which of these is a innate adaptation?

A.hunting in packs
B.mating
C.fighting for protection
D.all behaviors are innate

Answers

Answer 1

Mating is a innate adaptation.

Answer 2

Answer: A lot of animals such as lions and tigers and big cats mate to make love so mate is the correct anwser.

MATING


Related Questions

What are the constituents of the vascular and lymphatic systems? consider structural similarities and differences between blood and lymph vessels, differences in the cell and molecular content of the blood and lymph, differences in the mechanism of fluid propulsion within blood and lymph vessels?

Answers

Lymph vessels travel one-way, back to the heart, venous route; has similar structure to veins including tunics and valves structural difference includes the lymph vessel's need to diffuse bigger molecules; lymph transport slower and has lower pressure and speed than veins

WILL GIVE MEDELS AND RATE!!!
Translation is a process by which the sequence:
a) a bases of mRNA is converted into a sequence of amineo acids of a protien
b) a basis of tRNA is converted into cytoplasm before attaching itself to a polypeptide
c) of basis of tRNA is converted into a sqeunce of amino acids of a protien
d) of basis of an mRNA is converted into cytoplasm before attaching itself to polypeptide.
If you've taken this quick check then plz post the other questions. I would like the help! I think its c,

Answers

a)Translation is a process by which the sequence of mRNA is converted into a sequence of amino acids of a protien.

What gene does aacgaagaggacatagagtatctaccgaaaaacaatcccgaaggaccgttacaacactcgatcaaccgcaagaaagtacgatggcaacatccattgtgtatgcatccatatctcatccagcattctgaaagggtaatgaataattattccgctgagttcatgaggtatccgaaggaggagcaacacttaggctataagagtatcatgcacatagatcgggataaatcgcctatcatatgtgacaacaatttcatgattaaaagt code for?

Answers

A gene instructs for the making of protein molecules.
Please make brainliest!☺

What is a strategic mineral?
Question 3 options:

A)one that is exported from the United States

B)a nonmetallic resource


C)one that must be imported to the United States

D)one that is easily removed from the ground

Answers

Your answer would be B. Hope this helped :)

A strategic mineral is a nonmetallic resource which are the commodities which are essential for the national defense during the situation of war. Thus, the correct option is B.

What is Strategic minerals?

Strategic minerals are the commodities which are essential to the national defense for which the supply during war is wholly, or partially dependent upon the sources outside the boundaries of the United States. These resources would be difficult to obtain as strict measures are used for controlling the conservation and distribution of resources.

Strategic minerals are imported from those countries where these are abundant and when the domestic production is unable to meet up with the demands of the country such as the during the situation of war. Nonmetallic Minerals like Petroleum, Aluminium, Copper, Uranium, etc are the examples of Strategic Minerals.

Therefore, the correct option is B.

Learn more about Strategic minerals here:

https://brainly.com/question/1263149

#SPJ2

What evolutionary development allowed plants to grow tall? see concept 29.3 (page 626)?

Answers

If your choices are the following:
A. rhizoids
B. sporophylls
C.leaves
D.the waxy cuticle
E. lignified vascular tissue

Then the answer is E.

Final answer:

The development of a vascular system with xylem and phloem enabled plants to grow tall, while the adaptations of seed and pollen facilitated reproduction independent of water and promoted wide dispersion, respectively.

Explanation:

The evolutionary development that allowed plants to grow tall was the development of a vascular system. This system includes xylem and phloem, which are tubes that transport water, minerals, and nutrients throughout the plant. The xylem is responsible for the upward transportation of water and minerals from the roots, while the phloem distributes sugars and other organic nutrients from the leaves to the rest of the plant.

Seed and pollen adaptations were crucial for the development and expansion of seed plants. Seeds allow plants to reproduce without being dependent on water, thus enabling them to survive in a variety of environments, including arid zones. Pollen, with its hardy structure, could be dispersed by wind or animals, reaching far distances and promoting gene flow between plant populations.

These developments provided plants with structural support to grow tall and compete for sunlight, while also being able to spread across vast territories.

"cold and dry" temperature and precipitation patterns are characteristic of

Answers

"cold and dry" temperature and precipitation patterns are characteristic of polar climates.

What are polar climates?

The polar climate regions are characterized by a lack of warm summers but with varying winters. Every month in a polar climate has an average temperature of less than 10 °C. Regions with polar climate cover more than 20% of the Earth's area.

Moreover, a polar climate is a place where the climate usually has a temperature below freezing, icy, and covered in snow. These areas do not get direct heat and sunlight from the sun. Polar climates are located at the North Pole of the Arctic, and at the South Pole on the continent of Antarctica.

Therefore, the polar regions surround Earth's North and South Poles. The area around the North Pole is called the Arctic. The area around the South Pole is called Antarctica.

Learn more about polar climates:

https://brainly.com/question/26116310

#SPJ6

Which theory of emotion includes a simultaneous arousal and interpretation of emotion?
A) James -Lange theory
B) canon bard theory
C) common sense theory
D) confirmed arousal theory

Answers

The correct answer is option B, that is, Cannon-Bard theory.  

The Cannon-Bard theory of emotion also called the Thalamic theory of emotion. It is a physiological illustration of emotion created by Walter Cannon and Philip Bard. The theory states that one feels emotions and encounter physiological responses like trembling, sweating, and muscle-tension at the same time.  

The Cannon-Bard theory suggests that one encounters physiological arousal and emotion at the similar time. The theory offers more attention to the role of outward behavior or thought that than was done by James-Lange.  


The major problem with hydrogen as an alternative source of energy is that none exists on the surface of the earth.
a. True
b. False

Answers

The answer will be False! Because it does not have hydrogen as an alternative source of energy it is not exists on the surface of the earth.

Hope it helped

Answer will be bolded

Does meiosis and mitosis (or both) end with unreplicated chromosomes? Which begins with replicated chromosomes?

Answers

Yes, both meiosis and mitosis end with unreplicated chromosomes.

Both meiosis and mitosis end with unreplicated chromosomes because mitosis has diploid chromosomes and meiosis has haploid chromosomes. We know that in mitosis, two daughter cells are produced that has double number of chromosomes each.

While on the other hand, in meiosis, four daughter cells are produced, each has half number of chromosomes. Mitosis is a type of cell division that start with replication of DNA in which exact copy of DNA formed which is distributed equally among the two daughter cells so we can conclude that both mitosis and meiosis end with unreplicated chromosomes.

Learn more: https://brainly.com/question/9074834

the graph shows the percentage of dog breeds affected by elbow dysplasia, which causes dogs to limp. What???s the most likely explanation for the mixed breed???s disease incidence?

Answers

it have low diversities 

Answer:

The most likely explanation is that the mixed race has a low diversity in genes.

Explanation:

Elbow dysplasia is a condition that causes a bad development in the elbows of dogs, causing a bad formation of cartilage in that region of the paw, or a bad structure of the surrounding bones.

This condition is common in mixed breeds, because these breeds have little diversity of genes, allowing this disease to be passed to the offspring during crossbreeding between dogs that already have the disease.

A neuron that carries impulses away from the central nervous system is a:

Answers

the answer is sensory neurons

Describe the process by which coral polyps and algae create a coral reef.

Answers

Coral reefs are built by coral polyps as they secrete layers of calcium carbonate beneath their bodies.  And inside each coral poly lives single-celled algae called zooxanthellae. So basically in simplistic terms, coral polys create coral reefs and algae is in coral polys which also goes into coral reefs when they are made. 

Which of the following genotypes is homogeneous recessive? ss, Bb, TT, or XY

Answers

The genotype that is homogeneous recessive is answer is Bb.
Hello,

The answer is option B "Bb".

Reason:

A recessive genotype has one lower case and one upper case letter (option B) A recessive homogeneous is two lower case letters (option A) XY is not a genotype. and dominate is two upper case letters (option C) therefore the answer is option B.

If you need anymore help feel free to ask me!

Hope this helps!

~Nonportrit

Which of the following is malleable?Question 6 options:

pottery

gold

glass

ice

Answers

Malleability is a substance's ability to deform under pressure (compressive stress). ... Examples of malleable metals are gold, iron, aluminum, copper, silver, and lead.
The correct answer is gold. 

How does producing plastics benefit the economy?

Answers

Producing plastics benefits the economy by employing workers and it helps the economy of every state by spending billions of dollars on shipping plastic products. 

Hope this helps! Have a good day. 

Plastic has economic benefits and can save resources. It increases food shelf life and reduces fuel usage by being lightweight.

Why is plastic industry important?

The use of plastic has been shown to have a number of direct financial benefits as well as the potential to improve resource efficiency. It lengthens the time that food can be stored without going bad, which cuts down on food waste, and its relatively low weight cuts down on the amount of fuel needed to transport items.

The invention of computers, mobile phones, and the majority of the life-saving advancements in modern medicine would not have been conceivable without plastics. Plastics, thanks to their low weight and superior insulating properties, contribute to the reduction of fossil fuel consumption in heating and transportation.

The usage of plastics not only enables us to lead more fulfilling lives but also makes a positive contribution to the preservation of the environment. Plastics are actually beneficial to the protection of the environment since they help cut down on trash, which in turn helps save energy in our houses, cuts down on the weight of vehicles, which results in fewer greenhouse gas emissions from the burning of gasoline, and so much more.

Learn more about plastics, here:

https://brainly.com/question/11452652

#SPJ2

In sickle-cell disease, variation in one gene causes red blood cells to bend, or sickle. This means the sickled cells _____.

carry toxic levels of oxygen through the body

attract larger numbers of the malaria parasite

are better at destroying the malaria parasite

cannot carry normal levels of oxygen to cells

Answers

Sickle cells are shriveled and do not function properly. Thus, they cannot carry normal levels of oxygen to cells. Think of it this way— a healthy cell that properly carries oxygen to cells is round and smooth. That’s how the cell is supposed to be. When a cell is a shriveled sickle cell, it is damaged, and isn’t able to work like it’s meant to.
Something interesting about sickle cell disease is that you can be a carrier for it (aka homozygous for the trait, Xx). Carriers are actually resistant to malaria. They have regular blood cells AND sickle cells! However, if you’re homozygous (XX) you will have complete sickle cell disease. And that’s not fun!!
Hope this helped you at all!!

In sickle-cell disease, variation in one gene causes red blood cells to bend, or sickle. This means the sickled cells cannot carry normal levels of oxygen to cells. Thus, the correct option is D.

What is sickle-cell disease?

Sickle-cell disease may be defined as a cluster of inherited red blood cell disorders.

Due to this disease, the shape of the red blood cells has an abnormal crescent, blocks small blood vessels, and does not last as long as normal red blood cells.

Due to the alterations in the shape of red blood cells, the affinity of oxygen binding decreases, and hence they cannot carry normal levels of oxygen to cells.

Therefore, the correct option for this question is D.

To learn more about the sickle-cell disease, refer to the link:

https://brainly.com/question/17063471

#SPJ5

Which region of skin hosts the largest bacterial population?

Answers

The epidermis is a layer of skin which contains the most bacteria in the skin. Upper parts of hair follicles also have those microorganisms a lot. Skin microbiota is usually non-pathogenic and has a defensive role (for example, preventing pathogenic organisms to enter the skin surface). Even though, bacteria can cause skin diseases (for example, acne) and enter the blood system.

Which state would best be suited to harness wind energy?

Answers

North Dakota would be the best state to harness wind energy.

The correct answer is North Dakota.


The best state which is suited to harness wind energy is North Dakota.


Harvesting of wind energy has some advantages. For example,

1 .Wind energy is one of the leanest and most effective forms of harnessing a renewable form of energy.

2. Wind energy is cleaner, more renewable and cheaper than many of the current sources of energy.


We use harnessing wind energy because,

1. It produces no pollution.

2. It produces more jobs per watt.

3.It is renewable and lasts for long

Which head glands secrete sucrase, lipase, amylase, and invertase?

Answers

The answer would be labial glands.

The labial gland is a small gland that located near the orifice of the mouth. It can secrete several kinds of enzymes like sucrase and amylase that degrades the carbohydrate(sugar and starch), or lipase that degrades fat. These enzymes can help protect the mouth and teeth from bacteria.

Solar energy is renewable. What could be an economic factor that prevents the maximum exploitation of this resource?

Answers

Answer:

Solar energy is not always available and needs to be stored.

Explanation:

Though solar energy is a renewable, clean source of energy, it is not available at all times and needs to be stored. This is an economic factor that could prevent the maximum exploitation of this resource.

Solar energy is not always available and needs to be stored that prevents the maximum exploitation of the resource.

What are the uses of solar energy?

Solar energy is radiant light and heat from the Sun that is harnessed using a range of technologies such as solar power to generate electricity, solar thermal energy, and solar architecture.

The most commonly used solar technologies for homes and businesses are solar photovoltaics for electricity, passive solar design for space heating and cooling, and solar water heating.

When the sun shines onto a solar panel, energy from the sunlight is absorbed by the PV cells in the panel. This energy creates electrical charges that move in response to an internal electrical field in the cell, causing electricity to flow.

Learn more about solar energy:

https://brainly.com/question/9704099

#SPJ6

Do you think that humans and humpback whales share a common evolutionary lineage?

Answers

Yes because when it comes to whales and humans we have a lot in common. They have different behaviors and languages within their own culture as humans do.They come in a lot of sizes and have different behaviors. Just like us and they are also mammals. While other sea creatures have gills.

Yes, humans and humpback whales share a common evolutionary lineage. Both humans and humpback whales are mammals, which means they have many biological similarities.

Additionally, research has shown that all mammals share a common ancestor that lived approximately 200 million years ago, so humans and humpback whales would have diverged from this common ancestor and evolved along separate paths.

Genetic studies have also provided evidence for the relatedness of humans and other mammals, including whales.

The last common ancestor of humans and whales lived over 95 million years ago and was a small, insect-eating mammal that lived on land.

Learn more about mammals at:

https://brainly.com/question/15326492

#SPJ2

How does an ecosystem approach to conservation differ from a single-species approach? the ecosystem approach has been more successful at attracting the public's attention to conservation needs. the ecosystem approach focuses on a single "charismatic" species―large, furry, and photogenic. an ecosystem approach involves restoring and protecting an entire habitat and all the species within it. all of the above?

Answers

For the answer to the question above,
the ecosystem's approach to conservation differs from a single-species approach by involving restoration and by protecting the whole habitat and organisms and species in it.
So the answer is
"an ecosystem approach involves restoring and protecting an entire habitat and all the species within it".

From which type of organism did the ancestor of land plants likely evolve

Answers

They most likely evolved from a protist similar to green algae. I hope this helped! Good luck! ^▽^

The protoplasm and cytoplasm of a plant are interchangeable terms.
a. True
b. False

Answers


B. False

Protoplasm- includes the nucleus
Cytoplasm- excludes the nucleus

SOS:

The answer is FALSE!!!

The cytoplasm is protoplasm that surrounds the nucleus. All the organic substances of the cell are referred to as the protoplasm. The cytoplasm and the nucleus make up the protoplasm.

Hope this helps!!

The leading preventable cause of cancer is _____.
A.tobacco B.UV exposure C.HPV D.bacterial infection

Answers

I think the answer is C.

Answer:

The answer is A: Tobbaco

Explanation:

Health officials estimate that almost 40 percent of cancers can be prevented by a healthy diet, physical activity, and avoidance of tobacco. In fact, tobacco use is the single most preventable cause of cancer in the world.

WILL MARK BRAINLIEST! HURRY!! a student wants to study the effect of removing
Thermal energy from a system. Which of the following experiments should the student perform?

Close a circuit by adding a penny and record if the bulb glows

Close a circuit by adding a nail and record if the bulb glows

Gradually warm a liquid and record it’s change in state

Gradually cool a gas and record it’s change in state

Answers

Answer:

Gradually cool a gas and record it's change in state

Explanation:

you are removing thermal energy

Answer:

c is answer

Explanation:

Heat exhaustion is a deadly heat stress illness that occurs when the body's heat production significantly exceeds its cooling capacities and core body temperature rises to dangerous levels. heat exhaustion is a deadly heat stress illness that occurs when the body's heat production significantly exceeds its cooling capacities and core body temperature rises to dangerous levels.
a. True
b. False

Answers

This question is false.

What advantage might chromosome banding patterns have in the analysis and diagnosis of chromosomal problems or abnormalities?

Answers

Chromosomal banding pattern is the pattern of colors formed when the chromosome is exposed to certain specific dyes.

These dyes do a color reaction with a special repetitive sequence of base pairs.

When the normal pattern is not obtained
there may be two reasons
1. Chromosomal injury
2. Chromosomal aberration.

In injury certain part is either deleted or shifted to somewhere else

in aberration chromosome is normal but its sequence is got changed.

So its certain that is has got great diagnostic value.
But it fails
in case of point mutation or certain others.

This banding pattern is also helpful in preliminary diagnosis of a suspect in any crime but most of the judiciaries do not assure of its results.

which structures are not found in prokaryotic cells

Answers

Nucleus and cell-bound organelles 

The answer is cilia. It actually means "motile" or moving.

Why is it said that natural selection acts on pheno- types rather than on the genetic material of organisms?

Answers

If you are strong and healthy then it doesn't matter if your genetic material isnt a complex structure
The environment can act directly on phenotypes, which are, of course the variations presented by genotypes. Genotype does determine phenotype but it is the phenotype which is exposed to the external environment so selection pressures can only act on the traits individuals have, not what gives them the trait i.e. if the same trait is produced by two different genotypes selection will act equally on both.
Other Questions
Yvonne put $4000 in a savings account. At the end of three years, the account had earned $960 in simple interest. A. How much does she have in her own account at the end of three years? B. What annual simple interest rate did the account grow? Show your work. C. How many more dollars would she have in her account if the interest rate were 1% greater? Show your work. Define circuit training The influence of indigenous populations such as the original Mayan and Aztec civilizations would most likely to be seen in the works of The potential energy of a pair of hydrogen atoms separated by a large distance x is given by u(x)=c6/x6, where c6 is a positive constant. is this force attractive or repulsive? When responding to an incident, awareness-level personnel should resist rushing onto the scene. use your emergency response guidebook (erg) and take the next three steps: step 1: identify the material (yellow or blue section); step 2: identify the 3-digit guide number; step 3: locate response actions within the? 5. (10.01 MC) If sin = 1 over 4 and tan > 0, what is the value of cos ? (1 point) what is 4 5/6 minus 5/6 minus 1 1/2 minus 2/3 Consider four species of conifers. species a and b are sister species. species c and d are also sister species. the clade containing species a and b is a sister to the clade containing species c andd. not counting the root as a node, how many nodes would be found in a phylogenetic tree of species a, b, c, and d? Which of the following represents seventh root of x to the sixth power in exponential form The area of a rectangle is 56 cm.the length is 2 cm more than x and the width is 5 cm less than twice x.solve for x Why do electromagnetic waves not require a medium for travel? a.because electromagnetic waves travel too fast for stationary particles to move with them b.because electromagnetic waves transmit energy without compressing the particles of the medium c.because electromagnetic waves generate their own particles for compression and use these for movement d.because electromagnetic waves move in two-dimensional space, the particles of mediums exist in 3-d space? Brent conducted a survey in his school regarding whether students ride their bikes to school each day. he surveyed a random sample of 150 students and 40 said they rode their bikes to school each day. there are 450 students who attended school. based on the results of Brents survey, about how many students in the school ride their bikes to school each day A 17-year-old gravid client presents for a regularly scheduled 26-week prenatal visit. she appears disheveled, is wearing ill-fitting clothes, and does not make eye contact with the nurse. which items should the nurse discuss with the client? select all that apply What is a comparison microscope? What are the advantages of this microscope? Hannah has 11 toothpicks that are the same length.Name the types of triangles and quadrilaterals Hannah can make if she uses only one toothpick for each side of each figure In most ____________ data collection, the researcher questions respondents to determine what they think about some topic or how they might behave under certain conditions. What is missing from the temperature and volume graph shown at right? A decrease in height of a column in a mercury barometer means that I really need help!! God bless you. For a machine, the output force is 20 N, and the output distance is 4 m. Which must be true about the work input? A. It equals 80 J. B. It must be greater than 80 J. C. It must be less than 80 J.