Answer:
The correct answer is a and e.
Explanation:
Translation is the process by which mRNA is translated into proteins. It occurs in both prokaryotes and eukaryotes. In prokaryotes, transcription and translation occur simultaneously while in eukaryotes translation is a separate process occurs in the cytoplasm after transcription.
The first amino acid incorporated in the polypeptide is methionine in eukaryotes and formyl methionine in prokaryotes. After protein synthesis in both eukaryotes in prokaryotes, post-translational takes place like glycosylation, acetylation, alkylation, etc.
Post translation is important for proteins to provide them heterogeneity and functional activity. Thus, the correct answer is a. the first methionine in eukaryotic translation contains a formyl group and e. many eukaryotic proteins are chemically modified after translation, which is a much rarer phenomenon in prokaryotes.
The thylakoid membrane becomes damaged, causing the inside of the thylakoid to mix with the stroma Which of the following processes is likely to be most affected by this damage?
A) The reduction ot NADP+ to NADP
B) Sunlight absorption by the chloroplasts
C) The movement of electrons from photosystem I (PSll) to photosystem I (PSI)
D) ATP synthesis
Answer:
The correct answer will be option-D.
Explanation:
Thylakoid membrane is the membrane of the thylakoid present in the chloroplast which encloses thylakoid lumen.
Thylakoid is the site of the light-dependent reaction as they contain chlorophyll in their photosystem. This membrane carries out main reactions of photosynthesis like water photolysis, ATP synthesis and electron transport chain.
If leaking is observed in this membrane then it will interfere with ATP synthesis as membrane maintains the proton gradient in and out of the thylakoid. The leaking will cause mixing the content of the stroma and lumen which will disturb the proton gradient. This proton gradient will prevent ATP synthesis.
Thus, option-D is the correct answer.
Luteinizing hormone stimulates testosterone secretion by the leydig cells of the testes.
a. True
b. False
Answer:
True
Explanation:
Testosterone is the primary male sex hormone. It is produced by the Leydig cells of the testis. The testosterone produced by both males and females. The amount is more male than females. In females, testosterone is in the form of androgen hormone.
The anterior pituitary secretes 2 hormones i.e. LH and FSH. The luteinizing hormone from the pituitary gland enters into the interstitial space of the testis. In the interstitial space, Leydig cells are present, which are the target organ for LH. The LH stimulates the Leydig cells to produce testosterone. Hence Leydig cells are also called interstitial cells.
Testosterone secretes from the Leydig cells of the testis and mixes with the bloodstream. It produces in the presence of LH. Then it reaches to different cells of the body by the bloodstream. Testosterone maintains bone and muscle growth, induces the secondary sexual characters.
When testosterone level is high in the blood, it sends a signal to the brain to decrease the secretion of testosterone. This is the negative feedback mechanism of testosterone.
There are many different types of touch receptors (hot, cold, etc.) in the skin, and these different types of receptors are not distributed throughout the various parts of the body equally.
a. True
b. False
Answer:
It is true.
Explanation:
Throughout the skin, there are sensitivity receptors, no matter what sector we look for.
The difference is that there are areas of higher density.
Places like the hand and fingers are the ones that help us explore and know things. The number of receptors there is much greater than in areas such as the back or neck.
In patients infected with nonresistant strains of the tuberculosis bacterium, antibiotics can relieve symptoms in a few weeks. However, it takes much longer to halt the infection, and patients may discontinue treatment while bacteria are still present. How might this result in the evolution of drug-resistant pathogens?
When patients infected with nonresistant strains of tuberculosis discontinue treatment before completing the full course, it can lead to the evolution of drug-resistant bacteria. This is because some bacteria may survive and develop resistance to the antibiotics.
Explanation:Patients infected with nonresistant strains of the tuberculosis bacterium may discontinue treatment once their symptoms are relieved, but before the planned course of treatment is complete. This can result in the evolution of drug-resistant pathogens. The reason for this is that when patients stop taking antibiotics prematurely, there is a higher chance that some bacteria may survive and develop resistance to the drugs. These drug-resistant bacteria can then continue to spread and cause infections that are more difficult to treat.
The discontinuation of antibiotic treatment in patients infected with non-resistant strains of the tuberculosis bacterium can indeed result in the evolution of drug-resistant pathogens through a process known as natural selection.
1. Initial Effectiveness of Antibiotics: When antibiotics are administered to a patient with a non-resistant strain of tuberculosis, the drugs begin to kill the bacteria. This is because the antibiotics are specifically designed to target and disrupt essential processes in the bacteria, leading to their death.
2. Persistence of Bacteria: Despite the effectiveness of the antibiotics, a small number of bacteria may survive. This could be due to various reasons, such as the bacteria being in a dormant state, residing in parts of the body that are less accessible to the antibiotics, or having genetic mutations that confer some level of resistance.
3. Incomplete Treatment Course: If a patient stops taking the antibiotics prematurely, the surviving bacteria are given an opportunity to multiply and grow in number. Since the antibiotics are no longer present at therapeutic levels, there is no pressure to suppress the bacterial population.
4. Selection for Resistance: Among the surviving bacteria, some may have acquired mutations that make them less susceptible to the antibiotics. These mutations might have arisen randomly or as a response to the antibiotic pressure. When the patient discontinues treatment, these less susceptible bacteria have a survival advantage and are more likely to reproduce and pass on their resistance genes.
5. Spread of Resistance: As the resistant bacteria replicate, they can accumulate additional mutations that further enhance their resistance. These resistant strains can then be transmitted to other individuals, spreading the drug-resistant form of tuberculosis.
6. Evolution of Drug-Resistant Pathogens: Over time, and with repeated cycles of incomplete treatment and transmission, the resistant strains become more prevalent in the population. This leads to the evolution of tuberculosis strains that are resistant to one or more of the antibiotics that were previously effective.
To prevent the evolution and spread of drug-resistant tuberculosis, it is crucial for patients to complete the full course of antibiotics as prescribed by healthcare professionals. This ensures that all bacteria are eliminated, thus preventing the survival and proliferation of resistant strains. Public health measures, including infection control practices, regular monitoring, and the development of new antibiotics and treatment regimens, are also essential in combating the rise of drug-resistant pathogens.
Distinguish between sister chromatids and non-sister chromatids.
Answer:
Sister chromatids:
The chromatids of replicated chromosome that are joined through a centromere is known as sister chromatids. These chromatids are identical to each other. They contains the same allele at similar loci. They are formed at the synthesis phase of cell cycle.
Non-sister chromatids:
The chromatids of the different homologous chromosomes are known as non-sister chromatids. These chromatids are non- identical to each other. They contains the different allele at similar loci. They are formed at the prophase I of phase of meiosis.
Explain how DNA stores complex information.
Answer: Via four types of smaller molecules (adenine, cytosine, guanine, and thymine) called nucleotides.
Explanation:
DNA is the main molecule of life on Earth, it is present in the cells of all living beings, being responsible for storing the information necessary for its formation and reproduction. DNA is a double strand of nucleotides that twist to form a double helix with a rotational sense on the right.
Basically, the binding between two single strands of DNA, forming the double helix, occurs following a single rule, adenine always binds to thymine and cytosine always binds to guanine and vice versa. The DNA molecule is made up of smaller molecules called nucleotides. There are four types of nucleotides that make up DNA, they are adenine, cytosine, guanine, and thymine, represented by their first letter {A, C, G, T}, forming the DNA alphabet.
Which of the following processes require the presence of 02 in order to occur?
a. Glycolysis
b. Glycogenesis
c. Fermentation
d. Citric acid cycle
e. More than one is correct
Answer:
d. Citric acid cycle
Explanation:
The only process in the list that requires the presence of O2 in order to occur is the Citric acid cycle or Krebs cycle. This cycle is part of the aerobic cellular respiration and it occurs only when O2 is available. If there is no oxygen, an alternative process that could happen is fermentation, but this is only carried by some microorganisms and some cells such as muscle cells.
In fact, oxygen is not needed by citric acid cycle but it is by the next step: the electron transport chain. In this chain, oxygen is the final acceptor of electrons, and without oxygen, the Krebs cycle doesn't occur because the final electron transport chain can't be done.
Explain the differences between the central nervous system and the peripheral nervous system.
Answer:
Central nervous system:
Central nervous system consists of the brain and the spinal cord. Short nerve impulse are present in the central nervous system. The information are obtained from the sensory organs. The damage of nerve fibers are irreparable in the central nervous system.
Peripheral nervous system:
Peripheral nervous system consists of the motor neurons, sensory receptor and sensory neurons. Long nerve impulse are present in the peripheral nervous system. The information are pass out to the effector organs. The damage of nerve fibers are reparable in the peripheral nervous system.
The bases of one of the strands of DNA in a region where DNA replication begins are shown here. What is the sequence of the primer that is synthesized complementary to the bases in bold? (Indicate the 5' and 3' ends of the sequence.) 5' AGGCCTCGAATTCGTATAGCTTTCAGAAA 3'
Answer:
Complementary primer- 3' TCCGGAGCTTAAGCATATCGAAAGTCTTT 5'
Explanation:
The synthesized primer will have base pair complementary to the given strand and also the leading and lagging ends will be opposite to the given strand.
As per the base pair rule for DNA
Guanine binds to cytosine & vice versa
Adenine always binds to thymine & vice versa
Given Sequence - 5' AGGCCTCGAATTCGTATAGCTTTCAGAAA 3'
Complementary primer- 3' TCCGGAGCTTAAGCATATCGAAAGTCTTT 5'
Plant molecular biologists have recently discovered genes that are responsible for controlling cell division in tomatoes. Why would such a discovery be important to producers of other kinds of fruits and vegetables ?
They can use those recently discovered genes and insert them in another species (fruits and vegetables) using genetic ingeniery technics so they can speed up the cell division on them, and accordingly increase the production.
If a mutation occur in a somatic cell, the resulting mutant phenotype will occur:
a. only in the individual cell
b. only in the progeny from that individual cell
c. only in the offspring of that organism
d. in both the progeny of that individual cell and the individual cell itself
e. neither the progeny from that individual cell or the offspring of the organism
Answer:
d. in both the progeny of that individual cell and the individual cell itself
Explanation:
Somatic mutations occur in the somatic cells of the individuals. Since the genetic material of the somatic cells is not passed to the next generation of an organism, the somatic mutations do not appear in the progeny of an individual.
Somatic cells divide by mitosis which in turn maintains the identity of DNA between the parent and the daughter cells. Therefore, the new cells derived from a mutated somatic cell would also carry the same mutation.
A mutation in a somatic cell results in a mutant phenotype in the individual cell itself and the progeny or descendants of that cell, but it will not be passed to the organism's offspring.
Explanation:If a mutation occurs in a somatic cell (i.e., a non-reproductive cell), the resulting mutant phenotype will occur in both the mutant cell itself and the progeny that arises from the cell division of that individual cell. So, the correct answer is. in both the progeny of that individual cell and the individual cell itself.' This happens because the mutation becomes part of the cellular DNA and will therefore be replicated each time that cell divides, spreading to all descendent cells. However, because somatic cells do not participate in sexual reproduction, these mutations will not be passed to the offspring of the organism.
Learn more about Mutation in Somatic Cells here:https://brainly.com/question/11333262
#SPJ3
You have discovered a new species of microbe. This microbe is unicellular, has a cell wall, and possess ribosomes. This microbe is most likely which of the following?
a. a bacterium
b. a protist
c. a fungus
d. it could be any of these three types of microbes
Answer:
d. it could be any of these three types of microbes
Explanation:
Cell wall made of peptidoglycan is a characteristic feature of bacteria that are otherwise unicellular prokaryotes.
Fungi have a chitinous cell wall and may be unicellular or multicellular. The example of unicellular fungi is yeast.
Protists are unicellular eukaryotes and have a cell wall made of cellulose.
Ribosomes are the site of protein synthesis and are present in all the organisms. Bacteria have 70S type of ribosomes while the eukaryotic fungi and protists have 80S ribosomes.
The old-growth forests of the Pacific Northwest are considered to be rainforests, which means it rains a lot. How do the forests help people deal with the rain?
A. They stick up into the clouds and absorb some rain directly.
B. They direct the water into the salmon streams.
C. They provide shelter to people out hiking.
D. They make it seem less gloomy.
E. They retain water to prevent flooding and erosion.
Answer:
The correct answer is E.They retain water to prevent flooding and erosion.
Explanation:
Rain forests are used to be very dense forests where lots of raining takes place. The forest floor can soak up lots of rain and during flood dense forest with woodland trees do not allow water to run fast through them thereby reducing flood's effect significantly.
The roots of the trees in the forest binds to the soil on the floor and prevent soil erosion during flooding. Study shows that water retention is more in summer than in winters. Forest can store lots of water and transfer it to the streams which is helpful in providing clean water to the people in dry season.
Therefore, the correct answer is E. They retain water to prevent flooding and erosion.
Describe two ways in which yeasts are useful to humans.
Yeasts are essential in the production of food and beverages, such as bread and alcoholic drinks, and are also used in biotechnology and medicine for producing compounds like insulin and as a model organism in research.
Food and Beverage Production: Yeasts, particularly Saccharomyces cerevisiae, are crucial in baking and the fermentation of alcoholic beverages. In baking, yeast ferments sugars to produce carbon dioxide, causing bread to rise. In alcoholic beverage production, yeast converts sugars into ethanol and carbon dioxide.Biotechnology and Medicine: Genetically engineered yeast is used in the production of various compounds, including insulin. This application is essential for diabetic patients who need insulin therapy. Furthermore, yeast is a model organism in research, helping scientists understand basic biological processes.Choose the sex-linked traits from the choices below. Choose all that apply.
a. Height
b. Hemophilia
c. Duchenes Muscular Dystrophy
d. Cystic Fibrosis
e. Sickle Cell Disease
a. Height
It's true that if you have tall parents, you might be tall too.
But no proof is a sex-linked trait.
b. Hemophilia
This is a disease related to blood coagulation.
It's recessive and linked to X chromosomes.
c. Duchenne Muscular Dystrophy
This is also a recessive sex-linked disease.
Girls can carry but only affect boys.
d. Cystic Fibrosis
This is also a hereditary disease but not linked to sex chromosomes.
e. Sickle Cell Disease
It's a malformation of blood cells and it can be inherited but not linked to sex chromosomes.
A slice of pizza has 500 kcal. If we could burn the pizza and use all the heat to warm a 50-L container of cold water, what would be the approximate increase in the temperature of the water? (Note: A liter of cold water weighs about 1 kg.)
a.50°C c.100°C
b. 5°C d.10°C
Answer:
Option D, There will be an increase of [tex]10[/tex] degree Celsius in the temperature of the water
Explanation:
As we know -
[tex]Q = m*C* dT\\[/tex]
Where Q is the total amount of heat produced
m signifies mass of any substance
C signifies specific heat
and dT represents change in temperature
Specific heat of water is 1 calories per gram per degree Celsius
On substituting the given values in above equation, we get -
[tex]500* 1000 = 50000 * 1* dT\\dT = \frac{500000}{50000} \\dT = 10[/tex]
Hence , there will be an increase of approximately[tex]10[/tex] degree Celsius in the temperature of the water
Of the 64 possible nucleotide codon triplets, how many specify polypeptide chain termination?
a. 61
b. 1
c. 2
d. 3
e. 64
Of the 64 possible mRNA codons, three are designated for polypeptide chain termination, also known as stop codons. The correct answer to the multiple choice question is d. 3.
In the universal genetic code, of the 64 possible mRNA codons, which are triplet combinations of the nucleotide bases Adenine (A), Uracil (U), Guanine (G), and Cytosine (C), a total of three specify polypeptide chain termination. These are often referred to as stop codons or termination codons. They include the codons UAA, UAG, and UGA, with UGA sometimes serving a dual function to encode selenocysteine—a rare 21st amino acid—given the presence of a SECIS element. The remaining 61 codons correspond to the addition of amino acids to the growing polypeptide chain during translation, with the codon AUG also doubling as the start codon for initiation of translation.
To answer the multiple choice question: Of the 64 possible nucleotide codon triplets, three specify polypeptide chain termination. So, the correct answer is d. 3.
Explain Mendel's law of independent assortment and how the 9:3:3:1 phenotypic ratio among the F2 of a dihybrid cross provides evidence for this law.
Answer:
Explanation:
Mendel's law of independent assortment state that two different genes assort independently in gamete formation.
To reach this conclusion, one has to do a dihybrid cross. This means that two genes responsible for different traits need to be analyzed at the same time.
1) Starting with a parental generation of a cross between two pure lines (homozygous for both genes) with different traits, a plant with yellow and round seeds (YYRR) and another with green and wrinkled seeds (yyrr). The F1 will be phenotypically homogeneous (yellow and round), and genotypically heterozygous (YyRr).
2) If the individuals from the F1 are crossed with one another, we have to do a Punnett Square to determine the phenotypic ratio of the F2.
If the genes assort independently, the F1 individuals will produce their different gametes with the same probability. Each possible gamete will appear in a 1/4 proportion: YR, Yr, yR, yr.The 9:3:3:1 ratio is a result of analyzing the possible phenotypes that result from the dihybrid cross.See the attached image for an illustration of the crosses in each generation and the Punnett Square.
Final answer:
Mendel's law of independent assortment demonstrates that alleles for different traits segregate independently during gamete formation, which was evidenced by the 9:3:3:1 phenotypic ratio seen in the F2 generation of a dihybrid cross. This law contrasts with gene linkage, which would lead to non-independent assortment and different ratios.
Explanation:
Mendel's Law of Independent Assortment
Mendel's law of independent assortment states that the inheritance pattern of one trait will not affect the inheritance pattern of another. This principle emerged from dihybrid cross experiments, indicating that the alleles for different traits segregate independently during the formation of gametes. By crossing two pea plants that were true-breeding for two different traits (e.g., seed color and seed texture), Mendel found that the F2 generation exhibited a phenotypic ratio of 9:3:3:1.
How does this support the law? If we consider two traits—seed color (yellow Y, green y) and seed texture (round R, wrinkled r)—the cross between F1 heterozygotes (YyRr × YyRr) should produce offspring with varying combinations. Using a Punnett Square, we find that the gametes form four possible allele combinations (YR, Yr, yR, yr) in equal proportions, leading to the 9:3:3:1 phenotypic ratio. This ratio emerges because, for example, 9/16 of the progeny will be both dominant for both traits (YR), 3/16 will be dominant for one and recessive for the other (Yr or yR), and 1/16 will be recessive for both (yr), provided the two traits assort independently.
What if genes were linked? If traits were linked, meaning they do not follow independent assortment, the observed phenotypic ratios would deviate significantly from the 9:3:3:1 expectation. Instead, some combinations of traits would occur more frequently than others, reflecting the physical proximity of the genes on the chromosomes and their tendency to be inherited together.
All animals must get oxygen for respiration. Which of the following is NOT involved in this critical function
A. Diffusion
B. Vascularized gills
C. Trachea found in crustaceans and insects
D. Lungs of lungfish
E. Corpus luteum
Answer:
E
Explanation:
Corpus luteum is not involved in respiration, it is a temporary structure (mass of cells) formed in the female body, precisely in the ovary, after the ovulation. If an oocyte is fertilized, It is responsible for the production progesterone during the first stages of pregnancy, if the oocyte is not fertilized the corpus luteum will break down.
Homeotic genes
a. encode transcription factors that control the expression of genes responsible for specific anatomical structures.
b. are found only in Drosophila and other arthropods.
c. are the only genes that contain the homeobox domain.
d. encode proteins that form anatomical structures in the fly.
Answer: a. encode transcription factors that control the expression of genes
Explanation:
Homeotic Genes - They encode transcription factors that determine the location at which specific structures develop. They give organs identity. Homeotic genes act as regulators of development and some mutations found in flies were instrumental in unraveling the macroevolution related mysteries.
Mutations in homeotic genes are often fatal in the early stages of development, however viable mutant flies with strange aberrations have been found, such as the discovery of Antennapedia mutants, in which paws are formed in place of antennae. Homeotic genes regulate the development of specific embryonic segments and are fundamental, among other functions, in determining the anteroposterior axis of metazoans. When we compare flies and humans, homeotic genes resemble both their nucleotide sequence and their relative position on chromosomes.
Which of these groups of mammals is defined by having multicusped lower molars and a narrow pelvis?
a. allotheria
b. prototheria
c. theria
d. metatheria
e. eutheria
Answer:
The correct answer will be option-A.
Explanation:
Allotheria is an extinct species of a mammalian group called marsupials which lived during the Mesozoic era.
The Allotheria can be easily distinguished by the few unique characteristics which were considered of non-placental mammals:
1. Presence of molariform teeth with longitudinal cusps in the lower portion of the mouth
2. Narrow pelvis which indicates that they used to give birth to young marsupials and used to feed them.
Thus, option-A is the correct answer.
What are the three main components of biodiversity?
a. Species diversity, species productivity, and species stability
b. Genetic diversity, species abundance, and species evenness
c. Species richness, species abundance, and species evenness
d. Species diversity, species-area relationship, and species evenness
e. Species diversity, genetic diversity, and habitat diversity
Answer:
C. Species richness, species abundance, and species evenness
Explanation:
Biodiversity is the variety and variability of all living organisms within a given environment. The main components that contribute to biodiversity are :
1 - Species richness: It takes into account the number of different species present in an area. So the more species, the more richer that place is.
2 - Species evenness: It describes the relative abundance of the different species in an area. That is, the more similar the abundance (quantity) of a species, the more uniform it will be.
The three main components of biodiversity are species diversity, genetic diversity, and habitat diversity. These are crucial for ensuring natural sustainability, resistance to diseases, and the adaptation to environmental changes.
Explanation:The three main components of biodiversity are species diversity, genetic diversity, and habitat diversity. Species diversity is the variety of different species within a specific area. Genetic diversity is the total number of genetic characteristics in the genetic makeup of a species, and habitat diversity refers to the range of different habitats present in an area.
Species diversity is important because a high diversity ensures natural sustainability for all life forms. Genetic diversity helps in providing resistance to diseases, and it enables natural populations to adapt to changes in the environment. Habitat diversity allows for a multitude of niches to be occupied by various species, enhancing species and genetic diversity.
Learn more about Biodiversity here:https://brainly.com/question/13073382
#SPJ12
A stack of thylakoids are known as
a. Thylakoid discs
b. Grama
c. thylakoid lumen
d. Stroma
A stack of thylakoids in a chloroplast is called a granum, which is the correct answer to the question.
Explanation:A stack of thylakoids within a chloroplast is known as a granum (plural = grana). Thylakoids are disc-shaped, membrane-bound structures where the light-dependent reactions of photosynthesis take place. Each thylakoid disc contains chlorophyll, which is responsible for the initial interaction between light and plant material. The inner membrane space that surrounds the grana is termed the stroma. Therefore, the correct answer to the question is 'b. Grama'. Thylakoids are disc-shaped, membrane-bound structures where the light-dependent reactions of photosynthesis occur.
The molecule that carries amino acids to the ribosome and binds to a mRNA ensuring a proper amino acid sequence in the resulting polypeptide is a(n):
a. tRNA
b. mRNA
c. rRNA
d. sRNA
Answer: a. tRNA
Explanation: The transference RNA is a nucleic acid that participates of the protein synthesis. tRNA is a small RNA with folding as a trefoil. The tRNA has a site where aminoacid is loaded and a anticodon site that is complementary to the codon in the mRNA, ensuring the proper aminoacid sequence in the resulting polypeptide.
What is homeostasis, and why is it important?
Answer:
Homeostasis is the body trying to maintain a equilibrium for many body elements, such as body temperature, body functions, etc, even with changes in the environment.
For example, the body, in trying to maintain body temperature in a cold area, would burn more calories and "create more heat" to equalize the body temperature.
Another example would be the body sweating so that excess heat would escape on a hot day.
~
Summarize the key factors DNA polymerase requires to replicate DNA.
Answer:
Explanation:
DNA polymerase is an enzyme that helps in the synthesis of new strands of DNA. It is found in both prokaryote and eukaryotes. In prokaryotes, there are 3 types of DNA polymerase and more DNA polymerase found in eukaryotes.
The 3 types of DNA polymerase are DNA polymerase I, DNA polymerase II, DNA polymerase III. The DNA pol I and DNA pol II helps in DNA repair rather than DNA replication. The DNA pol III is the major enzyme that initiates the replication.
DNA polymerase III is a multisubunit enzyme that functions as a dimer of these multiple subunits. The DNA polymerase enzyme has 3 significant enzymatic activities -
All DNA polymerase direct the synthesis of DNA from 3' to 5' end.
It possesses 3' to 5' exonuclease activity. It also helps in proofreading activity by replacing the incorrect nucleotides with the correct base sequence.
Some DNA polymerase has a 5' to 3' exonuclease activity. It is found in the lagging strand.
DNA polymerase is not able to initiate DNA synthesis alone. They need a free 3' end, where the enzyme can add new nucleotides. It means they require 2 primers to initiate the DNA replication in both the direction.
The strands act as complementary to the DNA polymerase. The DNA polymerase adds new strands continuously in 5' to 3' direction in the leading strand. While in lagging strand short fragments of DNA formed. Later they attached by DNA ligase.
DNA polymerase also needs RNA polymerase in some cases to start replication. Such a process is called reverse transcription.
The key factors DNA polymerase requires to replicate DNA are:
1. A template strand of DNA to guide the synthesis of the new strand.
2. Deoxyribonucleoside triphosphates (dNTPs) as the building blocks for the new DNA strand.
3. A primer, typically an RNA primer, to initiate the synthesis of the new strand.
DNA polymerase is an enzyme that synthesizes DNA from deoxyribonucleotides, the monomers of DNA. The process of DNA replication is semiconservative, meaning that each strand of the original DNA molecule serves as a template for the synthesis of a new complementary strand.
Here are the key factors required for DNA polymerase to function in DNA replication:
1. Template Strand: DNA polymerase requires a single-stranded DNA template to direct the synthesis of the new strand. The enzyme reads the template strand in the 3' to 5' direction and adds nucleotides to the 3' end of the growing strand.
2. Deoxyribonucleoside Triphosphates (dNTPs): These are the precursors for DNA synthesis. dNTPs include adenine (A), thymine (T), cytosine (C), and guanine (G) nucleotides. DNA polymerase links these nucleotides together in a sequence that is complementary to the template strand.
3. Primer: DNA polymerase cannot initiate synthesis de novo; it requires a short piece of RNA or DNA called a primer that is hydrogen-bonded to the template strand. DNA synthesis starts at the 3' end of this primer.
4.Temperature Conditions: DNA polymerase has optimal temperatures at which it functions most efficiently. In humans and other eukaryotes, this temperature is around 37°C, while in bacteria like E. coli, it is slightly higher.
In summary, DNA polymerase requires a template strand, dNTPs, a primer, magnesium ions, and appropriate temperature conditions to accurately replicate DNA. These factors ensure the high fidelity of DNA replication, which is crucial for the maintenance of genetic information."
Twogenes,
A and B, are located 10 maps units fromeach
other. A third
gene,
C, is located 15 map units from B and 5 mapunits
from A. A parental
generation
consists of AAbbCC and aaBBccindividuals. The F1
are then test-
crossed to
aabbcc individuals. What percentage ofthe offspring would
you
expect to be
AaBbCc?
Answer:
5%
Explanation:
We have the following loci map:
C/c -------------A/a--------------------------B/b 5 m.u. 10 m.u.The parental cross was between the individuals:
CCbbAA, which can be written as CAb/CAb.ccBBaa, which can be written as caB/caB.Each parental individual can produce only 1 type of gamete, so the F1 will be homogeneous with the genotype: CAb/caB.
The F1 are test crossed to cba/cba individuals.
CAb/caB X cab/cabThe homozygous recessive can only produce cba gametes.
The F1 can produce 8 types of gametes:
The parentals: CAb and caBThe crossovers between the genes C/c and A/a: CaB and cAbThe crossovers between the genes A/a and B/b : CAB and cabThe double crossovers: Cab and cABThe question is asking about the percentage of offspring that will have the genotype CAB/cab
The cab chromosome comes from the homozygous recessive individual with a probability of 1.
The CAB chromosome comes from the F1 individual, and was a result of crossing over between the genes A/a and B/b.
The formula to relate genetic distance with recombination frequency is:
Genetic Distance (m.u.)= Recombination Frequency X 100.
In our problem, Genetic distance between A/a and B/b loci is 10 map units.
Therefore:
10 m.u. = (Recombination Frequency between A/a and B/b) x 100.
0.1 = Recombination Frequency between A/a and B/b
When crossing over happens between the A/a and B/b genes, both CAB and cab are generated, so each of them will appear in a frequency of half the total recombination frequency between those genes, to add a total of 0.1.
The gamete CAB will appear with a frequency of 0.05.
The gamete cab will appear with a frequency of 1.
The percentage of the offspring that will be CAB/cab is:
0.05 x 1 x 100% = 5%During _____________ ______________, oxygen enters the blood and carbon dioxide leaves the blood, and enters the alveoli.
During respiration oxygen enters the blood and carbon dioxide leaves the blood
A genetic engineer needs to use gene therapy to help a person with cystic fibrosis. Arrange the following steps in the order the engineer would use them.
a. Use only the steps you need. Inject the modified CFRT gene into a fertilized egg and implant into a woman who will be the surrogate mother.
b. Combine the cloned CFRT gene with a disarmed respiratory virus.
c. Clone the CFRT gene from someone with cystic fibrosis.
d. Clone the CFRT gene from someone without cystic fibrosis.
e.Modify the CFRT gene by putting on a different promoter
f. Test the patient’s blood cell DNA with PCR to see if they have the CFRT transgene.
g. Have the patient use an inhaler that contains the modified respiratory virus.
Answer:
d-b-g-f
Explanation:
1. Clone the CFRT gene from someone without cystic fibrosis.
This will make millions of copies of the gene (wild type, not being mutated and thus unable of producing the disease).
2. Combine the cloned CFRT gene with a disarmed respiratory virus.
This step will allow the virus to transport the gene of interest.
4. Have the patient use an inhaler that contains the modified respiratory virus.
This step helps the virus to enter and infect the patient's cells and thus allowing the copies of the transgene to be integrated into the patient's genome.
3. Test the patient's blood cell DNA with PCR to see if they have the CFRT transgene.
This will confirm if the transgene has actually been integrated into patient's genome.
Which of the following statements about DNA structure is true? View Available Hint(s) Which of the following statements about DNA structure is true? The nucleic acid strands in a DNA molecule are oriented antiparallel to each other, meaning they run in opposite directions. Hydrogen bonds formed between the sugar‑phosphate backbones of the two DNA chains help to stabilize DNA structure. Nucleic acids are formed through phosphodiester bonds that link nucleosides together. The pentose sugar in DNA is ribose.
Answer:
The correct answer will be option- the nucleic acid strands in a DNA molecule are oriented antiparallel to each other, meaning they run in opposite directions.
Explanation:
Deoxyribose nucleic acid or DNA is the molecule which acts as the genetic material of the organisms.
The structure of DNA suggests that DNA molecule is made of two strands of nucleotides which are oriented in the opposite direction with respect to each other.
Each nucleotide is composed of a five-carbon sugar called deoxyribose bonded with a phosphate group via ester bond and four types of nitrogenous bases bonded to complementary bases via hydrogen bond.
The sugar-phosphate backbone runs in the opposite direction with a free 5' carbon atom of phosphate group end a 3' OH group of sugar. The orientation of strands is that one strand run from 5' to 3' direction while another runs from 3' to 5' direction.
Thus, the selected option is the correct answer.
DNA consists of two antiparallel strands forming a double-helix structure. Each strand is made of nucleotides linked with phosphodiester bonds, and the pentose sugar in DNA is deoxyribose.
Explanation:The correct statement about the structure of DNA is that the nucleic acid strands in a DNA molecule are oriented antiparallel to each other, meaning they run in opposite directions. DNA is composed of two strands that are twisted to form a double helix; each strand composed of nucleotides that include a nitrogenous base, a five-carbon sugar (deoxyribose), and a phosphate group. The two DNA strands are antiparallel, such that the 3' end of one strand faces the 5' end of the other, resulting in the nitrogenous bases of each strand facing inward and forming hydrogen bonds, which stabilizes the double helix structure. Nucleic acids are indeed formed through phosphodiester bonds that link nucleotides together, but the pentose sugar in DNA is not ribose, but deoxyribose.
Learn more about DNA Structure here:https://brainly.com/question/36469737
#SPJ11