Which of the following body parts has involuntary muscles?

A.Arm
B.Face
C.Intestine
D.Leg

Answers

Answer 1

Answer:

intestine has involuntary muscles

Answer 2

Answer:

intestine

Explanation:


Related Questions

(WILL MARK BRAINLIEST, I NEED HELP URGENTLY)

What is the DNA Sequence, Resulting mRNA sequence, Complementary tRNA
sequence, and Resulting Amino Acid sequence

Answers

Answer:

a.The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’

(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)\

b.The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’

c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’

(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)

d.The third codon is 5’ ACC 3’.  Therefore, the corresponding anti-codon is 5’ GGU 3’

Frost wedging happens when__

Answers

Answer:

Frost wedging occurs as the result of expansion of water when it is converted to ice. Cracks filled with water are forced further apart when it freezes.

Answer: The correct option is water freezes inside a rock, causing it to break

Explanation:

Which part of a mushroom can you see above the ground?

Answers

Answer:

The correct answer is reproductive part.

Explanation:

The mushroom belongs to the family of fungus. It is composed of two parts one underground part called as mycellium and the other part which can be seen above the ground. This part is the reproductive part of mushroom which is often edible. The other parts of the mushroom includes stem, hypae, volva, spores, gill, ring cap. There are variety of mushrooms available but all the forms are not eatable some of them are poisonous to human health.

Why do geese fly together in a V formation?

Answers

Explanation:

Geese fly together in a v formation.

Geese fly together because when the first goose flaps it's wings it creates an upward force which make it easier for the second goose to fly.

In this way the force increases and the effort the last goose has to spend to fly decreases a lot.

Hope it helps you.

please mark as brainliest.

Answer:

B. to save energy

Explanation:

ody ssey Unit 3, Assignment 2. Animal behavior and Interdependencies, page 4, under Group Animal Behavior, paragraph 2, from " The lead goose....V formation.....making their flight easier."  

nowhere in my ody ssey unit materials did it mention otherwise or geese again.  

Why is carbon dioxide considered a greenhouse gas? (A) It is released when fossil fuels are burned. (B) It is part of the carbon cycle, which is also known as the greenhouse cycle. (C) It can absorb infrared radiation. (D) It is responsible for protecting organisms from UV radiation.

Answers

Answer:

C It can absorb infrared radiation

Explanation:

need help plzzzzzzzz In this assessment, you will categorize a group of animals by two forms of classification: phylogeny (cladistics) and Linnaean taxonomy. For phylogeny, you will create a cladogram for your groups of animals. For Linnaean classification, you will create a taxonomy chart or concept map that categorizes your species by taxa. Select from the two groups of animals listed below for your project.

Bird Group: Blue Jay, robin, cardinal, finch, and pelican
Insect Group: African honeybee, grasshopper, black widow spider, mosquito, and yellow jacket

Answers

Answer:

Blue Jay

Kingdom: Animalia

Phylum: Chordata

Class: Aves

Order: Passeriformes

Family: Corvidae

Genus: Cyanocitta

Species: C. cristata

Robin

Kingdom: Animalia

Phylum: Chordata

Class: Aves

Order: Passeriformes

Family: Turdidae

Genus: Turdus

Species: T. migratorius

Cardinal

Kingdom: Animalia

Phylum: Chordata

Class: Aves

Order: Passeriformes

Suborder: Passeri

Family: Cardinalidae

Finch

Kingdom: Animalia

Phylum: Chordata

Class: Reptilia

Class: Aves

Order: Passeriformes

Superfamily: Passeroidea

Family: Fringillidae

Pelican

Kingdom: Animalia

Phylum: Chordata

Class: Aves

Order: Pelecaniformes

Family: Pelecanidae

Genus: Pelecanus

Explanation:

I put it into the graph they want, and I got a 100%. (If your in FLVS like me, try to re-word it or put it in a different setting.)

The two groups of animals listed below for your project are as follow:

1. Blue Jay

Kingdom: AnimaliaPhylum: ChordataClass: AvesOrder: PasseriformesFamily: CorvidaeGenus: CyanocittaSpecies: C. cristata

2. Robin

Kingdom: AnimaliaPhylum: ChordataClass: AvesOrder: PasseriformesFamily: TurdidaeGenus: TurdusSpecies: T. migratorius

3. Cardinal

Kingdom: AnimaliaPhylum: ChordataClass: AvesOrder: PasseriformesSuborder: PasseriFamily: Cardinalidae

4. Finch

Kingdom: AnimaliaPhylum: ChordataClass: ReptiliaClass: AvesOrder: PasseriformesSuperfamily: PasseroideaFamily: Fringillidae

Kingdom: AnimaliaPhylum: ChordataClass: AvesOrder: PelecaniformesFamily: PelecanidaeGenus: Pelecanus

What is animal classification chart?

Kingdom, phylum, class, order, family, genus, and species are the classification levels in order.

Thus, this the answer.

To learn more about animal classification click here:

https://brainly.com/question/24095327

#SPJ2

How is an egg fertilized in flowering plants?


A.
with sperm


B.
by spores


C.
with an ovule


D.
with embryos

Answers

Answer: A. with sperm

Explanation:

How does introduced species harm our planet?
Please someone answer this
ASAP!!!

Answers

Introduced species can harm our planet because in some regions of the world we are not prepared for their type of species, which can all in all cause damage.

Answer: alteration of the ecosystem

Explanation:when a new specie is introduced into the ecosystem it may have profound affects in the ecosystem and may also be called an invasive specie.

The affects that it may have on the ecosystem include

1.outcompeting the native specie and sometimes even leading to their extinction because the new specie may be modified in such a way as to have better chances of survival in the ecosystem because of their evolved genetics e.g : the new specie may encounter a native and non evolved specie of the ecosystem and compete with it for survival leading to reduction and even complete eradication of the native specie

please, answer the question immediately as it is important for my project. the motions of comets and asteroids in our solar system are predictable because they are
1)smaller than planets
2)nearly spherical in shape
3)in orbit around the sun
4)controlled by earth's gravity

Answers

I think its 3)in orbit around the sun

i hope i helped even just a little :)

3) in orbit around the sun.

The motions of comets and asteroids in our solar system are predictable because they are in orbit around the sun.Asteroids are rocky. They come from the inner solar system, where any ice would have been baked off by the sun long ago. Their orbits are fairly predictable. That means new comets can arrive in the inner solar system ,something we have no way of predicting ahead of time.Asteroid revolves around the Sun in elliptical orbits.

Learn more:

brainly.com/question/17717852

Influenza, or the flu, is an infectious disease that affects mammals and birds. The flu cannot be treated with antibiotics because
A.
it is caused by two unique strains of bacteria.
B.
it is caused by a fungus, not a bacterium.
C.
it is caused by a virus, not a bacterium.
D.
it is caused by a highly resistant strain of bacteria.

Answers

Answer:

C. It is caused by a virus, not a bacterium

Explanation:

The answer is C influenza is caused by viruses not a bacterium

viruses invade your cells and the antibiotics can’t get to your cells through the blood they can only kill bacteria which harbours inside the blood

40 POINTS!!! NEED GOOD ANSWERS!!!
What is the correct definition of conflict? A. A disagreement between people with opposing viewpoints. B. A negative and unjustly formed opinion, usually against people of a different racial, religious, or cultural group. C. Using another person to help reach a solution that is acceptable to both sides. D. Discussing problems face-to-face in order to reach a solution.

Answers

The statement (A) is correct. A disagreement between people with opposing viewpoints.

What do you mean by conflicts?

A conflict is a struggle and a clash of interest, opinion, or even principles. Conflict will always be found in society; as the basis of conflict may vary to be personal, racial, class, caste, political and international.

Moreover, conflict is serious disagreement and argument about something important. If two people or groups are in conflict, they have had a serious disagreement or argument and have not yet reached agreement. Try to keep any conflict between you and your ex-partner to a minimum.

Therefore, the opposing force created, the conflict within the story generally comes in four basic types: Conflict with the self, Conflict with others, Conflict with the environment and Conflict with the supernatural.

Learn more about conflicts:

https://brainly.com/question/12832202

#SPJ2

I need help now
Which type of bacteria is shown in the image?
A. bacillus
B. coccus
C. spirillum
D. cholera

Answers

Answer is B bacillus

The bacteria shown in the image are bacillus bacteria. Therefore, option A is correct.

Bacillus bacteria are a group of rod-shaped, gram-positive bacteria that belong to the genus Bacillus. They are characterized by their ability to form endospores, which are dormant structures that allow them to survive in harsh conditions. Bacillus bacteria are widely distributed in nature and can be found in soil, water, and various organic materials.

Some notable species of Bacillus include Bacillus subtilis, Bacillus cereus, and Bacillus anthracis. Therefore, option A is correct.

Learn more about Bacillus bacteria, here:

https://brainly.com/question/11201874

#SPJ4

The four principles of natural selection

Answers

1) Variation: there needs to be a difference in the individuals within a population

2) Inheritance: These variable traits must be able to be passed down genetically

3) Growth rate: There needs to be a growth rate that requires a struggle for resources

4) Survival rate: There needs to be a difference in survival rate for the different variation types... certain variations will live

Final answer:

The four principles of natural selection are variation, inheritance, high rate of population growth, and differential survival and reproduction. This means members of a species are variable, part of this variation is inheritable, populations produce more offspring than can survive, and those with better survival traits are more likely to pass them on.

Explanation:

The four principles of natural selection are: variation, inheritance, high rate of population growth, and differential survival and reproduction.

The principal of variation means individuals within species are variable. Inheritance means that some of these variations are passed on to offspring. High rate of population growth means that populations produce more offspring than can survive, leading to competition. Lastly, differential survival and reproduction states that individuals with advantageous traits are more likely survive and reproduce than those without these traits.

Combined, these principles drive the process of natural selection, causing species to adapt to their environments over time. In any given environment, the individuals with traits best suited to that environment will have the greatest chances of surviving and passing those traits on to the next generation.

Learn more about Natural Selection here:

https://brainly.com/question/32227158

#SPJ6

In order from less complex to more complex, which level of organization is directly after tissue?

Answers

Elements. Knowledge of basic science includes the distinction between atoms and molecules, and elements, mixtures and compounds. ...

Molecules. The size of molecules varies enormously depending on the type of molecule.

Organelles.

Cells.

Tissues.

Organs.

Organ Systems.

Organism.

Answer:

a

Explanation:

hope it helps

What happens to a virus involved in the lysogenic cycle?

Answers

Answer:

The lytic cycle involves the reproduction of viruses using a host cell to manufacture more viruses; the viruses then burst out of the cell. The lysogenic cycle involves the incorporation of the viral genome into the host cell genome, infecting it from within.

The information contained in the table could be used _______________________.

Answers

Can you attach the table so I can see it??

Answer:

A

Explanation:

to establish the degree of relatedness among these organisms The more similar the DNA, the greater the degree of relatedness, or the more recent in time the two organisms diverged from a common ancestor. If there is a great difference in DNA sequencing, this suggests that the organisms shared a common ancestor a long time ago.

Chapter8 lesson 2 cell structure

Answers

Answer:

Can you give me more details about this question?

Answer:

wdym

Explanation:

The function of the eardrum is to

Answers

Answer:

A. carry the sound energy to the brain. B. collect the sound waves. C. amplify the received sound. D. vibrate with the frequency of the received sound.

These are the choices right? Well, I think that its D. vibrate with the frequency of the received sound. I hope its correct bc im on the same question.. good luck:) {MARK BRAINLIEST!!!}

The two immediate functions of the eardrum are auditory and protective.

The eardrum is the membrane of the middle year which vibrates in response to sound waves; also the tympanic membrane.

How can we protect(s) the eardrum from dirt?

The earwax is the part of the ear that protects the eardrums from dirt and infections. These are produced by glands in the skin linings of the ear canal responsible for protecting the ear. The ear is divided into three sections: Outer, middle, and inner ear.

Earwax is found in the outer ear section lining the ear canal protecting the passage to the eardrum.

Earwax when removed in excessive amounts may cause the ears to develop certain infections and might cause the infections of the other sections of the ears as well.

Thus, this could be the answer.

To learn more about eardrum  click here:

https://brainly.com/question/13740969

#SPJ2

Can a tornado pick up a person and send it to another island?

Answers

Answer: almost imposiable

Explanation: If you do happen to get picked up a tornado the longest time you will stay in it is approximately 5 minutes before it throws you out of it. If you did so happen to be swept in a tornado near a island it is possiable, but tornados over water die very very fast so this is very unlikley.

Hope this helps

Answer:

Nope.

Explanation:

Now I don't know anything about much about tornado's. But I'm pretty sure it won't pick up that person and send it to another island. I don't think the tornado have enough force to throw the person to another island. It will, however, send that person on another area maybe close to the tornado area. But yet again I don't the tornado have the abilty to do that.

Linnaeus is considered the "Father of _____." Modern Taxonomy Botany Zoology

Answers

Answer:taxonomy

Explanation:

Modern Taxonomy

Carolus Linnaeus it credited with developing the scientific naming and classification system.

Hope this helps!!

The action by which a plant grows toward sunlight is called _____.


response to stimulus

using energy

reproduction

movement

Answers

Answer: phototropism

Explanation: phototropism is a plant's response to light.

Plants growing toward sunlight is known as tropism, a response to stimuli.

Tropism is the action by which a plant grows toward sunlight. This growth movement is a response to stimuli where the plant or a part of it grows in the direction from which the stimulus originates.

A geologist concludes that a rock sample is an extrusive igneous rock. Based on this information, which statement about the rock is accurate?

A. The rock formed from cooling lava.
B. The rock likely came from a pluton.
C. The rock cooled slowly over millions of years.
D. The rock formed within Earth's crust.

Answers

The correct answer is D

The accurate statement about an extrusive igneous rock is that it formed from cooling lava, which cools quickly at the Earth's surface, leading to a finer-grained texture.

Based on the information that a geologist concludes a rock sample is an extrusive igneous rock, the accurate statement about the rock is A. The rock formed from cooling lava. Extrusive igneous rocks such as basalt are formed above the surface when molten rock, known as lava, extrudes onto the Earth's surface and cools quickly. This rapid cooling does not allow large crystals to form, leading to a finer-grained texture, and in some cases, such as with obsidian, a glassy texture due to the extremely rapid cooling.

Option B is incorrect because rocks that come from plutons are intrusive, rather than extrusive, and they cool slowly within the Earth's crust. Option C is incorrect as extrusive igneous rocks do not cool slowly over millions of years. Option D is also incorrect because extrusive igneous rocks form at the Earth's surface, not within the Earth's crust.

There are several problems with classifying organisms into six kingdoms of life. One problem is that _______ aren't well defined and are very diverse. In addition, any eukaryotes that don't fit into other kingdoms are placed in this kingdom. A. fungi B. plants C. archaea D. protists

Answers

Answer:

D. Protists

Explanation:

Kingdom protista is composed of mostly unicellular organisms, but they do include some multicellular organisms. Like your problem says, eukaryotes that do not fit in other kingdoms are placed in this kingdom. As a result, even members of this kingdom do not share many similarities, as the organisms here are diverse.

The answer is D. Protists

Which process involves making glucose without energy from sunlight?
A. Photosynthesis
B. ATP formation
C. NADPH formation
D. Chemosynthesis

Answers

Answer:

Chemosynthesis

Explanation:

Its right trust me

the correct answer is chemosynthesis <3

1: Fill in the blanks: The process of
_____is
the scientific term used for water moving across
a semi-permeable membrane. Water tends to
move from the side with a________
concentration of solute to the side of the
membrane with a________
concentration of
solute

Answers

In order: osmosis, higher, lower

Osmosis higher lower

what are two ways variation in the trait could be introduced into the population?

Answers

A single mutation can have a large effect, but in many cases, evolutionary change is based on the accumulation of many mutations. I hope this help you

Answer:

i sai sai

Explanation:

sia sia sai In a running relay, each runner ran an equal part of the total distance.  Joseph and 3 othe

Figure 10-4
49
replicate DNA
a
In Figure 10-4. what role does structure A play in mitosis?
b. increase cell
connect to spindled dissolve nuclear
volume
fibers
envelope
Figure 10-5

Answers

Structure A in Figure 10-4 is the centrioles.  role does structure A play in mitosis  is: (c) connect to spindle fibers

Centrioles are paired organelles that are found in the cytoplasm of eukaryotic cells. They are composed of microtubules, which are long, thin filaments that form the structural framework of the cell. During interphase, the centrioles are located near the nucleus and are surrounded by a cloud of protein called the centrosome.

As the cell progresses into mitosis, the centrioles replicate and move to opposite poles of the cell. This process is called centrosome separation. The centrosomes act as organizing centers for the spindle fibers, which are microtubules that extend from the centrosomes and attach to the chromosomes. The spindle fibers play a crucial role in separating the chromosomes during mitosis.

Solve this Sex-Linked traits practice problem

Answers

We know that hemophilia is a recessive trait, and the only way to express a recessive trait is to have a homozygous mixture. So, the genotypes probably look like this:

BB = normal blood clotting
Bb = carrier for hemophilia
bb = hemophiliac

Because the mother does NOT have hemophilia, we will be using BB x Bb to find out the alleles of their children. Because this is sex-linked traits practice, our alleles will be the following.

normal = X^BY
(uppercase B represents no hemophilia)

X^BX^b

Let’s cross them and see what we get!

X^B Y

X^B | X^BX^B X^BY

X^b | X^BX^b X^bY

As you can see, 0/4 of the females (represented by XX) will have hemophilia. Again, it is only present when there are two recessive alleles and none of them satisfy that.

2/4 of the females will be carriers (X^BX^b).

As for the boys, 1/4 will have normal clotting and 1/4 will have hemophilia. None of the males will simply be carriers.

I hope I helped!
Feel free to ask me for more assistance (if needed); I’ll gladly help! :)



Mid-ocean ridges are underwater mountainous regions formed by the separation of ___________. A) tsunamis B) tectonic plates C) continental divides D) subatomic particles

Answers

Answer:B, tectonic plates

Explanation:

A group of environmental activists in West Virginia wants to save a large forest. Which act will help them in this activity?

1. Nature conservancy
2. Toxic substance control act
3. Eastern wilderness areas act
4. Endangered species act

Answers

Answer:

A

Explanation:

Answer: 1. Nature conservancy

Explanation:

Nature conservancy is the process or initiative taken by the human society to conserve the regions of forests and the associated wildlife, fossil fuels, water sources and others. This practice will ensure that the valuable resources will remain available for the present as well as for the future generation of human beings.

On the basis of the above description, nature conservancy is the activity which will help the environmental activists to save the forests.

Other Questions
Cara os making potato salad for a cook out. One serving of potato salad has 1 1/2 cups of cooked potatoes and 1/4 cup of mayonnaise. How many cups of potatoes would be needed if cara uses 3 1/4 cups of mayonnaise? Which of the following would not be characteristic of a chain restaurant? A. well-recognized name and brandingB. standardized menu and preparation methodsC. ability to set your own hours of operationD. payment of fees for rights to use the name In a kitchen there are three containers that can hold different quantities of water, as shown in the figure below:Three containers of the same shape but different sizes are shown, starting with the shortest and ending with the longest. The following quantities are written below the containers. x minus 10 liters below the first, x minus 5 liters below the second, and x liters below the third.How many liters of water can the three containers hold in all? x 15 3x 15 x3 + 50 3x3 15 1. Including a full-wave rectifier in an AC circuit will yield a/an _______ current. A. continuous alternating B. continuous direct C. intermittent alternating D. intermittent direct2. A transmission system at a radio station uses a/an _______ to convert a direct current into a high-frequency alternating current. A. modulator B. oscillator C. demodulator D. transmitting antenna3. Combining which of the following substances with germanium will cause the germanium to emit free electrons? A. Indium B. Gallium C. Bismuth D. Aluminum6. Which of the following does not affect the electrical resistance of a body? A. Bodies directly surrounding the body B. Length of the body C. Temperature of the body D. Material composing the body8. Which of the following is an accurate description of the relationship demonstrated in Ohm's Law? A. The resistance (ohms) divided by the current (amperes) equals the electric potential (volts). B. The electric potential (volts) divided by the current (amperes) equals the resistance (ohms). C. The electric potential (volts) multiplied by the resistance (ohms) equals the current (amperes). D. The electric potential (amperes) divided by the resistance (ohms) equals the current (volts).11. A series circuit contains a generator, two devices, and connecting wires. The resistances of the two devices are 15 ohms and 10 ohms. The voltage supplied by the generator is 75 V. What will be the voltage drop in the device with 10 ohms of resistance? A. 3 V B. 45 V C. 25 V D. 30 V13. If a bar magnet's neutral region is broken in two, what will most likely occur? A. Each of the two segments of the original bar magnet will have a north and south pole. B. The segment that's longer will have a north and south pole. C. One segment will have only a north pole, the other segment will have only a south pole. D. Neither segment will have a north or south pole16. Which of the following would decrease the resistance to the flow of an electric current through a body? A. Using a conductor with a smaller cross section B. Lengthening the conductor C. Shortening the conductor D. Heating the conductoreeach question is worth 5 points I will give brainliest answer About when did the first limbs evolve in tetrapods (land-dwelling vertebrates)? Read this excerpt from The Adventures of Robinson Crusoe:[The captain) offered me also sixty pieces of eight more formy boy Xury, which I was loth to take; not that I was notwilling to let the captain have him, but I was very loth tosell the poor boy's liberty, who had assisted me sofaithfully in procuring my own.What impact does the phrase "sell the poor boy's liberty" have on the meaningof this passage?A. It makes the reader aware of how young Xury is and how far he isfrom home.OB. It shows that the captain respects Crusoe because he's asking hispermission to buy Xury.C. It emphasizes the point that Xury is Crusoe's property and Crusoecan do with him as he pleases.D. It highlights the fact that Crusoe has grown fond of Xury after allthey've been through together. Which statements are true of the Aboriginal peoples?Choose ALL answers that are correct please help A. They developed about 400 languages.B. Their culture and arts are closely tied to their beliefs about creation.C. They hunted the kiwi, a fight less bird, to extinction. D. They never settled permanently t in one location. Outgroup homogeneity is: a. When you see members of an outgroup as diverse. b. When you see members of an outgroup as similar. c. When you see members of an ingroup as diverse. d. When you see members of an ingroup as similar. When parasites are found in food, the food has been exposed to _____ contamination.options-biologicalphysical chemicalbiological AND physical what is the midpoint of the line segment with endpoints (3, 2, 2, 5) and (1, 6, -4.5)?A. (4.8, -1)B. (2.4, -2)C. (4.8, -2)D. (2.4, -1) Read the passage from "Marriage Is a Private Affair" by Chinua Achebe. In this excerpt, Nnaemeka is the first to speak, and Okeke speaks after him. "I cantwe mustI mean it is impossible for me to marry Nwekes daughter. "Impossible? Why? asked his father. "I dont love her. "Nobody said you did. Why should you? he asked. "Marriage today is different . . . "Look here, my son, interrupted his father, "nothing is different. What one looks for in a wife are a good character and a Christian background. Nnaemeka saw there was no hope along the present line of argument. How could the characters differing views of arranged marriage be analyzed from a historical perspective and from a feminist perspective? A historical perspective would focus on arranged marriage being part of the culture at the time the story is set. A feminist perspective would focus on how arranged marriages took choice away from women. A feminist perspective would focus on arranged marriage being part of the culture at the time the author wrote. A historical perspective would focus on how arranged marriages took choice away from women. A historical perspective would focus on how the story would be different if it were written by an author of a different gender. A feminist perspective would focus on how the characters interact. A feminist perspective would focus on the biography of the author. A historical perspective would focus on the power dynamics between characters. In socially stratified societies, the relative frequency of many diseases, health problems, and death rates varies directly with The number of instructions N performed per second by a computer varies directly as the speed S of the computer's internal processor. A processor with a speed of 20 megahertz can perform 1 comma 600 comma 000 instructions per second.a) Find an equation of variation.b) How many instructions per second will the same processor perform if it is running at a speed of 180 megahertz? Given y=x2 + 9x + 20 find the zeroes. Why is cloture very difficult to achieve? 6x(x 4) 16x2 (9x 1)?A. -10x2 33x + 1B. 10x2 33x + 1C. -10x 33x + 1D. -10x2 + 33x + 1 According to The Thrill of the Chase, what have some treasure hunters gotten out of their efforts to find the treasure? 1Points A legal problems due to trespassing on private lands B a share of the treasure when it is found C time out in the mountains and experiences shared with family D the opportunity to meet Fenn and his celebrity friends Match the drug with a mode of action PLEASE HELPAn aggregate is one type of land resource. What is an aggregate?a layer of solid rock found beneath soilthe top layer of soila natural mixture of sand, gravel, and crushed stonea naturally occurring mineral or rock Write the coordinate pairs of 3 points that can be connected to construct a line that is 5 1/2 units to the right of and parrallel to the y-axis.