What were the names of the three Confederate generals that won the Second Battle of Bull Run?

Answers

Answer 1
Robert E lee was in overall command. stonewall Jackson and James were the corps commanders involved 
Answer 2
Robert E. Lee, Thomas J. "Stonewall" Jackson, and Jeb Stuart I believe.

Related Questions

The Yellow River (Huang He River) does not contain as many cities along its banks as other rivers in China. Why is this the case?

Answers

Here is the reason why the Yellow River or Huang He River does not contain as many cities along its banks as other rivers in China. The reason why is that, the river erodes the loess easily, carrying along sixty times the sediment load. During floods, the river bursts its banks which turns the plain into a flood plain. This place has become more dangerous as China's population increases. Hope this helps.

Answer: Its D

Explanation: Had it on USATESTPREP

Explain how the development of agriculture changed the way in which people lived

Answers

The development of agriculture introduced trading and surplus. This allowed people to expand the way of living and trading. People were able to store food by digging holes within the ground.
Once hunters and gatherers learned about the conveniences of nurturing crops specifically to help them grow and to use them for food sources, they stopped going after every animal to feed everyone in the village and instead created crops. Thanks to the Green Revolution, productivity in the agricultural field has greatly increased and less manual labor is required. I hope I help! ^^

Which of the following helped support passage of the new Constitution?

Answers

The promise to create a Bill of Rights

With which worldly activities had popes become more and more involved since the late middle ages?? PICK 2
A. Investing in trade
B. Gaining political power
C. Educating new priests
D. Supporting the arts
E. Helping the poor

Which if the following triggered the formation of the church of England?
A. A campaign to end corruption by pope paul 3
B. Henry 8 's desire to end a marriage
C. Mary tudors persecution of heretics
D. The birth of a daughter to anne boleyn

Answers

The best and most correct answers among the choices provided by the first question are "Gaining political power and investing in trades".
On the other hand, the best and most correct answer among the choices provided by the second question is  the third choice"Mary tudors persecution of heretics"

I hope my answer has come to your help. God bless and have a nice day ahead!

Consider a French-owned cheese factory located in Paris, France. Are the goods made by the cheese factory part of the U.S. Gross Domestic Product (GDP)? Are these goods included in the U.S. Gross National Product (GNP)? In 1 or 2 sentences, explain your response.

Answers

The correct answer is, considering a French-owned cheese factory located in Paris, France, the goods made by the Cheese Factory are not part of the U.S. Gross Domestic Product(GDP) and these goods are not included in the U.S. National Growth Product(NGP).

The U.S. Gross Domestic Product(GDP) considers the services and products that are produced in the United States territory. The GDP represents the value of the market in any period of time. It is the monetary value of what is produced in the country.

The U.S. National Growth Product(NGP) is the value of the market considering all the products and services of U.S. companies everywhere, not only in the United States. In these cases, neither one of them is owned by an American citizen. The factory is in France and it is French-owned.


The goods made by the French-owned cheese factory will neither part of the U.S. Gross Domestic Product (GDP) nor these goods included in the U.S. Gross National Product (GNP).

What GDP and GNP?

GDP is a measure of production that only takes into account the products and services produced within the borders of a determined country during a period of time.

GNP only measures the value of products and services that are owned by a country's residents.

Thus, the cheese factory is French-owned and located in Paris. So, it will neither part of the U.S. Gross Domestic Product (GDP) nor these goods included in the U.S. Gross National Product (GNP).

Learn more about GDP and GNP here,

https://brainly.com/question/11385882

#SPJ5

Which invention and inventor are credited with changing the nature of commerce and news in the first half of the nineteenth century? (Points : 3)
printing press and Benjamin Franklin

telephone and Alexander Graham Bell

telegraph and Samuel F.B. Morse

electric battery and Alessandro Volta
printing press and Benjamin Franklin

Answers

Telegraph and Samuel F.B. Morse invention and inventor are credited with changing the nature of commerce and news in the first half of the nineteenth century

Did elbridge gerry sign the constitution?

Answers

No, he did not sign the Constitution. 

Which type of tax does the federal government collect?

Answers

Income taxes and social insurance payroll taxes.

The type of tax the federal government collects is income tax.

An income tax is understood as a tax  that the government imposes on individuals or entities known as taxpayers that varies with respective income or profits (taxable income).  Income taxes are a source of revenue for governments. They are used in order to fund public services, pay government obligations, and provide goods for citizens.

Taxpayers must file an income tax return annually to determine their tax obligations.

(LC)What was the purpose of the Palmer Raids? to find and deport illegal immigrants to break the power of the Ku Klux Klan to identify and punish suspected communists to undermine the Civil Rights movement

Answers

To identify and punish suspected communists
punish communists and deport anarchists 

Why was Great Britain the site for the beginning of the Industrial Revolution?

Answers

Because Great Britain owned many colonies world wide they were a huge center of trade.

Hope this helps <3




It had access to a lot of natural resources (Iron and coal) was the main reason.

This man was a Chilean poet, writer, diplomat, political activist and exile, Nobel Prize winner for Literature, "people's poet," senator, and one of the greatest South American poets.

A. Juan Peron

B. Pablo Neruda

C. Federico Garcia Lorca

D. Gabriela Mistral

Answers

Answer:

The answer is option B

Explanation:

Pablo Neruda was a well known Chilean artist and government official. He was a Communist and was compelled to leave Chile briefly because of his political belief system. He in the long run won the Nobel Prize in Literature. He picked up a considerable measure of distinction because of his affection ballads and furthermore his political writing.This accumulation of adoration lyrics was disputable for its sensuality since Neruda was an extremely youthful writer. He won the Nobel Prize for Literature in 1971. The writer Gabriel Garcia Marquez once called Neruda "the best artist of the twentieth century in any dialect." He was the most well known of his poetry.Cherry trees begin delivering blossoms in the spring in anticipation of putting out fruits. Blooms draw in honey bees and useful creepy crawlies to the tree and enable them to fertilize the blossoms, empowering the advancement of natural product. Cherry trees create leaves in the spring also.

[tex]\huge\bold\blue {Answer}[/tex]

This man was a Chilean poet, writer, diplomat, political activist, and exile Nobel prize winner for literature, people's poet, senator and one of the greatest south American poets is Pablo neruda

hence the correct option is option B

Thanks

what was one affect of the expansion of islam between 632 and 750

Answers

Answer:

The expansion of Islam between 632 and 750, was ruled by the Umayyad caliphate that conquered the Iberian Peninsula, Iran, Afghanistan, and part of China. This territory, added to the territory that they had achieved during its first stage, meant having influence in all North Africa and the Arabian peninsula.

Because feudalism had never been firmly established in Italy, growing city-states were able to
A.appeal to the central government for assistance with expansion
B. barter various goods and services provided by the merchants for food crops from surrounding farms
C. freeze assets of the nobility to enrich the political leaders of the city-state
D.expand into surrounding areas by taking lands away from nobles

Answers

D. expamd into surrounding areas by taking lands away from nobles

Answer:

Option: D. Expand into surrounding areas by taking lands away from nobles

Explanation:

Since the rise of the Roman Empire, Italy has grown into a significant place, for trading goods and exchanging ideas from the other empire. Italy never became a firmly feudal state because of its flourished cities like Florence, Venice, Milan and other cities. By the 11th century, cities became large trading centers and were able to achieve independence from their formal monarchs also seized lands from nobles.        

   

How many u.s. battleships were at pearl harbor when the japanese attacked?

Answers

8 battleships were at pearl harbor. All 8 were damaged, 4 of which sank.

Why did motecuhzoma say to cotés now you have arrived on the earth?

Answers

Motecuhzoma thinks that Cortes is God because of his pale skin. 

Answer:

Moctezuma says to Cortes, ¨Oh Lord, you must be tired and weary, you have arrived on the earth, you have come to govern the city of Tenochtitlan which I have looked after for you and now it has been fulfilled. You have come!¨  

According to a prophecy Cortes was a returning god coming from a distant world.  

Explanation:

According to a prophecy, Quetzalcoatl had centuries earlier banished from the gulf coast. Priests from the cult of the feathered serpent had left Mexico from the same coast which Cortes had arrived and legend claimed the god had light skin. The god Quetzalcoatl promised to one day return. In the mid 1500s, the Spanish arrived with armor, cannons and horses.

Moctezuma had reason to worry whether he believed the prophecy or not. Many subjugated people throughout the Aztec Empire embraced the story of the feathered serpent and awaited his return, (It was in their hearts that he would come).  

He was confused as to fight or to welcome Cortes as his people expected. He said to the stranger in the center of the empire something like ¨Oh Lord, you must be tired and weary, you have arrived on the earth, you have come to govern the city of Tenochtitlan which I have looked after for you and now it has been fulfilled. You have come!¨  

Motecuhzoma seemed to have given the throne to the invaders or maybe he did believe that he was the returning god.  Some believe he was confused and was just buying time but he was killed by the Spanish.

How did Otis Williams' son Lamont die?

Answers

He died in a workplace accident.

Describe the steps by which England became a Protestant country

Answers

Henry VIII asked the Catholic pope to annul his marriage from Catherine of Aragon to marry Anne Boleyn. He had a daughter with Catherine, but wanted a male heir. The pope disagreed, so Henry decided to take over the Church of England. He had a series of laws passed through Parliament. The church was placed under Henry's rule away from the pope. In 1534, the Act of Supremacy made Henry "the only supreme head on Earth of the Church of England". Many Catholics who refused to accept the Act of Supremacy were executed for treason.

Also, The English didn't like that the church was taking them to death so a man by the name of Calvin starting spreading the idea that was based on Christianity but wasn't dependent on the church like Catholicism. His belief was that the more you work and save money, the better chance that you will get into heaven- Catholics believed in the opposite. Everyone started focusing on working and saving creating the start of our current economic beliefs. 

Hope this helped :)

How did the French Revolution affect the French colony of Saint-Domingue, or Haiti?

a) It inspired the Haitian people to mount their own rebellion for independence.

b) It caused the Haitian people to ally with England to conquer the French Republic.

c)It encouraged the Haitian people to demand an annual share of France’s riches.

d) It made the Haitian people suspicious of their French colonizers’ intentions.

Answers

It inspired the Haitian people to mount their own rebellion for independence.

The French Revolution affect the French colony of Saint-Domingue, or Haiti by inspiring the Haitian people to mount their own rebellion for independence. Thus the correct answer is A.

What was French Revolution?

A revolt against the government that took place in France from 1789 to 1799 and led to the creation of a republic is known as the French Revolution.

Freedom, equality, and unity were the three main beliefs of the French Revolution.

 The revolution was successful in ending French colonial rule and establishing the unstable political and economic circumstances in St. Domingue that had triggered the Haitian Revolution.

Therefore, option A is appropriate.

Learn more about French Revolution, here:

brainly.com/question/2796465?

#SPJ2

After building a road to connect it with a larger trade route, a small southeastern African village would most likely experience which of these effects during the postclassical period?

Answers

If there was a road built to connect with a larger trade route, a southeastern African village would likely experience young members of the community adopting new nontraditional beliefs and opinions.

C is the correct answer

Who was america's first female astronaut?

Answers

It was Sally Kristen Ride.

do you agree wit horace's claim on page 178 that when it come to culture, greece in essence conqured rome? expain

Answers

Yes, Sam is entirely correct - Greece was one of those cultures that could not be totally vanquished from the world - in fact for a period of time in Roman history the Greek language and culture wasnecessary as it was the most common language spoken across the entire Roman Empire. Horace was correct in saying that Roman culture was behind and lacked the same experience and popularity that the Greek culture had. 

Rome conquered Greece through militaristic ways - Greece conquered rome through social, culture, economic and other ways. And even after Roman decline Greek culture still played a massive part in Ancient world. It was even more important and advanced than that of the Egyptians. Whilst Rome andother superpowers died and were killed off - Greece remained strong for plenty of years to come - without Greek culture and society much of the Roman empire would have remained useless due to lack of latin or native languge speaks in the different areas 

Study the 14th-century Persian image below. What could one conclude about the Islamic world from this image?

A. The Islamic world in the 14th century was a time of great scientific learning.
B. The Islamic world in the 14th century saw a renewed interest in Asian philosophy.
C. The Islamic world in the 14th century prohibited images of the human form.
D. The Islamic world in the 14th century disallowed dissection of the human body.

Answers

It's A. The Islamic world in the 14th century was a time of great scientific learning.

I believe the answer is: A. The Islamic world in the 14th century was a time of great scientific learning.

The picture above represent the picture of what the experts at the time see how a human body look like. The existence of this picture proof that at that time, people start to make attempts to pursue scientific learning on how human anatomy functions

the british hoped to limit american settlement in the northwest territory by

Answers

If the answers to this question are:

A. moving their forts across the Great Lakes. 
B. sending troops to attack American settlements. 
C. providing arms and ammunition to Native Americans. 
D. sending General Arthur St. Clair to patrol the area.

Then the answer is C.

Hope this helps :)

Answer:

C

Explanation:

Which of the following is true about child labor

Answers

They were more likely to get injured than adults.

I hope this is one of the choices.

Answer:may jobs were unsafe

Explanation:

Which statement describes how the crusades affected the relationship between Christians of the east and west
A eastern Christians feared that the Western Christians reclaim their holy land.
B Western Christians feared that the pope would move theConstantinople
C The crusades restored peace between the two groups
D. The crusades for the divided the two groups

Answers

It depends what crusades you are talking about, since in the fourth crusades the Latin troops captured constantinople. I would say D is the best answer because the Byzantine empire's economy was strained by all the soldiers that had to be housed and fed on their march to the Holy Land.
Final answer:

The Crusades created fear and mistrust between Christians of the East and West, as Eastern Christians were worried about Western Christians reclaiming the holy land and potentially exerting control over them.

Explanation:

The Crusades had a profound impact on the relationship between Christians of the East and West. One significant result was the fear and mistrust that developed between the two groups. Eastern Christians, also known as Byzantine Christians, feared that Western Christians would reclaim the holy land and potentially try to exert control over them. This fear was rooted in the fact that when the Crusaders arrived in the Byzantine Empire during the First Crusade, they sacked and pillaged Constantinople, causing significant damage and loss of life.

In 1935, italy invaded the african nation of __________.
a. somalia
b. ethiopia
c. the sudan
d. libya

Answers

In 1935, Italy invaded the African nation of Ethiopia

Read the sentence below and answer the question that follows. Desert biomes often have many droughts. What is the best way to define the underlined word in the sentence above? A. long periods of time without rain B. types of animal life within a biome C. long periods of cold temperatures D. types of plant life within a biome

Answers

A. long periods without rain.

The correct answer is A) long periods of time without rain.

Desert biomes often have many droughts. The best way to define the underlined word in the sentence above is "A. long periods of time without rain."

Drought means that the region has long periods without rain. Droughts can be caused by lack of rain, high temperatures, overuse of the land, and deforestation. Water supply shortage and crop damages are the most critical consequences of a drought.  

The Bailiff served as head of the manorial court. True or False

Answers

true-he did serve as leader of court


No, I don't think so. He's just an overseer. 

Why didn’t the reforms made after President Garfield’s assassination completely reduce corruption nationwide?

Answers

They were only applied to government workers, called the pendleton act.

On July 2, 1881, at the Washington train station, the lawyer Charles Jules Guiteau, a finder of charges and perks disappointed by the firmness of James Garfield, who had not granted him a consular post he had requested, fired upon him. President, two bullets that did not injure any vital organ.

Wounded, Garfield remained in the White House for 70 days. The doctors, on the pretext of finding one of the bullets, were transforming a wound of a few millimeters into a serious wound. Alexander Graham Bell tried unsuccessfully to find the bullet with a metal detector that he had improvised himself for the occasion, but the bed where he was lying was made of metal and that made the discovery impossible. On September 6 Garfield was taken to the coast of New Jersey. For a few days he seemed to have recovered, but on the 19th of that same month he died because of the infection and the internal bleeding caused by the doctors. The posthumous image of President Garfield was marked by ambiguity. His struggle against the spoil system and his subsequent murder at the hands of a stalwart who had denied him a public position made him a martyr in the fight against careerism and corruption.

After the death of Garfield, he tried to fight corruption. In 1883, through the Pendleton Act, the system of merit in the hiring of public employees was established in the United States. But the efforts did not prosper throughout society, since the law was limited to public administration.

how wide is the united states standard railroad gauge

Answers

Approximately 55% of the lines in the world are this gauge

How I got it well I saw this question a long time ago. Hope this helps
Other Questions
write 2.18 as a mixed number in simplest form Find the Nth term of the following sequence...7, 27, 47, 67, ..... Marvin is trying to finish 1/2 of his test every 2/3 hour. How many hours will it take Marvin to complete his whole test List the integers between the square root of 15 and the square root of 48 ? Why is radium valuable what is 3400 as a decimal answer asap Solve the given differential equation dN/dt=kN, (k=constant) ...? The trash, located by the sink, is always taken out at least once a week to keep the kitchen from smelling. What is the dangling modifier in this sentence? Given the ip address 192.168.112.0. each network requires between 35 and 60 hosts. what is the broadcast address of the first available subnet? 30 POINTS DONT ANSWER IF YOU DONT KNOW THE ANSWER FOR SUREIn the gene TATTCATTGTTATGATTTATTCG, CATTGTTA encodes for pepsin, a digestive enzyme. The rest of the sequence doesnt code for any protein. Which sequence contains a mutation that will affect the formation of pepsin?A. TATTCATTCATTATGATTTATTCGB. TATTCATTGTTATGACTTTATTCGC. TATTCATTGTTATGATTTATTGGCGD. TATTCATTGTTATGATATTCGE. TGCATTCATTGTTATGATTTATTCG A box is given a push so that it slides across the floor. How far will it go, given that the coefficient of kinetic friction is 0.15 and the push imparts an initial speed of 3.5m/s? When was the u.s. constitution written? what is bulimia? can someone explain it to me. Which items describe people's interactions with their environment?Technology does not affect the earth's environment.People adapt to their environment.People adapt their environment.Population growth and the environment are unrelated.Changes to the earth's environment rarely matter.Changes to the earth's environment can be harmful.Changes to the earth's environment can be beneficial. Choose the sentence that has the correct form of the verb ser. Ellas es muy inteligentes. Clara no es cubana. Nosotros son amigos. Yo eres serio. A rate that describes how much smaller or larger the scale drawing is than the real object Write 6% as a decimal. There are two main functions for polysaccharides in living things. Discuss these two functions, and how the structures of polysaccharide molecules support these functions.Now I know that all polysaccharides are made up of the same monomer, glucose. Is this question essentially asking me the use of glucose throughout different organisms? Which of the following represents the graph of f(x) = 2x + 2? algebra help?write a function rule for the area of a triangle with a base of 3 cm greater than 5 times its height. what is the area of a triangle when its height is 6 cm?