Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3')? view available hint(s) where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3')? it would not bind the target dna. ttttagccatttacgattaatcg ttttagccatttacgattaatcg ttttagccatttacgattaatcg?

Answers

Answer 1
If the DNA sequence is: 5’  TTTTAGCCATTTACGATTAATCG  3’
The probe  5’ AATCG  3’ will bind for the CGATT part of DNA.
The two complementary strands of DNA are usually differentiated as the "sense" strand (5’-3’) and the "antisense" strand (3’-5’), meaning that they have different directions. According to this, the probe in antisense would be 3’ GCTAA 5’. 

Related Questions

A one-way relationship in which one species benefits and directly hurts the other is called

Answers

that type of relationship is known as Parasitism

A heavier person will have a lower bal level due to a greater amount of ____ in their body

Answers

 A heavier person will have a lower blood alcohol level due to a greater amount of __________ in their body. 

Blood 


not sure if this helps

Which would have the GREATEST effect on the rate of photosynthesis in a plant?

Answers

If carbon dioxide and light levels are high, but temperature is low, increasing temperature will have the greatest effect on reaching a higher rate of photosynthesis. 

Answer: Low level of carbon dioxide, low temperature due to lack of sunlight will affect the process of photosynthesis.

Explanation:

The photosynthesis can be defined as the process by which autotrophs make their own food in the presence of sunlight with the help of carbon dioxide, water and other nutrients presents in soil.

If there will be inadequate amount of sunlight, or low level of carbon dioxide then the rate of photosynthesis will decrease.

Which of the following is NOT a characterisitic of all plants? a They produce seeds b They have cell walls of cellulose c They are eukaryotic d They are multicellular

Answers

is your answer.

Not all plants produce seeds. Some plants, like ferns and moss produce spores. While others use asexual vegetative reproduction and grow new plants.

The major form of fat in both food and the body is

Answers

Triglycerides!!!
The major form of fat in both food and the body is Triglycerides.

An increase in the nfp would result in a(n) _______________ in the gfr.

Answers

an increase in the gfr

The increase in the NFP would result in an increase in the GFR.

NFP stands for Net Filtration Pressure and GFR stands for Glomerular Filtration Rate. The two quantities are associated with the process of blood filtration and urination process in the kidney. When the blood vessels leading to the kidney expand and the blood vessels leading out of the kidney shrink, it leads to the build up of the GFR in glomerulus. This leads to the increase in the process of the blood filtration and thus increases the NFP.

In living things, hydrolysis reactions result in the formation of

Answers

in living things hydrolysis reaction result in the formation amino acids, glucose or fatty acids from their polymers by addition of water.
Forexample
                  Complex carbohydrates are broken down into simple glucose units when water is added to them.

Hydrolysis reactions in living things result in the formation of simpler molecules through the addition of water.

Hydrolysis reactions, in living things, result in the formation of simpler molecules through the addition of water. This process is important for breaking down complex molecules such as proteins, carbohydrates, and lipids into their individual building blocks. For example, a hydrolysis reaction involves the breaking of a peptide bond in a protein, resulting in the formation of amino acids.

Learn more about Hydrolysis reactions in living things here:

https://brainly.com/question/31575052

#SPJ6

The term _________ represents a predictive theory of how a species might change with time. the term ________ assumes that nature can create whole new structures and organisms simply be environmental constraint.

Answers

The term microevolution represents a predictive theory of how species might change with time.
The term macroevolution assumes that nature can create whole new structures and organisms simply be the environmental constraint.
Evolutionary biology, genetics, aetiology, genetics they overlap with the closely related sciences of ecology.
Ecology seeks to explain the movement of materials and energy through living communities, successional development of ecosystem and processes, adaptation and interactions.
Final answer:

Gradualism and punctuated equilibrium are two theories that explain how species might evolve over time. Gradualism suggests continuous slow change, while punctuated equilibrium points to long periods of stability followed by rapid changes. Both are vital in understanding the complexity of evolutionary processes in biology.

Explanation:

The term gradualism represents a predictive theory of how a species might change over time. This theory proposes that change occurs continuously and slowly over long periods. On the other hand, the term "assumes that nature can create whole new structures and organisms simply by environmental constraint" is likely referring to the concept of saltation or punctuated equilibrium, which suggests that species remain constant for long periods and that change, when it occurs, is rapid and significant. It's important to note that gradualism and punctuated equilibrium are two theories of evolutionary change that continue to be debated within the scientific community.

Contemporary biological anthropologists use an evolutionary perspective to understand the diversity of life through natural selection. These principles are instrumental in understanding why certain traits prevail over time. The ongoing evolution includes processes like mutation, natural selection, and speciation. The classical view of gradualism contends that species undergo continuous adaptation, but the punctuated equilibria view introduced by Stephen Jay Gould and Niles Eldredge provides an alternative model where species experience long periods of stability (equilibria) interrupted by brief periods of rapid evolution (punctuated).

Adaptationism allows us to understand how traits contributing to survival and reproduction become predominant within a population, which is a fundamental concept of natural selection. It is important to recognize that evolutionary theory isn't fixed, as it continues to develop with new technologies and cultural shifts, which might lead to a broader understanding of evolutionary forces beyond the classic model.

Every individual, including young people, can make decisions to use resources wisely. Use the terms reduce, reuse, and recycle to explain how the students in the image above can help minimize solid waste.

Answers

Reduce the use of items like paper towels, plastic wraps, bottled water, and newspaper.
Reuse. Items like Tupperware containers, metal water bottles, and grocery bags can be reused for multiple times.
Recycle. Items like glass bottles, plastic can, and aluminium cans can be collected and being reprocessed into new containers.

Answer:

3R's i.e reduce, reuse, and recycle can help the solve the problem os solid waste

Explanation:

All solid waste that is generated at a city level can be dealt with the utilization of concept of three R’s.  

First R is the reduction of waste generation; All individuals must try to reduce the waste generated at his/her level so that the total quantum of waste get reduced.

Second R stands for Reuse. All individuals must try to use the item again and again if it is in condition of being reused such as plastic containers, bottles etc.  

Third R stands for Recycle. All the waste that can be recycled must be recycled so that it can  be reused again without producing new items that further adds to the total waste generated.  

How are ingenious rocks formed

Answers

They are formed by the cooling of molten magma on the earth's surface. 

What causes density currents to form in the Mediterranean Sea?


(A)condensation

(B)transpiration

(C)upwelling

(D) evaporation

Answers

An example of a density current formed by evaporation is found in the Mediterranean Sea. The hot, dry climate causes much more water to evaporate than is received from rainfall or rivers. Less-dense Atlantic Ocean water pours into the Mediterranean, over the denser water.
Hope this helps!!
most liklely evaporation

In a male plant of a dioecious species, which set of homeotic genes is likely never expressed?

Answers

C genes alone. Your welcome.

In my research, i found that the levels of "gonadotropins" in the body are critical to understanding how the drugs clomid and ortho tri-cyclen work. what are gonadotropins? what structure releases them? (2)

Answers

Answer:

Gonadotropins are polypeptide hormones and are secreted by the anterior pituitary gland.

Explanation:

Hypothalamus releases GnRH i.e gonadotropin releasing hormone which stimulates the anterior pituitary to secrete gonadotrophs such as FSH, ICSH and LH.

FSH (follicle stimulating hormone): In males it stimulates spermatogenesis. In females it stimulates growth of ovarian follicles.

ICSH (Interstitial cell stimulating hormone): In males, secretion of testosterone.

LH (Luteinising hormone): In femalestogether with FSH, it triggers ovulation, stimulates conversion of broken ovarian follicle into corpus luteum.

I believe the gonadotropins are hormones secreted by the gonads and are released by the testes and ovaries.

Explanation:

Gonadotropins are a group of hormones secreted by the female and male reproductive system. The organs that produce are Testes and Ovaries. The hormones are released due to action of another polypetide hormone called the gonadotropin releasing hormone that stimulates the male gonads (testis) to produce the steroid hormone called testosterone and the female gonads (ovaries) to produce estrogen.

Further Explanation:

All the gonadotropin hormones are steroid in nature and they are lipophilic hence they can pass through the lipid bilayer of the cell membrane and cause a change in the gene expression inside the nucleus of the target cell. Control of these hormones is via the Hypothalamus Pituitary Gonadal (HPG) axis and the Hypothalamus Pituitary Adrenal (HPA) axis. The steroid hormone testosterone can also be produced by the adrenal cortex of the adrenal gland in the topmost layer called the zona glomerulosa. The drugs clomid and ortho tri-cyclen target the these to axes in order to produce the desired response.

Clomid acts on the female HPG axis by acting on specific estrogen receptors in the hypothalamus where it has a negative feedback mechanism on the release of gonadotropin releasing hormone thus impacting the production of gonadotropic hormones through upregulation.

ortho tri-cyclen is an oral contraceptive that inhibits ovuating by acting on the female HPG axis where it has a negative feedback mechanism on the hormone Follicle Stimulating Hormone. It inhibits the FSH hormone production in the anterior pituitary gland meaning there will be no maturation of the ovarian follicle into the graafian follicle which will produce the hormone estrogen necessary for the thickening of the endometrial layer of the uterus. Inhibitin estrogen production also means that it will prevent the cervical mucus from becoming thin in order to allow the passage of sperms during sexual intercourse.

Learn More:

Learn more about the menstrual cycle: https://brainly.com/question/4189307

Learn more about steroid hormones: https://brainly.com/question/892851

Learn more about gonadal hormones: https://brainly.com/question/4189307

Level: High School

Subject: Biology

Topic: Reproduction

A _____ locates all or most of the processing logic on the server.​ select one:
a. ​thin client
b. ​portal client
c. ​batch client
d. ​topological client

Answers

portal client I think so

Given what you know about these two strains of yeast, what role does a cell's ability to repair dna play in how well it tolerates exposure to sunlight?

Answers

Final answer:

A cell's ability to repair DNA is essential for its tolerance to sunlight exposure. Cells with efficient DNA repair mechanisms can quickly fix DNA damage caused by sunlight, while cells with impaired repair abilities are more susceptible to the harmful effects of sunlight. Studies on yeast strains lacking DNA repair genes show higher mutation rates and reduced viability after sunlight exposure.

Explanation:

The ability of a cell to repair DNA plays a crucial role in how well it tolerates exposure to sunlight. When cells are exposed to sunlight, the high-energy UV radiation can cause damage to their DNA. Cells with efficient DNA repair mechanisms can quickly detect and repair this damage, minimizing its negative effects. In contrast, cells with impaired DNA repair abilities will experience accumulative DNA damage over time, making them more susceptible to the harmful effects of sunlight exposure.

For example, in the case of yeast, the ability of a cell to repair DNA can impact its survival and growth after exposure to sunlight. Studies have shown that yeast strains lacking certain DNA repair genes, such as photolyase, exhibit higher mutation rates and reduced viability after exposure to bright sunlight. These strains are less able to repair DNA damage caused by UV radiation, leading to the accumulation of genetic mutations and decreased survival.

Overall, a cell's ability to repair DNA is crucial for its tolerance to sunlight exposure. Efficient DNA repair mechanisms help maintain genome integrity and protect cells from the harmful effects of DNA damage induced by sunlight.

What role do hydrogen bonds play in the dna molecule?

Answers

Final answer:

Hydrogen bonds within the DNA molecule stabilize its double helix structure, facilitate genetic fidelity, and allow for DNA replication and transcription by easily 'unzipping' due to their relative weakness compared to covalent bonds. These bonds are crucial for the DNA's stable yet flexible structure.

Explanation:

The hydrogen bonds play a crucial role in the structure and function of deoxyribonucleic acid (DNA). According to the Watson-Crick model, DNA's double helix structure is primarily stabilized by the hydrogen bonds that form between the base pairs on the opposing strands. These hydrogen bonds occur between the nitrogenous bases of nucleotides: adenine pairs with thymine through two hydrogen bonds, while cytosine pairs with guanine through three hydrogen bonds. The precise alignment and pairing ensure the double helix's stability and play a significant role in genetic fidelity during DNA replication and transcription.

Hydrogen bonds are not exclusive to interactions between DNA strands. They can also occur within a single large biomolecule, affecting the three-dimensional structure and function of proteins. It's important to note that, while strong in their cumulative effect, individual hydrogen bonds are weaker than covalent bonds. This relative weakness allows the two DNA strands to “unzip” easily during the replication process, enabling each strand to serve as a template for creating a new complementary strand.

The hydrogen bonds, along with van der Waals interactions, contribute to the DNA's shape and structure, which is essential for its function in living organisms. The cumulative effect of millions of hydrogen bonds holding the DNA strands together is integral for the molecule's stability, yet it still allows for the necessary flexibility for replication and transcription processes that are vital for life.

In a nuclear fusion reaction, the mass of the products is less than the mass of the reactants. What happens to this "missing mass"? A. It turns into matter. B. It turns into energy. C. It turns into antimatter. D. It turns into matter and antimatter.

Answers

In a nuclear fusion reaction, the mass of the products is less than the mass of the reactants. This "missing mass" -turns into energy.

Answer: Option B; it turns into energy

In a nuclear fusion reaction, two reactants combine, and form new products. But the mass of the products is less than total mass of the reactants. This is because a part of mass is lost as energy. This can be seen in an example shown below. You can see that mass is of the products is less than that of the reactants.

Which of the following is an example of a nonspecific immune response?
A.
The receptors of a B lymphocyte bind to an antigen.
B.
A T lymphocyte attacks and destroys a cancer cell.
C.
A plasma cell releases antibodies.
D.
A macrophage engulfs invading bacteria.

Answers

The correct answer is D. A macrophage engulfs invading bacteria.
Non-specific immune response (or innate immune response) includes mechanisms that defend the host from infection by pathogen by recognizing and responding to pathogens but without providing long-lasting immunity to the host. Mechanisms of this respond include recruiting immune cells to sites of infection via cytokines, identification and removal of foreign substances by white blood cells (like macrophages, neutrophils), activation of the adaptive immune system (antigen presentation).

Answer:

A macrophage engulfs invading bacteria.

Explanation:

A nonspecific immune response is the body's first line of defense against invaders. It is a general immune response that requires no prior memory of the pathogen. A macrophage engulfing invading bacteria is an example of a nonspecific immune response.

Have a good day :)

What agent of erosion creates a cirque?

Answers

the agent of erosion is glaciers

You have just purchased a hamburger at toady loady's hamburger stand. you get ready to eat it and notice that the meat is red-almost raw. you take the hamburger back to get a well-cooked hamburger due to your concern about which organism that is commonly associated with undercooked meat? staphlococcus aureus giardia lambia e-coli clostridium botulinum

Answers

The correct answer is E.coli.

Eating undercooked meat puts you at a great risk of getting food-borne diseases, which are caused by pathogen microorganisms. One of the most common food-borne diseases from under-cooked beef is E.coli. The most common symptoms of E.coli are vomiting, diarrhoea and stomach cramps. 

The result of the light-dependent phase of photosynthesis is the generation of which two energy-rich molecules?

Answers

molecules are NADPH and ATP

Which property of water helps support life in this harsh Arctic environment?

Answers

The icy waters of the Arctic and Antarctic Oceans sustenance a great amount of marine life. For millions of years, life has remained unchanged, making it possible for these animals to adapt themselves to these particular patterns of existence. Due to water's cohesiveness, water's polarity enticed to other water molecules. The hydrogen bonds in water grasp other water molecules unruffled. Also the Cohesion or known as water's attraction to other water molecules is one of the major properties of water. 

Reflect on all of the illnesses anna garcia has experienced. did any of her illnesses studied this year result in a breakdown of her body's ability to protect itself?

Answers

The illnesses of Anna Garcia had result in a breakdown of her body’s immune system that make her vulnerable to different infection. Her sickle cell disease and type 1 diabetes had made her weaker because the white blood cell that supposed to protect the body did not function properly and she often experienced fatigue and exhaustion because of low insulin. Due to these, she experienced urinary tract infection that made her more ill.

In addition to oxygen and carbon dioxide, the circulatory system is the primary delivery system for?

Answers

Cerebrospinal fluid is also delivered by the circulatory system to the brain

Animals have a great variety of internal structures that define the way they live. For example, a bear has lungs to help it get oxygen to all of its cells. What does a fish have that serves the same function? A. scales B. gills C. fins D. lungs

Answers

B gills serve so that the fish can breathe

Answer:

B

Explanation:

Which other system in the body works closely with the kidneys to regulate arterial blood ph?

Answers

T he answer is respiratory system (lungs). Lungs expel carbon dioxide from blood hence raise blood pH. Thesis because it reduces the amount of carbonic acid in the blood. The carbonic anhydrase is responsible for the dissociation of carbonic acid to carbon dioxide and water. CO2 is then expelled by the lungs.

Toddlers should consume ________ milligrams of calcium per day.

Answers

The answer is 700 milligrams needed toddlers should consume per day. Children need enough calcium to support their growing bones and teeth. Calcium is one of the body's most essential minerals and also has other necessary roles to play, including supporting a healthy nervous system and muscle function.

Part a the presence of a mutant lac repressor that could not bind lactose would result in _______ transcription even when lactose was present because the mutant repressor would remain bound to the lac __________ see section 18.3 (page 373) . view available hint(s) the presence of a mutant lac repressor that could not bind lactose would result in _______ transcription even when lactose was present because the mutant repressor would remain bound to the lac __________ see section 18.3 (page 373) . no; operator lots of; operator lots of; promoter no; promoter

Answers

The presence of a mutant lac repressor that could not bind lactose would result in no transcription even when lactose was present because the mutant repressor would remain bound to the lac operator 

The transcription of lac operator is controlled by the lac repressor. When lactose is present, the lac repressor normally will bind to the lactose, removing itself from the lac operator so it could be transcripted. 
In this case, the mutation makes the lac repressor keep binding to the lac operator so the result would be no transcription even when lactose present.

The presence of a mutant lac repressor that could not bind lactose would result in no transcription even when lactose was present because the mutant repressor would remain bound to the lac operator.

Further Explanation:

When lactose is unavailable, the repressor molecule binds to the DNA and prevents transcription of the genes. Therefore, the enzyme that is required for the lactose metabolism will not be produced. Comparatively, in the presence of lactose, the repressor molecule will bind to inducer (allolactose), which prevents binding of the repressor to DNA results in transcription of a gene. Enzymes accountable for the lactose metabolism will be produced. The mutated repressor molecule, which prevents binding to DNA, will result in the production of enzymes all the time, irrespective of the presence or absence of lactose. Genes responsible for the metabolism of lactose will be expressed all the time. If a mutation occurs in the repressor, it will prevent inducer binding. The repressor molecule will bind then to DNA permanently and blocks the activity of RNA polymerase. This results in no transcription and translation of operon. Presence of a mutated operator that does not allow the binding of a repressor would cause constitutive expression of the operon.

Learn More:

Learn more about the treatment of eukaryotic cell with a drug https://brainly.com/question/10767798 Learn more about the proteins synthesis in a cell https://brainly.com/question/1420458 Learn more about the exchange of gases by blood cells https://brainly.com/question/1213217

Answer Details:

Grade: High School

Subjects: Biology

Chapter: Genetics

Keywords:

Lactose, metabolism, genes, produce, DNA, allolactose, repressor, transcription, repressor, operon, binding, enzyme, absence.

Removing which of the following parts would cause the plant to starve? Leaves Branches Stems Roots

Answers

Final answer:

Removing leaves from a plant would cause it to starve due to the lack of photosynthesis. If roots are damaged or die, the plant cannot absorb water and minerals and will likely perish. Girdling interrupts the flow of nutrients, not water, but still leads to the eventual death of the plant.

Explanation:

Removing leaves from a plant would cause it to starve. Leaves are essential for photosynthesis, the process by which plants convert light energy into chemical energy in the form of glucose, which is a source of food for the plant. Without leaves, a plant cannot perform photosynthesis, leading to a lack of energy and eventual starvation.

If an herbicide causes roots to shrivel and die, the most direct consequence for the plant is that it would not be able to absorb water and minerals from the soil. Roots are vital for the uptake of these essential nutrients, and without functional roots, the plant would be unable to maintain necessary life processes and would likely die.

Effect of Girdling on Plants

Girdling a plant, which involves removing a band of bark from around the trunk, interrupts the downward flow of nutrients through the phloem but not the upward flow of water through the xylem. While the foliage does not initially wilt, the entire plant, including the roots, will eventually die because they cannot receive food manufactured by the leaves.

The peppered moth comes in 2 varieties: dark-colored and light-colored. it is preyed upon by birds. suppose that prior to predation the population was 50% dark and 50% light, but after predation the population was 10% dark and 90% light. did evolution occur?

Answers

What occurred is known as :  Natural selection ( evolution ) i.e True evolution occured

Given that Prior predation both species has the same population i.e 50% each and after predation the dark moth had 10% of the population of moth while the light-colored moth had 90% of the moth population.

We can summarize that the the light colored moth survived the predation because they were better adapted to live and survive predation from birds which is simply a phenomenon known as Natural selection.

Hence we can conclude that a mechanism of evolution ( Natural selection ) occurred.

Learn more : https://brainly.com/question/15577096

Other Questions
Atomic weight of gold is 197.2 amiCalculate no of gram atoms in 7.5g of gold I have no congruent sides. One of my angles has a measure of 100 degrees. Workers in uranium mines have experienced extremely high incidences of if y -18 =14 what is the value of 3(Y + 5) what is the measure of the angles Given the two expressions shown below:A. \sqrt{3} +\sqrt{2} B. \sqrt{3} +\sqrt{6} Which statement best describes the two expressions? Both are rational. Both are irrational. A is rational, but B is irrational. A is irrational, but B is rational. What is the y-value of sin(x) when x = -90? Fashion experts readily understand the power of ______________. shortly after kate middleton married prince william, throngs of soon-to-be-brides scrambled to find copies of her bridal gown, and also that of her sister pippa?s bridesmaid gown. what happens when ice transform into steam What was NOT a new technology used in World War I that contributed to the massive casualty rates?A) U-Boats B) poison gas C) Machine guns D) Jet fighters What is Wrights strategy for using personal anecdotes to show readers how he feels?He says how he feels about something and then gives an experience as an example.He describes what happens and then comments on how he feels about it.He writes so that only people who had similar experiences will understand his feelings. How do I do this ?? Many sports organizations have banned the use of _____ by athletes.a. colloidal ligandsb. anabolic steroidsc. herbal extractsd. branched chain amino acids the chemical composition of a star can be determined using a Ross and 5 of his friends are going kayaking. They rented 6 kayaks for 420. then they brought food for all 6 people , which costs 144. if all 6 people shared the cost 144. if all 6 people shared the cost of the trip equally, how much did each person pay? A. 70 B.76 C.88 D.94 please help me Doctors have been looking for a cure for which disease since 1981 By the early 21st Century, most Americans had Internet access through their homes, schools, offices, and/or libraries. What is a major impact the Internet has had on American society? In which atmospheric layer does most of the greenhouse effect occur answer? pls help soon:)James threw a flying disc from a height of 4 feet above the ground. The disc travels a horizontal distance of 30 feet before falling to the ground. The height of the disc, in feet, at a distance of t feet from James, is modeled on the graph below.FILL IN BLANKThe domain represents the A. horizontal distance covered by B. maximum height of C. possible heights of the flying disc. The range of this function is [A. 1 B. 0 C. 2, A. 7 B. 6 C. 5 ]. For this function, the range represents the flying disc's A. possible heights B. maximum heights C. horizontal distance covered Suppose you increase your walking speed from 7 m/s to 15 m/s in a period of 2 s. What is your acceleration