppers are a significant food source, the decrease could directly affect frogs' reproductive success and survival rates, potentially leading to their population decline.

What is the most likely explanation of the data shown below?
Year Dark moths Light moths
50% 50%
599
4196
68%
324
8096
2096
95%
10096 0%
NO
a. There has been a drought in the area that is affecting all life forms.
b. The population of natural predators of the moths has gotten smaller.
c. The moths are living in an environment with light trees.
d. The moths are living in an environment with dark trees.​

Answers

Answer:

D) The moths are living in an environment with dark trees.

Explanation:

Answer:

Option D

Explanation:

The dark colored moths are increasing with time. This clearly indicates that the dark colored moths are able to save themselves from the predators. The predators of moth identify them only by the contrasting color of the moth and its habitat. Moths live on trees. Thus, if dark colored moths are able to survive, they might be living in habitat which could make them untraceable. Hence, it is obvious to say that dark colored moths are living on dark trees. Also the light colored moths are living on dark trees and this is the reason why they are easily identified and killed by the predators.

Thus, option D is correct

Which of the following substances is a base?
A. Vinegar
B.lemon juice
C. Water
D. Liquid soap

Answers

Answer:

liquid soap is a base

Explanation:

liquid soap is made from a base material in which its pH is more than pH 7 while, lemon jiuce, vinegar are acidic in nature with water as neutral

Final answer:

The correct answer is D. Liquid soap.

Explanation:

The correct answer is D. Liquid soap.

A base is a chemical substance capable of participating in reactions by accepting hydrogen ions (H+) or donating hydroxide ions (OH-). In the context of liquid soap, it often contains compounds such as sodium hydroxide (NaOH) or potassium hydroxide (KOH). These substances have the capacity to act as bases, and their presence in soap formulations allows them to effectively emulsify oils and fats. Consequently, liquid soap can both clean and sanitize surfaces due to the chemical properties of these base compounds, making them valuable components in everyday cleaning and hygiene products.

Learn more about bases here:

https://brainly.com/question/37020951

#SPJ3

Look at the diagram of the solar system. The solar system shows the sun and planets in their orbits around Earth in this order: Moon, Mercury, Venus, Sun, Mars, Jupiter, Saturn. What observation did this geocentric model of the solar system help to explain? orbit speed the phases of Venus retrograde motion the rising of the Sun

Answers

Answer: c....retrograde motion

The geocentric model of the solar system helped to explain the retrograde motion of Venus.

Retrograde motion, the apparent backward movement of a planet in the sky, is a phenomenon attributed to the differing orbital speeds of planets within the solar system.

Venus, in particular, exhibits retrograde motion due to its orbital relationship with Earth.

As Venus completes its orbit around the Sun, there are times when it outpaces Earth, moving ahead in its orbit, and times when it lags behind.

The geocentric model, an early conceptualization of the solar system, played a pivotal role in explaining retrograde motion.

This model positioned Earth at the center of the universe, with other celestial bodies, including Venus, orbiting around it.

The understanding derived from this model helped clarify why retrograde motion occurs.

When Venus is positioned ahead of Earth in its orbit, the relative motion creates the illusion of backward movement when observed from Earth.

As Earth catches up and overtakes Venus, the normal forward motion resumes.

Although the geocentric model has been superseded by the heliocentric model, where the Sun is at the center of the solar system, the fundamental principle of varying orbital speeds contributing to retrograde motion remains unchanged.

This celestial dance continues to captivate astronomers, offering insights into the dynamic interactions and relative positions of planets in our solar system.

For such a more question on solar

https://brainly.com/question/1286910

#SPJ2

Select all the correct answers. A colorimeter is an instrument used for chemical analysis by comparing a liquid’s color with standard colors. In an experiment, a scientist used two colorimeters and noted the readings. The first colorimeter showed consistent readings that were five points lower than the actual reading. The second colorimeter provided readings that were the same as the actual reading. Which two statements are implications of these readings? The first colorimeter is reliable but not valid. The second colorimeter is valid and reliable. Both the colorimeters are reliable and valid. The readings of the first colorimeter can be used without repeating the experiment. The readings of the second colorimeter aren’t reliable and can’t be used for the experiment.

Answers

Answer:

The first colorimeter is reliable but not valid

The second colorimeter is valid and reliable

A chemical analysis of the colored solution was done. The readings of the first colorimeter are not the actual readings while the second colorimeter gives the readings same as the actual readings. So statements A and B are the implications of the readings.

What is a colorimeter?

Colorimeter is a device that is used to measure the ability of a colored solution to transmit light through it. The concentration of the light-absorbing solute is determined using the colorimeter. When a light beam passes through a colored solution, some part of the incident light is reflected back, some part is absorbed into the solution while some part is transmitted. The colorimeter is sensitive to light and it measures the amount of light that is transmitted and absorbed by the solution.

The colorimeter is based on the principle of absorption of a certain light wavelength by the colored compounds present in the solution.

To know more about the colorimeter, refer to the link:

https://brainly.com/question/31446323

#SPJ5

Explain what would happen to the population of wolves if
a) A sudden frost were to kill many green plants in this food web?​

Answers

Answer: the wolves would starve

Explanation:

the grass fed the deer, rabbits, etc they fed on. The deer, rabbits, etc would stave. The wolves have less food and decrease in population.

Other Questions
3x + 1 = 8 I need the steps and answer. Porches, Inc. sells lawn furniture. Selected financial information for the most recent year is as follows: Beginning merchandise inventory on January 1 was $ 33 comma 100. Ending merchandise inventory on December 31 was $ 35 comma 400. Purchases during the year were $ 92 comma 800. Selling and administrative expenses were $ 75 comma 700. Sales for year were $ 262 comma 900. What was operating income for the year? Seawater has a specific density of 1.025. What is its specific volume in m^3/kg (to 3 significant figures of accuracy, tolerance +/- 0.000005 m^3/kg)? While you are returning from lunch, a frantic woman flags you down and states that she just found a young child on the roadside who appears to have been hit by a car. She is not sure if the child is breathing. You should immediately:A) inform the woman that she will need to calm down.B) advise dispatch that you have been flagged down for a possible emergency.C) grab equipment and get to the child's location.D) call for paramedic assistance and await their arrival. Kyle, a 5-year-old boy, has been growing by leaps and bounds; his height is 100% above normal for his age. He has been complaining of headaches and vision problems. A CT scan reveals a large pituitary tumor. A) Which hormone is being secreted in excess? B) Which condition will Kyle exhibit if corrective measures are not taken? C) What is the probable cause of the headaches and visual problems? What is the most important use of repetition in poetry? What is the root word for spherical? A. sphere B. here or C. her? 4y+2x=180 solve for x and y Distinguish between sister chromatids and non-sister chromatids. The speed of light in a vacuum is 2.998 x 108 m/s. What is its speed in kilometers per hour (km/h)? K speed = What is its speed in miles per minute (mi/min)? speed = mi/min How many core electrons does magnesium (Mg) have? Human-centered technology often recommends _______aoto computer designers and manufacturers, telling them how to make systems and the devices that support them more user-friendly. What impact would low blood pressure have on kidneys? What symptoms might you expect with a decrease in kidney functions? Molteni Motors Inc. recently reported $3.25 million of net income. Its EBIT was $6.25 million, and its tax rate was 35%. What was its interest expense? (Hint: Write out the headings for an income statement and then fill in the known values. Then divide $3.25 million net income by 1 T = 0.65 to find the pre-tax income. The difference between EBIT and taxable income must be the interest expense.) Enter your answer in dollars. For example, an answer of $1.2 million should be entered as 1,200,000. Round your answer to the nearest dollar. What are the three main types of money?A) credit, commodity, representativeB) fiat, commodity, creditC) representative, credit, fiatD) commodity, representative, fiat How much exercise should teens do daily Fiona shares an office with her exminushusband. Her share of the rent and utilities is $625 per month. She is considering moving to a home office which she will not have to share with anyone. The home office will not cost her anything as far as extra rent or utilities. Recently, you ran into Fiona at the gym and she tells you that she has moved into her home office. Fiona is as rational as any other person. As an economics major, you rightly conclude that ______ Can someone help me with this problem? It has to be in PEMDAS order. 16+(4*2/2)-4 I think it's 18 but I'm not sure The bases of one of the strands of DNA in a region where DNA replication begins are shown here. What is the sequence of the primer that is synthesized complementary to the bases in bold? (Indicate the 5' and 3' ends of the sequence.) 5' AGGCCTCGAATTCGTATAGCTTTCAGAAA 3' what is 3.149 rounded to the nearest hundredth