Which of the following do you calculate
when you divide the total distance trav-
eled by the total travel time?​

Answers

Answer 1
dividing distance by time gives you speed

Related Questions

the amount of water returning to the earth through precipitation is blank the amount of water leaving the earth through evaporation

Answers

Answer:

The amount of water entering the earth through precipitation is equal to the amount of water leaving earth through transpiration.

Explanation:

Rates of precipitation and evaporation vary widely according to regions and seasons. But in a global scale the rates are equal. Thus the total amount of earth’s water maintains its constancy even though there is a continuous change in forms of water.

Evaporation and transpiration are the forms in which Water leaves the earth and it returns to the earth in various forms of precipitation like rain, snow, dew, fog etc. This water then reaches ocean and land. The water that reaches the land flows as surface run off into rivers and water bodies or seep into the ground replenishing the ground water table.

Final answer:

The water cycle is a balanced system that allows water to circulate between the earth's oceans, atmosphere, and land. Water leaves the earth through evaporation/sublimation, reenters the atmosphere, condenses, and falls back to the earth through precipitation. The amount of water returning to the earth matches the amount leaving it, maintaining equilibrium.

Explanation:

The water cycle, also known as the hydrological cycle, is a continuous process by which water circulates between the earth's oceans, atmosphere, and land. This cycle involves several key stages such as evaporation/sublimation, condensation/precipitation, and surface runoff/snowmelt.

Firstly, water from the land and oceans enters the atmosphere through evaporation or sublimation, where it condenses into clouds. This condensation ultimately falls back to the earth's surface as precipitation, such as rain or snow. Therefore, the amount of water returning to the earth through precipitation equals the amount of water leaving the earth through evaporation.

Once the water hits the earth, some of it may infiltrate into the soil or enter freshwater bodies. In most natural terrestrial environments, rain encounters vegetation before it reaches the soil surface. Some of this water evaporates immediately from the surfaces of plants in a process known as evapotranspiration.

After precipitation, water may travel over the surface as runoff into various bodies of water, eventually reentering the ocean, thus completing the cycle. In conclusion, the water cycle is a balanced system with the water leaving and coming back to the earth in similar quantities.

Learn more about Water Cycle here:

https://brainly.com/question/31195929

#SPJ3

Measuring spoons are used when measuring
less than how much?​

Answers

Measuring spoons are used when measuring less than 1/4 cup

We can see here that measuring spoons are used when measuring less than 1/4.

What is Measuring spoon?

Measuring spoons are used when measuring less than one tablespoon or teaspoon of an ingredient. These spoons are designed to provide accurate measurements for small quantities of dry or liquid ingredients used in cooking and baking. Measuring spoons typically come in sets, with the most common sizes being 1 tablespoon (tbsp), 1 teaspoon (tsp), 1/2 teaspoon, 1/4 teaspoon, and sometimes 1/8 teaspoon.

When recipes call for precise measurements of ingredients, especially in baking, measuring spoons are essential to ensure the right balance of flavors and the desired outcome of the dish. They are particularly useful when dealing with potent or costly ingredients, as small variations in quantities can significantly impact the final result.

Learn more about Measuring spoon on https://brainly.com/question/29067969

#SPJ6

It takes a pulse of light 35 microseconds to travel down a 5.0 km length of fiber optic cable. How fast does light move through the cable (in m/s)?

Answers

It takes 7 microseconds for each km

The net Forward force on the propeller of a 3.2 KG model airplane is 7.0 N. What is the acceleration of the airplanes

Answers

Answer:

[tex]2.1875 ms^{-2}[/tex]

Explanation:

Newton's second law: [tex]F=ma[/tex] Let's substitute and solve for whatever is left behind:[tex]7.0N= 3.2kg *a[tex]a =\frac {7.0}{3.2} \frac{N}{kg} = 2.1875 \frac{kg\frac{m}{s^2}}{kg}=2.1875 \frac{m}{s^2}[/tex]

The value of acceleration of the airplane is [tex]2.19 \;\rm m/s^{2}[/tex].

Given data:

The mass of propeller model is, m = 3.2 kg.

The net force on the propeller model is,  F = 7.0 N.

Apply the Newton's second law, which says that the applied force on an object is equal to the product of mass of object and acceleration of object, caused due to applied force.

Then the expression is,

[tex]F = m \times a[/tex]

here, a is acceleration.

Solving as,

[tex]7 = 3.2 \times a\\a=2.19 \;\rm m/s^{2}[/tex]

Thus, the required value of acceleration of the propeller model is [tex]2.19 \;\rm m/s^{2}[/tex].

Learn more about the Newton's second law here:

https://brainly.com/question/13447525


A man moving at 2 m/s accelerates at a rate of 3 m/s² for 2.5 seconds. What is the new velocity of the man?​

Answers

Final answer:

Using the kinematic equation v = u + at, the man's new velocity is found to be 9.5 m/s after accelerating at 3 m/s² for 2.5 seconds.

Explanation:

To calculate the new velocity of the man after accelerating, we apply the basic kinematics equation v = u + at, where:

v is the final velocity (which we are trying to find).u is the initial velocity.a is the acceleration.t is the time over which the acceleration occurs.

Given that the man's initial velocity (u) is 2 m/s, acceleration (a) is 3 m/s², and the time (t) is 2.5 seconds, we substitute these values into the equation:

v = 2 m/s + (3 m/s²)(2.5 s)

This yields:

v = 2 m/s + 7.5 m/s

The new velocity of the man is:

v = 9.5 m/s

if a particle moving in straight line such that its position varies with time as x=5(t-2) + 6(t-2)^2 ,then intial acceleration is​

Answers

Answer:

12

Explanation:

x = 5 (t − 2) + 6 (t − 2)²

x = 5t − 10 + 6 (t² − 4t + 4)

x = 5t − 10 + 6t² − 24t + 24

x = 6t² − 19t + 14

Velocity is the derivative of position with respect to time:

v = dx/dt

v = 12t − 19

Acceleration is the derivative of velocity with respect to time:

a = dv/dt

a = 12

The particle's acceleration is constant at 12 (use appropriate units).

Which of the following represents a decimal system of measurement?


1 quart = 16 fluid ounces


1 kilometer = 1,000 meters


1 mile = 5,280 feet


1 pound = 16 ounces

Answers

Answer: 1 kilometer = 1,000 meters

Explanation:

The decimal metric system is the predecessor of the International System of Units (SI) and consists of a system in which the multiples and submultiples of the unit of measure are related to each other by multiples or submultiples of ten (10).

It should be noted that this system was created to be neutral and that it could be easily used, understood and adopted by all countries. However, so far only the United States, Myanmar (Burma) and Liberia have retained their traditional units of measurement instead of the Decimal Metric System, which was then replaced by the current SI.

In this sense, two main basic units of this system are the meter (to measure length) and the gram (to measure mass). In the specific case of the meter there are submultiples of the same nature that follow a decimal scale, for example:

[tex]1km = 10^{3} m = 1000m[/tex]

Therefore, among the given options, the one that fulfills the explained conditions is 1 kilometer = 1,000 meters

The other options do not follow a decimal system.

Final answer:

The decimal system of measurement is represented by the option '1 kilometer = 1,000 meters' because it follows the base ten structure of the metric system, where conversions are based on powers of ten.

Explanation:

The decimal system of measurement is exemplified by the base ten structure, which is integral to the SI or metric system. Of the options provided, 1 kilometer = 1,000 meters represents a decimal system of measurement, as it’s based on a multiple of ten, specifically 103 or one thousand. This system is characterized by the ease of conversion among different units of measurement using powers of ten. In comparison, other measurements listed, such as quarts to fluid ounces, miles to feet, and pounds to ounces, are based on the English system, which uses different conversion factors that are not consistently multiples of ten.

Which fractures tend to occur first when a pane of glass is struck?
A. Radial fractures
B.
Concentric fractures
c. Spider web fractures
D. Impact fractures

Answers

Radial fractures tend to occur first when a pane of glass is struck.

Answer: Option A

Explanation:

There is a slight difference between radial and concentric fractures and as radial fractures are formed which extends outwards in a radial manner  from the point where the glass is struck.

Whereas concentric fractures are circular in pattern and they terminate long before radial crack. Also when a bullet is fired from a gun, a similar reaction is observed as it gets struck on the surface and fractures are formed in the same pattern.

The Anwer is: A Radical Fractures

If a wave has a period of 0.077 sec, it has a frequency of
01/13 Hz.
3.6 Hz.
169 Hz.
13 Hz.

Answers

Answer: 13 Hz

Explanation:

The frequency [tex]f[/tex]  of a wave is expressed as:  

[tex]f=\frac{1}{T}[/tex]  

Where [tex]T[/tex] is the period of the wave

If we are told the period is 0.077 s, then its frequency is:

[tex]f=\frac{1}{0.077 s}[/tex]  

[tex]f=12.98 Hz \approx 13 Hz[/tex]  

In a wet cell battery what is the electrolyte?
copper

liquid acid

zinc

Answers

Answer:

the liquid acid

Explanation:

This because electrolytes are supposed to be in a liquid form.

Answer:

Liquid Acid

Explanation:

The wet cell battery implies that it has an liquid inside.

The Copper and the Zinc are also the  compounts that will react in the battery as the semi-reactions implies:

Cu2+(aq) + 2e- --> Cu0

Zn2+(aq) + 2e- --> Zn0

The electrolyte is a substance present in the battery that will help the electricity to flow to the ion of interest and will not participate in the reaction, the acid should work as the electrolyte in this case.

A particle starts at the origin and moves away from it in a straight line. After 1.6 seconds, it is 12.8 meters from the origin. It then reverses direction due to a force field with a like charge. After 3.8 seconds total, the particle is at −9.23 m. What is the average velocity of the particle? 3.8 m/s −5.8 m/s −2.4 m/s 13.8 m/s

Answers

Answer:

Average velocity of the particle is[tex]-2.4 m/s[/tex]

Explanation:

Average velocity is defined as the total velocity divided by the total time. It is given  by the equation[tex]v_av= \frac{displacement}{(total time taken)}[/tex]

In the given problem the particle starts from origin, travels [tex]12.8 m[/tex] and then reverses direction and travels till [tex]-9.23 m[/tex] within a total time of [tex]3.8 seconds.[/tex]

Displacement is defines as the shortest distance between initial and final point.  

Here displacement = [tex]- 9.23 m[/tex]

total time=[tex]3.8 s[/tex]

[tex]v_av=-9.23/3.8=-2.4 m/s[/tex]

Two airplanes leave an airport at the same time. The velocity of the first airplane is 740 m/h at a heading of 25.3◦. The velocity of the second is 570 m/h at a heading of 82◦.
How far apart are they after 1.5 h? Answer in units of m.

Answers

Final answer:

The distance between the two airplanes after 1.5 hours is 255 m.

Explanation:

To find the distance between the two airplanes after 1.5 hours, we first need to determine the displacement of each airplane. Displacement is a vector quantity that represents the change in position. We can calculate the displacement of the first airplane using the equation:

Displacement = Velocity × Time

Substituting in the given values:

Displacement1 = (740 m/h) × (1.5 h) = 1110 m

Similarly, we can calculate the displacement of the second airplane:

Displacement2 = (570 m/h) × (1.5 h) = 855 m

Finally, we can find the distance between the two airplanes by subtracting the displacements:

Distance = Displacement1 - Displacement2 = 1110 m - 855 m = 255 m

A Porsche challenges a Honda to a 500 m race

Answers

A Porsche will always win no matter what

A central purple circle labeled N a has 3 concentric rings around it. The inner ring has 2 small green spheres. The middle ring has 8 small green spheres. The outer ring has 1 small green sphere. Does this atom satisfy the octet rule? Why or why not?

Answers

Answer:

This atom doesn’t satisfy octet rule

Explanation:

To satisfy octet rule the outermost shell should have 8 electrons. This is called octet electronic configuration which makes the atom stable. When participating in chemical reactions atoms tend to lose or gain electrons or share electrons like in a covalent bond all to achieve the octet configuration.

In this atom there are three shells and 11 electrons in total. Maximum number of electrons that can be present in the first shell is two and in this atom the first shell contains that maximum electrons. The second can contain maximum 8 electrons. In this atom the second shell is fully filled with 8 electrons.

For octet rule to be satisfied the outermost shell or the valence shell should contain 8 electrons. But in this atom the outermost shell has 1 electron. This means that the atom doesn’t satisfy octet rule. In order to obtain the octet configuration it should lose 1 electron.

Answer:

Answer

Explanation:

Sample Response: No, it does not, because the octet rule says that an atom needs to have eight electrons in its valence shell to be stable. The exceptions are hydrogen and helium, which need only two electrons. This atom has only one electron.

Current functional magnetic resonance imaging (fMRI) technology allows researchers to:
a. Predict the likelihood of developing Alzheimer's disease.
b. Diagnose most forms of mental illness.
c. Identify selected sentences that a person reads in a scanner.
d. Read a person's private thoughts at a distance.

Answers

Final answer:

fMRI technology allows researchers to analyze brain activity by tracking blood flow changes related to neural activity. It can identify selected sentences that a person reads in a scanner, but it cannot predict Alzheimer's, diagnose most mental illnesses, or read private thoughts at a distance.

Explanation:

Current functional magnetic resonance imaging (fMRI) technology enables researchers to observe and analyze changes in the brain's activity over time by tracking blood flow and oxygen levels. fMRI is utilized for a variety of medical and psychological assessments. It is highly effective at mapping brain function and determining the functioning of various regions involved in thought and motor control. Specifically, fMRI can measure changes in blood flow associated with neural activity and can thereby generate a detailed map showing the most active parts of the brain during a given task.

Answering the student's multiple-choice question, among the provided options, fMRI technology can c. Identify selected sentences that a person reads in a scanner. The ability to predict the development of Alzheimer's, diagnose most forms of mental illness, or read a person's private thoughts at a distance is not explicitly achievable with the current fMRI technology.

a physics student drops a rock from a 55m cliff. How long does it take to hit the ground?

Answers

Answer: 9.9 seconds

Explanation:

that's just how long it takes

To hit the ground it takes approximately 3.19 seconds for the rock to hit the ground when dropped from a 55-meter cliff.

To calculate the time it takes for the rock to hit the ground when dropped from a certain height, we can use the kinematic equation for free fall:

ℎ = 1/2 gt2

Where:

h is the height of the cliff (55 m in this case).

g is the acceleration due to gravity ( 9.8 m/s2 approximately on the surface of the Earth).

t is the time we're trying to find.

Rearranging the equation to solve for t:

t =[tex]\sqrt{ 2h / g}[/tex]

​Plugging in the values:

t =[tex]\sqrt{ 2(55)m / 9.8m/s²}[/tex]

Calculating this:

t≈3.19s

So, it takes approximately 3.19 seconds for the rock to hit the ground when dropped from a 55-meter cliff.

To know more about free fall

https://brainly.com/question/12167131

#SPJ3

Which of the following is derived unit?

A: g (grams, mass)

B: m (meters,length)

C: s (seconds, time)

D: m2 (square meters, area)

Answers

Answer:

D: m² (square meters, area)

Explanation:

Derived units are a combination of SI base units.  m² is the only option that's a combination of base units (meters times meters).

pls help me solve this physics question​

Answers

Answer:

C. 1.4 m/s

Explanation:

Energy is conserved:

Initial energy = final energy

At P, the pendulum has only gravitational potential energy.

At Q, the pendulum has only kinetic energy.

PE = KE

mgh = ½mv²

v = √(2gh)

Given h = 0.1 m:

v = √(2 × 9.8 m/s² × 0.1 m)

v = 1.4 m/s

Answer:

1.4

Explanation:

How long did it take beagle to sail from Tahiti back to Falmouth, England?

Answers

Answer:

On 2 October 1836, the Beagle entered the English port of Falmouth after a voyage which had lasted for four years, nine months and five days.

The Beagle voyage from Tahiti to Falmouth, England took five years.

The Beagle took five years to sail from Tahiti back to Falmouth, England as part of Charles Darwin's famous voyage on the HMS Beagle from 1831 to 1836.

What planet with the largest rings

Answers

Answer: saturn

Explanation:

Saturn, it is known to be the largest with rings.

A train moving with a velocity of 87.1 km/hour North, increases its speed with a uniform acceleration of 0.250 m/s2 North until it reaches a velocity of 160.0 km/hour North. What distance did the train travel while it was increasing its velocity, in units of meters?

Answers

Answer:

2780 meters

Explanation:

First, convert km/hr to m/s.

87.1 km/hr × (1000 m / km) × (1 hr / 3600 s) = 24.2 m/s

160.0 km/hr × (1000 m / km) × (1 hr / 3600 s) = 44.4 m/s

Given:

v₀ = 24.2 m/s

v = 44.4 m/s

a = 0.250 m/s²

Find: x

v² = v₀² + 2a (x − x₀)

(44.4 m/s)² = (24.2 m/s)² + 2(0.250 m/s²) (x − 0 m)

x = 2780 m

A telephone wire has a current 20A flowing through it . How long does it take for a charge of 15 C to pass through the wire?

Answers

Charge = Current/time
Q = It
t = Q/I = 15/20 = 0.75 s

It will take 0.75 s for a charge of 15 C to flow through the wire.

The quantity of electricity flowing through a wire is related to current and time according to the following equation:

Q = It

Where

Q is the quantity of electricity

I is the current

t is the time

With the above formula, we can calculate the time taken for the 15 C to flow through the wire. This can be obtained as follow:

Quantity of electricity (Q) = 15 C

Current (I) = 20 A

Time (t) =?

Q = It

15 = 20 × t

Divide both side by 20

[tex]t = \frac{15}{20}\\\\[/tex]

t = 0.75 s

Therefore, it will take 0.75 s for a charge of 15 C to flow through the wire.  

Learn more: https://brainly.com/question/21690385

5. What happens to the arrangement of water molecules as ice melts?
A Molecules gain enough energy to escape as vapor.
B Molecules release enough energy to escape as vapor.
C Molecules gain enough energy to move from their fixed positions.
D Molecules release enough energy to move from their fixed positions.

Answers

Answer: I am pretty sure the answer is B

Explanation: If not sorry bro.

A cat is moving at 18 m/s when it accelerates at 4 m/s2 for 2 second. what is his new velocity?

Answers

Answer: [tex]26\ \frac{m}{s}[/tex]

Explanation:

His new velocity is the "Final velocity". In order to calculate it, you need to use the following formula:

[tex]V_f=V_0+at[/tex]

Where [tex]V_f[/tex] is the Final velocity, [tex]V_0[/tex] is the Initial velocity, [tex]a[/tex] is the acceleration and [tex]t[/tex] is the time.

Based on the information provided in the exercise, you can identify that:

[tex]V_0=18\ \frac{m}{s}\\\\a=4\ \frac{m}{s^2}\\\\t=2\ s[/tex]

Therefore, you can substitute values into the formula:

[tex]V_f=18\ \frac{m}{s}+(4\ \frac{m}{s^2})(2\ s)\\\\V_f=26\ \frac{m}{s}[/tex]

Then, his new velocity is [tex]26\ \frac{m}{s}[/tex]

Velocity and acceleration are both vectors; they have a direction. What is thedirection of the velocity and acceleration vectors of a tennis ball that is rising upward towards its highest point above the ground? a.The velocity vector is directed upward. b.The velocity vector is directed downward. c.The acceleration is directed downward. d.Both A & C

Answers

Final answer:

The velocity vector of a rising tennis ball is directed upward, while the acceleration vector is directed downward due to gravity slowing the ball down as it reaches its peak.

Explanation:

The velocity and acceleration vectors of a tennis ball that is rising upward towards its highest point in its motion can be defined by first understanding that acceleration is a vector in the same direction as the change in velocity. As the tennis ball is moving upwards, its velocity vector is directed upward. However, understanding that acceleration is the rate of change of velocity, the acceleration vector is directed downward because the ball is slowing down as it reaches its highest point, hence the gravity is acting downwards causing its speed to decrease. Therefore, the correct answer is d. Both A & C.

Learn more about Physics of Velocity and Acceleration here:

https://brainly.com/question/40191699

#SPJ12

Final answer:

In the case of a tennis ball rising towards its peak, the velocity vector points upward while the acceleration vector due to gravity, points downward.

Explanation:

When a tennis ball is rising towards its highest point above the ground, the velocity vector is directed upward because the ball is moving in an upward direction. Thus, the answer 'A' is correct. However, the acceleration vector is directed downward, as the downward force of gravity is acting on the ball at all times, causing a constant acceleration downward, even when the ball is moving upward. Thus, the answer 'C' is also correct. Therefore, in this scenario, for both 'A' and 'C', the velocity vector is directed upward and acceleration is directed downward, true.

Learn more about Velocity and Acceleration here:

https://brainly.com/question/14683118

#SPJ12

What is the frequency of an electromagnetic wave with a wavelength of 1.0 x 10 m?

Answers

Answer: 0.03 Hz

Explanation:

The frequency [tex]f[/tex] of a light with a wavelength [tex]\lambda=1(10)^{10} m[/tex] is calculated by the following equation:

[tex]f=\frac{c}{\lambda}[/tex]

Where [tex]c=3(10)^{8}m/s[/tex] is the speed of light

Then:

[tex]f=\frac{3(10)^{8}m/s}{1(10)^{10} m}[/tex]

[tex]f=0.03 s^{-1}=0.03 Hz[/tex] This is the frequency

which calculation is an example of velocity ? 10m/s 10/Ms to the right 10 m to the right 10​

Answers

Answer:

10m/s to the right

Answer: 10 m/s to the right

Explanation: Velocity is both speed AND Direction.

Although the temperature gradient changes from region to region in the homosphere, there is one gradient that stays the same. it continues to decrease as you increase in altitude, no matter where you are in the homosphere. what gradient?

please answer quick

Answers

Answer: The amount of air gradient.

Explanation:

Answer:

Pretty sure the answer is air gradient

Explanation:

What happens to the force between the spheres when you increase the mass of one of the spheres?
What happens to the force between the spheres when you increase the mass of both spheres?

Answers

The force between the spheres increases when the mass increases in one of the spheres.

Explanation:

            Newton law of universal gravity extends gravity beyond the earth's surface. This gravity depends directly on the mass of both objects and is inversely proportional to square of distance between their centers.  

                   [tex]\bold{F=\frac{G \times\left(m_{1} \times m_{2}\right)}{\left(r^{2}\right)}}[/tex]

          Since gravity is directly proportional to “mass of both interacting objects”, stronger objects with greater gravitational force attract. If the mass of one object increases, gravity between them also increases. For example, if an object's mass of one double, force between them also doubles.  

Answer: The force between two spheres increase when mass of one or both spheres are increased.

Explanation:

According to universal law of gravitation “every body in the universe attracts every other body with a force that is directly proportional to the product of their masses and inversely proportional to the square of the distance between them”.

It is given by the expression

[tex]F=(GM_1 M_2)/r^2[/tex]  

Where G is the gravitational constant, [tex]M_1 ,M_2[/tex] are the masses of the bodies and  r is the distance between them.

In the question two conditions are given.

Mass of one object is increasedMasses of both objects are increased.

Since force between two objects is directly proportional to the masses, the force increases in both cases.

An elevated weighing 15,00 Newton’s is raised one story in 50 seconds. If the distance stories is 3.0 meters how much power is required of the motor

Answers

Power required for motor to raise elevated weighing 1500 newton for a distance of 3 meter in 50 second is 90 watt.

Solution:

By using power force formula,  

Power is obtained by multiplying force and velocity

[tex]\text { Power }=\text { Force } \times \text { Velocity }[/tex]

Velocity can be calculated by dividing distance by time.

[tex]\begin{array}{l}{\text {Velocity}=\frac{\text {Distance}}{\text {Time}}} \\ {\text {Power}=\text {Force} \times \frac{\text {Distance}}{\text {Time}}}\end{array}[/tex]

So for a force of 1500 newton with distance 3 meter for a time period  50 second, power is given as,

[tex]\text { Power }=1500 \times \frac{3}{50}=150 \times \frac{3}{5}=30 \times 3 = 90[/tex]

Power = 90 watt

Other Questions
Seawater has a specific density of 1.025. What is its specific volume in m^3/kg (to 3 significant figures of accuracy, tolerance +/- 0.000005 m^3/kg)? While you are returning from lunch, a frantic woman flags you down and states that she just found a young child on the roadside who appears to have been hit by a car. She is not sure if the child is breathing. You should immediately:A) inform the woman that she will need to calm down.B) advise dispatch that you have been flagged down for a possible emergency.C) grab equipment and get to the child's location.D) call for paramedic assistance and await their arrival. Kyle, a 5-year-old boy, has been growing by leaps and bounds; his height is 100% above normal for his age. He has been complaining of headaches and vision problems. A CT scan reveals a large pituitary tumor. A) Which hormone is being secreted in excess? B) Which condition will Kyle exhibit if corrective measures are not taken? C) What is the probable cause of the headaches and visual problems? What is the most important use of repetition in poetry? What is the root word for spherical? A. sphere B. here or C. her? 4y+2x=180 solve for x and y Distinguish between sister chromatids and non-sister chromatids. The speed of light in a vacuum is 2.998 x 108 m/s. What is its speed in kilometers per hour (km/h)? K speed = What is its speed in miles per minute (mi/min)? speed = mi/min How many core electrons does magnesium (Mg) have? Human-centered technology often recommends _______aoto computer designers and manufacturers, telling them how to make systems and the devices that support them more user-friendly. What impact would low blood pressure have on kidneys? What symptoms might you expect with a decrease in kidney functions? Molteni Motors Inc. recently reported $3.25 million of net income. Its EBIT was $6.25 million, and its tax rate was 35%. What was its interest expense? (Hint: Write out the headings for an income statement and then fill in the known values. Then divide $3.25 million net income by 1 T = 0.65 to find the pre-tax income. The difference between EBIT and taxable income must be the interest expense.) Enter your answer in dollars. For example, an answer of $1.2 million should be entered as 1,200,000. Round your answer to the nearest dollar. What are the three main types of money?A) credit, commodity, representativeB) fiat, commodity, creditC) representative, credit, fiatD) commodity, representative, fiat How much exercise should teens do daily Fiona shares an office with her exminushusband. Her share of the rent and utilities is $625 per month. She is considering moving to a home office which she will not have to share with anyone. The home office will not cost her anything as far as extra rent or utilities. Recently, you ran into Fiona at the gym and she tells you that she has moved into her home office. Fiona is as rational as any other person. As an economics major, you rightly conclude that ______ Can someone help me with this problem? It has to be in PEMDAS order. 16+(4*2/2)-4 I think it's 18 but I'm not sure The bases of one of the strands of DNA in a region where DNA replication begins are shown here. What is the sequence of the primer that is synthesized complementary to the bases in bold? (Indicate the 5' and 3' ends of the sequence.) 5' AGGCCTCGAATTCGTATAGCTTTCAGAAA 3' what is 3.149 rounded to the nearest hundredth What did the Gestapo and SS do? What is different about the number of course options kids get in virtual schools compared to typical schools?