Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3')? view available hint(s) where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3')? it would not bind the target dna. ttttagccatttacgattaatcg ttttagccatttacgattaatcg ttttagccatttacgattaatcg?

Answers

Answer 1

It would bind to the part that has a complementary sequence. Since A pairs with T and C pairs with G then it would bind to  ttagc sequence on the  DNA strand. The two DNA pieces would also align in anti-parallel alignment.







Related Questions

1. What is the coding system used to help consumers identify the type of plastic a container is made from

Answers

Resin identification coding system

Resin identification coding system is introduced as a means of helping consumers and recyclers to identify the type of plastic resin from which a bottle or a container is produced from. Manufacturers follow the coding system by placing a number or SPI code on each plastic product and the code are usually molded into the base of the products. For example, plastics marked with an SPI Code of 1 are made with polyethylene terephthalate (PET).






A gene is physically located on a _____ in the nucleus of a cell.

Answers

The answer is DNA. DNA is vital for all living beings and this is made up of molecules called nucleotides. Each nucleotide contains a phosphate group, a sugar group and a nitrogen base. The four types of nitrogen bases are adenine. There are three main functions of DNA to our body, this facilitate occurring mutations and even in a single nucleotide. Then it forms RNA and proteins and this exchange the genetic material of parental chromosomes during meiotic cell. 

Which mechanism of genetic variation results from the exchange of gene segments between non-sister chromatids?

A.Crossing over

B. Independent assortment

C.Random fertilization


Answers

Crossing over is the mechanism of genetic variation results from the exchange of gene segments between non-sister chromatids.

The mechanism of genetic variation results from the exchange of gene segments between non-sister chromatids is called crossing over. So, the correct option is (A).

Crossing over is the process of exchange of genetic material between two non-sister chromatids in meiosis. It occurs in the pachytene stage of prophase. Two chromosomes one from the mother and one from the father line up and the parts of the chromosome are exchanged.

Crossing over promotes genetic diversity. Chiasmata is formed as a result of crossing over.

Thus, option (A) crossing over is correct.

To know more about crossing over :

https://brainly.com/question/33558845

#SPJ5

Of all planets in our system jupiter has the greatest gravitational strength

Answers

That is a true statement.
That is right.
#####

Which chambers of the heart below are the ventricles? Which chamber receives oxygen- poor blood from the body?

Answers

The Left and Right Ventricles.
The right ventricle receives deoxygenated blood via the superior and inferior vena cava.

Which of the following living things would be found closest to the beginning of a food chain? A. coyote B. caterpillar C. mushroom D. scorpion

Answers

Answer:

It is B. Caterpillar

Explanation:

The living thing would be found closest to the beginning of a food chain is caterpillar.

Which organism in this food web is an omnivore?

Omnivores typically occupy the third trophic level alongside meat-eating carnivores.

Omnivores are a mixed group of creatures.

Examples of omnivores include bears, birds, dogs, raccoons, foxes, certain insects, and even humans.

Thus, option "B" is correct, is found  closest to the bengining  of a food chain is caterpillar.    

To learn more about a caterpillar click here:

https://brainly.com/question/11838798

#SPJ3  

How does conservation affect biodiversity? It helps to preserve climate change. It decreases species diversity. It helps to preserve biodiversity. It decreases ecosystem diversity.

Answers

A conservation biologist has determined the status of the ecosystems in a protected area, It helps to preserve climate change. It decreases species diversity.

It helps to preserve biodiversity.

How is conservation related to biodiversity?

The conservation helps to maintain flora, fauna, microbial and genetic sources for food production, farming, and habitat functions such as fertilizing the soil, recycling minerals, taking care of pests and disease, maintain erosion, and pollinating.

Thus, t helps to preserve biodiversity.

To learn more about biodiversity click here:

https://brainly.com/question/13073382

Answer: Helps to preserve biodiversity

Explanation: :)

Describe what happens in the nervous system when you duck your head to avoid an object flying toward it. 2. what protects the brain and spinal cord from injuries? 3. what does the cerebrum control? 4. name the lobes of the cerebral cortex, and identify a function of each lobe. 5. how does the brain control the endocrine system? critical thinking questions 1. explain how the case of phineas gage influenced the development of psychology. 2. give examples of activities or processes that are controlled by the somatic nervous system. 3. an elderly person suffered from a stroke that damaged part of his brain. he can speak easily, but his sentences make no sense. explain which area of his brain was most likely damaged. 4. assume that a pet scan was made of the brain of a person speaking and of the brain of a person smelling a flower. describe how you would expect the pet scan of each person's brain to look. 5. why is a home heating system a good model for the way that the thyroid gland is controlled by the pituitary gland and hypothalamus? describe how each system is controlled.

Answers

Final answer:

The nervous system coordinates bodily actions, including reflexes. The brain and spinal cord are protected by the meninges. The cerebrum controls voluntary movements and cognitive functions, while the hypothalamus controls the endocrine system.

Explanation:

The nervous system coordinates and controls bodily actions, including reflexes, through the communication between the brain and other parts of the body. When you duck your head to avoid an object flying towards it, this action is coordinated by the brain, which sends signals through the nervous system to the muscles of the neck to quickly move your head out of the way.

The brain and spinal cord are protected by a set of three membranes called meninges, which act as a cushion to absorb shock and protect the delicate nervous tissue from injuries. The meninges also enclose and protect the cerebrospinal fluid that surrounds the brain and the spinal cord.

The cerebrum is the largest part of the brain and is responsible for higher cognitive functions. It controls voluntary movements, sensory perception, language, memory, and reasoning. It is divided into two hemispheres, each with four lobes: frontal, parietal, temporal, and occipital. Each lobe has its own specific functions, such as the frontal lobe being involved in decision making and problem-solving.

The brain controls the endocrine system through the hypothalamus, which is located in the brain. The hypothalamus releases hormones that signal the pituitary gland to release or inhibit the production of certain hormones. This allows the brain to regulate and control various bodily functions, such as growth, metabolism, and reproduction.

Learn more about Nervous system here:

https://brainly.com/question/24255030

#SPJ12

While at the shore, you and your friend Maria find a nest containing the fossilized remains of an animal. The nest, covered with sand, contains the skeleton and six preserved eggs. Maria believes you have discovered a bird nest. You believe it is a turtle nest. What evidence would support Maria's claim that the fossilized remains are that of a bird, class Aves, instead of a turtle, class Reptilia? A) the eggs B) a backbone C) a keeled sternum D) warm-bloodedness

Answers

To answer the question, they should examine the skeleton or the fossilized remains of the animal.

Turtles have tough, bony shells, like a suit of armour that protects their body. It has a carapace (domed top) and a plastron (flat layer underneath the belly). The backbones of the turtles are fused to the bones in their shells.

On the other hand, birds have a lightweight skeleton that is made of mostly thin and hollow bones. If the skeleton has a keeled sternum, or the breastbone what they discovered is most likely a bird's nest.

The answer is C.

Answer:

The correct answer is C) a keeled sternum.

Explanation:

Many sports organizations have banned the use of _____ by athletes.
a. colloidal ligands
b. anabolic steroids
c. herbal extracts
d. branched chain amino acids

Answers

hope this helps..........
it would be anabolic steroids

Polar bears feed on seals. So, polar bears and seals share a _________ . Climate change has caused ice caps to melt in colder regions where polar bears live. This change has caused them to hunt less. This situation will lead to _________.
1.)
A. Prey Predator Relationship
B. Mutual Relationship
C. Parasitic Relationship
2.)
A. Less Biomass in the Quaternary level
B. Increased Biomass in the Quaternary level
C. Less Biomass in the Primary level

Answers

Polar bears feed on seals. So, polar bears and seals share a: A. Prey Predator Relationship  . Climate change has caused ice caps to melt in colder regions where polar bears live. This change has caused them to hunt less. This situation will lead to A. Less Biomass in the Quaternary level

Answer 1- A

             2-A

Polar bear is the top consumer in the polar bear food chain. Polar bear feeds on seals therefore they share prey predator relationship in which polar bear is predator which preys on seal.

Climate change reduces the ice which will ultimately effect the habitat of polar bears and will reduce the number of polar bears. Since the polar bear is top consumer than a decrease in polar bears will decrease the biomass in quaternary level.

Explain how chemical weathering differs from physical weathering.

Answers

chemical weathering is when chemical reactions dissolve minerals and change them into different minerals. physical weathering (or mechanical weathering) is when physical things such as plants, animals, or ice wedging, breaks the rock without changing its chemical makeup

Answer:

The difference is the way that each one works on rocks

Explanation:

Chemical weathering is related principally with water and its characteristics at the moment it enters in contact with the rock, like pH, salinity and others. This type of weathering changes the chemical characteristics of the rock and ist minerals, changings its originals components. It may happen as hydrolisis, hydration, disolution and oxidation.

Physical weathering implies mechanical actions related with temperature changes and tectonic forces that may fracture the rock and make smaller and smaller, giving space to chemical weathering to keep acting on the rock until it becomes just sediment. Physical weathering can occur as gelation, minerals growth, lagging or desiccation.

There's another kind of weathering: The biological one. It is related with animals actions like making caves for living or plants growth into the rocks.  

What is a cellular organelle? list 5 different organelles that a cell might possess, and indicate the function of each. also, specify which of these organelles carries its own dna. prof. morris only talked about two organelles in the lectures, but this is a topic that lends itself to an internet search?

Answers

A cellular organelle is a structure in the cell that performs a specific function.

Nucleus - stores cell's DNA; DNA replication occurs here

Ribosome - produce protein; "factories" of the cell

Mitochondria - breaks down food for energy to be used by the cell; "powerhouse" of the cell

Vacuole - store materials such as food, water, sugar, minerals, and waste products

Endoplasmic reticulum - carry materials throughout the cell; "transport system"

Mendel discovered that yellow seed color in pea plants is dominant to green. what offspring genotype probabilities are expected for a cross between a plant that produces yellow seeds (heterozygous genotype) and one that produces green seeds

Answers

Pea plants with yellow color, which are heterozygous have a genotype Aa
Pea plants with green color have a genotype aa (homozygous recessive).
If we cross them:
Parents: Aa  x  aa
F1 generation: Aa  Aa  aa  aa
This means that half of the offspring will have yellow color (Aa genotype) and half of them will be green (aa genotype). 

From past experience, it is known that 90% of one-year-old children can distinguish their mother's voice from the voice of a similar sounding female. a random sample of 20 one-year-old children are given this voice recognition test. calculate the variance.

Answers

1\20   all of  20 kids can know there mother name 

Of what benefit is sodium bicarbonate in the blood?

Answers

Sodium bicarbonate is the long name for baking soda, what it does is it helps stabilize your blood pH.

Hope this helps!

What is the main evidence of life in the early universe

Answers

The main evidence of life for the early universe would be photosynthetic bacteria. They are known to be longer than the Earth's atmosphere to preserve life. There are scientists who are studying about how these microorganisms in relation to photosynthesis.

The main evidence of early life includes carbon with an organic signature in ancient zircon grains, microscopic filaments from ancient hydrothermal vents, and 3.5 billion-year-old stromatolites. These findings, along with the cosmic evolution of the universe, shed light on the beginnings of life on Earth.

Evidence of Early Life in the Universe

The main evidence of life in the early universe is derived from multiple sources, including geochemical signatures, fossil records, and geological formations. Geochemically, carbon found in 4.1 billion-year-old zircon grains suggests an organic origin, indicative of life. In addition, 3.8-4.3 billion-year-old microscopic filaments from hydrothermal vent deposits in Quebec, Canada, offer evidence of very early life forms. Furthermore, well-preserved fossil evidence, such as the 3.5 billion-year-old stromatolites found in Australia, confirms the existence of photosynthetic microbial mats. These findings, combined with the understanding of the Big Bang and the subsequent formation of stars and galaxies, help us map out the history of life's beginnings on Earth.

Scientists continue to explore other features that might have provided evidence of life on early Earth, which also assists in the current search for extraterrestrial life. The early atmosphere's composition, particularly before oxygen levels became detectable approximately 2 billion years ago, remains a focal point for understanding early life detection.

With the advances in astronomy, we can see a universe that has evolved significantly over billions of years, and through cosmology, originate a consistent picture of this evolution, from the cosmic microwave background radiation to the formation of the earliest atomic nuclei comprised of deuterium, helium, and lithium.

Using the hardy-weinberg principle, which expression represents the frequency of the homozygous recessive genotype?

Answers

The Hardy-Weinberg Principle has two equations:
[tex]p + q = 1\\ p^{2} + 2pq + q^{2} = 1[/tex]

Answer: The frequency of the homozygous recessive genotype is the value of [tex]q^{2}[/tex].

biodiesel is often produced using

Answers

Biodiesel is often produced using recycled vegetable oil used in cooking food.

Cartels are easy to form and to maintain.
a. True
b. False

Answers

I Believe that would be B.False.

Cartels would not be an easy thing to form you have to first find people and its hard maintaining.

What dictates the structure of a protein molecule synthesized by the body? the body's need for a protein the dna inside the nucleus of the cell the number of essential amino acids available the combination of proteins consumed in the diet?

Answers

The DNA inside the cells nucleus.
Final answer:

The structure of a protein is determined by the DNA inside the nucleus of the cell, with each gene providing the code to construct a particular protein. Proteins are made of amino acids, some of which are essential and must be consumed in the diet. The combination of these amino acids determines the protein's structure and purpose.

Explanation:

The structure of a protein molecule synthesized by your body is determined primarily by the DNA inside the nucleus of the cell. Each gene in your DNA provides the code necessary to construct a particular protein, a process called gene expression. This involves using amino acids, the fundamental building blocks of proteins, which are bonded together to form unique sequences. Some of these amino acids are essential, meaning the body cannot synthesize them and they must be consumed in the diet.

Free amino acids available in the body are used in a process called protein synthesis. If a particular essential amino acid is not available in sufficient quantities, protein synthesis can slow or even cease. Essentially, it is the combination of these amino acids that dictates the structure and ultimate function of the protein. Protein shape is also critical to its function, and most proteins in the body are globular, like enzymes.

Learn more about Protein Structure here:

https://brainly.com/question/33255981

#SPJ3

Sandy experimented with the placement of the straw and the balloon while making this air powered toy car. He taped the straw and balloon to face toward the right. He told Tim that his toy will travel to the right. Tim said that Sandy was wrong. The toy will gradually spin in a circle. Which boy was right and why?. A) Sandy is right. The drag will force the car to turn to the right. B) Sandy is right. The car will move in the direction of the thrust. C) Tim is right. The car will spin in a circle because the earth is curved. D) Neither boy is right. The car will move in the opposite direction, to the left.

Answers

The answer is D) Neither boy is right. The car will move in the opposite direction, to the left. When he taped the straw and balloon to face toward the right, this will indicate the the air flow will go to the right side making the car move in the left side.

Which three industries would be most directly affected if regulations and laws regarding deforestation became stricter?
- Timber industry
- paper industry
- electric industry
- furniture industry
- coal industry

Answers

The answers are: Timber industry, paper industry, furniture industry.
These three industries depend on the trees so that they are able to make products. The timber industry uses the chopped trees, the paper industry uses the cellulose from the trees as it's basis for production, and the furniture industry makes it's products from certain types of tree. So stricter rules would mean big economic blows for this industries. 

Timber industry

Paper industry

Furniture industry

Surgical destruction of the drink center causes an animal to

Answers

Surgical destruction of the drink center causes an animal to Refuse water

Final answer:

Surgical destruction of the 'drink center' in an animal's brain would likely impair its ability to regulate thirst, possibly leading to dehydration or overhydration, although the provided options don't directly align with this outcome. This condition could broadly affect the animal's ingestive behaviors.

Explanation:

The surgical destruction of the “drink center”, likely referring to a critical area of the brain responsible for the regulation of thirst and possibly some aspects of feeding behavior, can have profound effects on an animal. While none of the provided options directly matches common scientific understandings, the closest implication is that the animal might face challenges with its intake of food and liquids. If we were to extrapolate based on typical neurological impacts, the animal might lose its ability to regulate thirst, possibly leading to dehydration or overhydration if it cannot inherently sense when it needs to drink.

However, the options given, such as the animal not being able to eat sweet and unspoiled food or distinguishing food that is dangerous, bitter, spoiled, sour, or sweet, seem more related to the sensory and cognitive aspects that would be affected by damage to other parts of the brain rather than specifically the “drink center.”

Research in neurophysiology indicates that regions such as the hypothalamus play a critical role in regulating thirst and hunger, and damage to these areas could disrupt normal eating and drinking habits. This underscores the interconnectedness of brain functions and the complexity of impacts that could arise from such surgical interventions. Recognizing the displacement between the provided responses and common neuroscientific knowledge, caution is advised in interpreting the question's implications.

An irritation of the stomach lining results in:

a) ulcer
b) gallstones
c) hemorrhoids
d) appensicittis

Answers

Should be C) Hemorrhoids

The correct option is a. ulcer. An irritation of the stomach lining typically results in an ulcer, which is a sore in the stomach or duodenum lining. Gallstones, hemorrhoids, and appendicitis affect different parts of the body. Thus, the correct answer is an ulcer.

An irritation of the stomach lining often results in the formation of an ulcer. An ulcer is a sore that develops in the lining of the stomach or the duodenum, the first part of the small intestine. When such a sore occurs in the stomach, it is referred to as a gastric ulcer, and it manifests symptoms like severe abdominal pain and bleeding.

Other listed conditions like gallstones, hemorrhoids, and appendicitis are associated with other parts of the body and do not usually result from irritation of the stomach lining. Here's a comparison:

Gallstones: Hardened deposits in the gallbladder.

Hemorrhoids: Swollen veins in the lower part of the anus and rectum.

Appendicitis: Inflammation of the appendix.

Hence, the correct option is a.

Which category most accurately describes waste such as food wastes, cardboard, cans, bottles, yard wastes, furniture, plastics, metal, glass, and e-waste?​?

Answers

Answer: Solid Type or solid wastes

Waste such as food wastes, cardboard, cans, bottles, yard wastes, furniture, plastics, metal, glass, and e-waste are categorized as solid wastes.

 

Solid waste is any garbage or rubbish that we make in our homes and other places. They are wastes that are non-liquid.

Prior to the start of the experiment, the students hypothesized that both the vinegar and Kayro syrup solutions would be hypertonic to the contents of their eggs. The student data can be seen in the data table above. Does this data confirm their initial hypothesis? Explain.

Answers

The answer would be 'C' 
~No. The egg in vinegar had an increase in mass therefore vinegar would be hypotonic to the egg's contents.

The egg in vinegar had a gain in mass, so vinegar would be hypotonic to the egg's collections. A cell (an egg in this case) in a hypotonic solution increases mass; in a hypertonic solution, it loses mass.

What is the hypertonic solution?

A hypertonic solution is any outer solution that has low water concentration compared to body fluid and a high solute concentration. In a hypertonic solution, the final movement of water will become out of the body and into the solution.

Solution is considered as hypotonic to the cell if the solute concentration outside the cell is less as compared to inside the cell. The solution is hypertonic if the amount of solutes is high as compared to inside the cell.

Therefore, the egg in vinegar had a gain in mass, so vinegar would be hypotonic to the egg's collections.

Learn more about hypertonic, here:

https://brainly.com/question/28020628

#SPJ2

Prokaryotes will take up foreign dna . How is this characteristic used in genetic engineering

Answers

Prokaryotes have the ability to take up foreign DNA. This ability is utilized by scientists to produce certain product. For instance, a gene that code for a particular protein can be inserted into a prokaryote for mass production. Thus, scientist used this method to produce in large quantity the products that they need.

Which of the following provides the best evidence for the idea that multicellular organisms are composed of highly organized arrangements of differentiated cells? A. The chloroplasts of a plant cell capture light energy that can be used to make food. B. A mouse cell divides into two identical daughter cells through the process of mitosis. C. A frog cell obtains energy from the bonds of food molecules through cellular respiration. D. Sheets of bone cells in a rabbit's body are connected to muscle cells that allow movement.

Answers

Multicellular organisms are those composed by multiple cells. The option (A)  provides the best evidence for the idea that multicellular organisms are composed of highly organized arrangements of differentiated cells.

What are multicellular organisms?

Multicellular organisms, composed of multiple similar cells, occur widely within the eukaryotic tree of life, and a few of these evolved into more complex multicellular organisms characterized by differentiated tissues and organs.

Animals, plants, and fungi are multicellular organisms. Multicellular organisms are much bigger in size and are very complex and intricate in their composition along with structure. Human beings, animals, plants, insects are examples of multicellular organisms.

Examples are Amoeba and Paramecium. The organisms that we can see with our eyes have many cells and hence are all multicellular organisms. Bear is a multicellular animal.

Learn more about multicellular organisms:

https://brainly.com/question/24381583

#SPJ3

Final answer:

The best evidence for the idea that multicellular organisms consist of organized arrangements of differentiated cells is shown by the sheets of bone cells connected to muscle cells in a rabbit, as it demonstrates specialized cell functions working together to permit movement.

Explanation:

The best evidence among the options provided is D. Sheets of bone cells in a rabbit's body are connected to muscle cells that allow movement. This is because it demonstrates how different types of cells in a multicellular organism have specialized functions and are organized in a way that enable the organism to perform complex tasks, like movement. Each type of cell has a specific role, and they work together in a coordinated way.

Chloroplasts are specialized organelles found in plant cells that capture light energy through the process of photosynthesis and are important for energy conversion. However, chloroplasts alone do not best demonstrate the highly organized structure of differentiated cells within an organism. Similarly, the processes of cellular respiration and mitosis are vital for the functioning and growth of cells, but they do not directly illustrate the concept of cell differentiation and organization within a multicellular organism, making them less relevant options.

Which law did the U.S. Congress pass as a response to the Dust Bowl?

Answers

1935 they passed the Soil Conservation Act
soil conservation and domestic allotment act of 1936
Other Questions
Which of the following strategies would most likely improve water conservation at a plant that manufactures computer chips? (2 points) Decrease the size of each chip Increase the number of chips manufactured in a day Move the plant to a location that is closer to a body of fresh water Replace toxic chemicals used to make the chips with nontoxic chemicals When a country brings in goods that were made in another country, what is it doing? Can somebody paraphrase this for me?Ten years from now, I see myself as a strong, independent, healthy, and most important of all, happy woman, and I am aware that the only person that can get me there is myself by putting all the passion, effort and determination I have in everything I do. HELP ASAP (dont answer if your not sure)Which of these types of art thrived during the golden age of Chandra Gupta?A: Sculptures, Dance, PaintingsB: Agriculture, Music, SculptureC: Metalworking, painting, art OrD:Math, Medicine, public Works Read the passage.(1) William Shakespeare was born in 1564 in Stratford-upon-Avon. (2) It is a town in England. (3) He is believed to have attended the Kings New School there from age seven to age fourteen. (4) Teachers were strict in Shakespeares day. (5) The school day was long. (6) In the summer, school started at 6 a.m. (7) School did not end until 5 p.m. (8) In the winter, the school day was an hour or two shorter. (9) At age nine, students began learning Latin. (10) It was the language of international affairs. (11) In school, students spoke Latin. (12) Teachers also spoke Latin. (13) Students caught speaking English in school were punished.Which is the most effective way to combine sentences (6) and (7)?a.Not ending until 5 p.m., school in the summer started at 6 a.m.b.The summer school day, ending at 5 p.m., started at 6 a.m.c.Starting at 6 a.m. and not ending until 5 p.m. was school in the summer.d.In the summer, school started at 6 a.m. and did not end until 5 p.m. Mri studies of persons using inhalants have revealed that the drug causes changes in brain structure that include What sequence on a dna molecule indicates where rna polymerase should begin transcription? Thomas had three different types of coins in his pocket, and their total value was $2.72. He had twice as many pennies as quarters and one less dime than the number of pennies. How many quarters did he have? This nation is the second-largest producer of opium in the world. -Cambodia -Laos -Myanmar -Brunei What type of severe weather would most likely decrease coral reef biodiversity by damaging coral skeletons and polyps? are these answers correct How did Chiang Kai-sheks fear of communism cause him to alienate many Chinese intellectuals and political moderates? Olgas family traveled 942 kilometers on the first day of their trip and 894.5 kilometers on the second day.How many more meters did Olgas family travel on the first day?I'm in K12 and if you are too and have the answer, plz help Seventy percent of the bicycles sold by a certain store are mountain bikes. among 100 randomly selected bike purchases, find the probabilities below. (round your answers to four decimal places.) (a) what is the approximate probability that at most 75 are mountain bikes? Find the range of the following data. 5.3, 6.2, 3.1, 4.8, 7.3 Hey can you please help me out posted picture of question We pigged out last night. How do I make this a formal sentence? please help with math? will give branliest!!2.A wildlife refuge in South America has howler monkeys and spider monkeys. A biologist working there randomly selected eight adults of each type of monkey, weighed them, and recorded their weights in pounds.howler monkey: {15, 16, 17, 17, 17, 17, 18, 19}spider monkey: {12, 13, 13, 14, 14, 14, 16, 16}(a)Calculate the median each type of monkey.(b)Calculate the mean for each type of monkey.(c)Calculate the MAD for each type of monkey.(d)Calculate the means-to-MAD ratio for the two types of monkeys. (e)What inference can be made about the weight of both types of monkeys? Explain.Answer: Which statement is true of an oral tradition? A.It focuses on deepening cultural fears. B.Its stories involve powerful gods, cruel monsters, and ordinary heroes. C.It is passed down from generation to generation. D.Its stories can be found painted on cave walls. -3x-4=-13 solve inequality plz show work!