Which President established the custom of not seeking a third term?

Answers

Answer 1

Answer:George Washington

Answer 2

Answer: FDR was the first president to seek and win a third term.

Explanation: The 22nd Amendment, which was ratified in 1951 made the custom a constitutional requirement.


Related Questions

Write a paraphrase of the information. A letter of thanks is a courteous acknowledgment of a gift or of something that was done for you

Answers

Answer:

The best answer to the request: Write a paraphrase of the information: A letter of thanks is a courteous acknowledgment of a gift or of something that was done for you, would be: "Notes of gratitude are the best, and most polite way, in which a person can show recognition for the presents, or actions that have been done for you by another person".

Explanation:

Paraphrasing, is a pretty difficult skill in writing, because it requires understanding of the message given by an original idea, and expressing that message without using any of the original words. Said in another way, paraphrasing is expressing the same thing, but in other words. As such, all the words of the original text must be changed, and the main idea of it must be expressed in the words of the new writer, while not changing structure, or the meaning of the original.

Why did the Minoans drink goat's milk?

They thought their gods drank it.
They thought uncivilized people drank cow's milk.
They did not have cows.
They only had goats.

Answers

They thought their God’s drank it

They only had goats. The Minoans likely drank goat's milk because that was the domesticated animal readily available to them, and goats played a significant role in their daily lives and economy.

The Minoans drank goat's milk likely because they only had goats available to them as a domesticated source of milk. Evidence of goat domestication dating back to the Neolithic Age suggests that goats were used extensively for their milk, meat, dung (used as fuel), hair, bones, and sinew. Goats also served as currency in the barter system before the invention of coins, highlighting their significance in daily Minoan life. Moreover, artefacts such as pottery and frescoes indicate the importance of animals in their society, including the prominence of goats. The Minoan civilization valued an abundance of natural resources, and goats were a readily available resource in their environment.

Which one of the following is true of agriculture in Spanish America? The main crops were vastly different than they had been before Spain’s arrival. Spain did not do any farming in its empire. Catholic priests were forbidden to be involved in farming. American Indian slaves did the work on large-scale farms.

Answers

Answer:

American Indian slaves did the work on large-scale farms.

Explanation:

Agriculture was the main economic activity and the basis of colonial wealth, both for the income generated and for the occupied population. In the early years of the conquest, most agricultural production followed indigenous techniques and organizational criteria. It was a varied activity, with great regional diversity and that mobilized broad social sectors. That is why it is necessary to differentiate local production from the products brought by the Europeans: grapevine, cereals, olive tree, indigo or sugar. Among the American products were the crops destined to satisfy the indigenous food needs (corn, potato, beans, etc.) and those other species whose stimulating power gave them a concrete function in the colonial system: coca, yerba mate or magüey (pulque), condemned as "vices" by the church and other social sectors, a category shared with tobacco. There were other successful American products, such as cacao, in southern Mexico and Central America, or the grana-cochinilla, a dye exploited by the indigenous communities of Oaxaca (Mexico), but not in the Spanish haciendas. The first purely Spanish agrarian enterprise was sugar production, which began to stand out in Santo Domingo in 1515 and had to be carried out with African slaves due to the disappearance of the local labor force.

Sources: 1- https://mihistoriauniversal.com/edad-moderna/agricultura-america-colonial/

2 -CAPUTO, Marina, “La configuración del sistema colonial hispanoamericano: economía, sociedad y política”, Ficha de cátedra, 2016.

3-*SERRERA, Raúl, “Sociedad estamental y sistema colonial”, en ANNINO, Antonio,CASTRO LEIVA, Luis y GUERRA, François-Xavier, De los imperios a las naciones iberoamericanas, Zaragoza, Iber-Caja, 1994, pp. 45-74.-

What are natural rights and natural law? Explain how the founders suggest the application of these concepts in the Declaration of Independence.

Answers

Natural law is the higher order positive law which emerged from the philosophers of ancient age. Stoic reformers believed that law of nature is the supreme law which connects man and nature to live in harmony with each other.

Aristotle says that though man perceives things and frames laws to live an orderly life, the natural law is universal and a common law exists which is divine.

Natural rights are the rights which are believed to be inherited by birth of a man. These are natural birth rights and they are the base for the founding fathers to frame the US Constitution.

What was John Brown’s goal in raiding the federal arsenal at Harpers Ferry, Virginia?What was John Brown’s goal in raiding the federal arsenal at Harpers Ferry, Virginia?

Answers

Answer:

Abolitionist John Brown leads a small group on a raid against a federal armory in Harpers Ferry, Virginia (now West Virginia), in an attempt to start an armed slave revolt and destroy the institution of slavery

Explanation:

In an effort to incite an armed slave insurrection and abolish slavery, abolitionist John Brown leads a small party on a raid against a federal armory in Harpers Ferry, Virgi.

What did John Brown do to end slavery?

In May 1858, Brown called a clandestine anti-slavery convention in Canada. About 50 of Brown's black and white allies ratified his anti-slavery constitution.

In December, Brown did more than just plan and talk. In a daring expedition, he crossed the border from Kansas into Missouri by killing one slave owner and freeing 11 slaves.

The plan was to seize the local federal armory with the intention of igniting a nationwide uprising against slavery. John Brown was in charge of the American abolitionist movement before the American Civil War.

Thus, In an effort to incite an armed slave insurrection and abolish slavery.

For more details about John Brown, click here:

https://brainly.com/question/14289363

#SPJ2

NEED HELP ASAP!!!!!!!!

John fortier says, "the people can speak." he means: the people can settle the matter

Answers

Answer:

The phrase is referring to the power struggle going on between the President and the Congress.  If the conflict is not resolved it might come down to the voters.

Explanation:

The way the government works is by a system of checks and balances.  This means that power is divided into three branches: executive, legislative, and judicial.  This system allows each branch to keep the others in check.  Clashed and power struggles between the branches is not something new, but the recent issues are really putting the system to the test.

Currently the system is in crisis because the Trump administration is at odds with Congress.  There are several alternatives for the situation to be resolved, but some, like John Fortier, suggest that it should be decided by the voters.  That's why he says, "The people can speak.  The people can decide if the President is right or Congress is right."

The power of judicial review is one example of _____.

Answers

Answer:

The power of judicial review is an example of the system of checks and balances.

according to the Constitution the right of freedom religion supports

Answers

Answer:

The constitution gives human rights where citizens have several rights in a democratic country. Freedom of speech is the freedom to speak about their own opinions and perspectives and right and wrong.

Just like that there is freedom of Religion where the citizens are free to follow their own religion and can even change their religion if they want to. There is freedom to follow any kind of religion and not follow any.

what was the main goal of redemtioners?

Answers

Answer:

Redemptioner. Redemptioners were European immigrants, generally in the 18th or early 19th century, who gained passage to American Colonies (most often Pennsylvania) by selling themselves into indentured servitude to pay back the shipping company which had advanced the cost of the transatlantic voyage

Explanation:

Why was the Missouri controversy in 1820 significant? It demonstrated the wisdom of the founding fathers in adopting the three-fifths clause. It revealed a sectional divide that potentially threatened the Union. It resulted from overly ambitious proslavery politicians seeking to score political points. It required a constitutional amendment, the Tallmadge Amendment, to be solved.

Answers

Answer:

Option: It revealed a sectional divide that potentially threatened the Union.

Explanation:

Missouri controversy in 1820 helped the legislation from getting divided between the slave and free states. It also helped in balancing the powers in the south and north states by converting Maine as a free state, Missouri as a slave state. The compromise stopped the spread of slavery in the north (Louisiana territory) from the southern line of latitude 36 degrees 30'.  

Final answer:

The Missouri controversy in 1820 revealed a sectional divide that threatened the Union and increased tension between free and slave states. The debate shifted the terms of discussion by presenting slavery as an evil.

Explanation:

The Missouri controversy in 1820 was significant because it revealed a sectional divide that potentially threatened the Union. The debate over Missouri's admission as a slave state brought to the surface the tension between free and slave states, leading to strident calls of disunion and threats of civil war. It also highlighted the issue of slavery's expansion westward and shifted the terms of debate by presenting slavery as an evil to be stopped.

Learn more about The significance of the Missouri controversy in 1820 here:

https://brainly.com/question/11752985

#SPJ3

The ritual sacrifices practiced by the Aztecs: a. occurred one at a time and therefore were minimal. b. prompted most Aztecs to oppose their leaders, who opposed the sacrifices. c. were always held at an arena in Tenochtitlán that resembled the Roman Colosseum. d. disgusted Europeans despite their own practices of publicly executing criminals and burning witches at the stake. e. cost the Spanish several hundred men before Cortés conquered the Aztecs.

Answers

Answer:

Option: d. disgusted Europeans despite their own practices of publicly executing criminals and burning witches at the stake.

Explanation:

When the Spanish first came to Central America, they were surprised to see the civilizations with the practice of rituals that required a heart of a human being. The Spanish were terrified by the notion that the Aztecs believed in deities that frequently expected blood.  

Aztec believed about the creation and destruction of the world. Aztec required these rituals and practices to keep Gods happy.      

What is citizenship?

Answers

Answer:

A citizenship is having the status of being a citizen. If you have a citizenship in your country you have the right to live there,work,vote, and pay taxes.

Answer:

the position or status of being a citizen of a particular country.

Explanation:

for example:

If you have citizenship in a country, you have the right to live there, work, vote, and pay taxes.

During the Progressive era:
(A) growing numbers of native-born white women worked in offices.
(B) the number of married women working declined.
(C) growing numbers of native-born white women worked as domestics.
(D) most eastern European immigrant women worked as telephone operators.
(E) most African-American women worked in factories.

Answers

Answer:

(A) growing numbers of native-born white women worked in offices.

Explanation:

The Progressive Era was a period of social activism and political reform across the US. Progressivists wanted to end political corruption, improve the lives of individuals and protect citizens.

During this period there was a rise in the participation of women in social and political movements. Because of that a large number of native-born white women that started to work in offices and participate more in society.

Final answer:

During the Progressive Era, native-born white women increasingly started working in office environments, reflecting broader societal changes and the evolution of women's roles during this period.

Explanation:

During the Progressive Era, the roles of women in society began to evolve significantly. One of the changes was in the professional sphere where growing numbers of native-born white women started working in office environments, and this shift marked a move away from traditional roles. The correct answer to the question, therefore, is (A) growing numbers of native-born white women worked in offices.

This change was part of a broader societal transformation during this period which also saw an increase in women's suffrage movement, with activists fighting for a woman's right to vote. While some newly arriving immigrant women might take up factory jobs or become domestics, the trend for native-born women was towards more white-collar work, reflecting their increasing participation in public life and education.

What were the most important characteristics of early civilization in Mesopotamia?

Answers

Answer:

Historians have identified the basic characteristics of civilizations. Six of the most important characteristics are: cities, government, religion, social structure, writing and art.

Explanation:

Use the drop-down menus to complete the sentence. The official religion of the Persian Empire was ___________ , whose main belief is __________

(Blank one Brahmanism,Buddhism,Judaism, OR Zoroastrianism)

Blank two people may worship many gods,meditation is the path to enlightenment,leaders should be buried in huge structures called pyramids, OR The universe in in a struggle between good and evil)

Answers

Answer:

1- Zoroastrianism

2- The universe in in a struggle between good and evil

Explanation:

Zoroastrianism, by the name of its founder, is the denomination of religion and philosophy that, is based on the teachings of the Iranian prophet and reformer Zoroaster (Zarathustra), who recognize Ahura Mazda as the divinity, considered by Zoroaster as the sole uncreated creator of everything.

Zoroastrists venerate eternal fire, the divine symbol. Zarathustra preached a dualism based on the battle between Good and Evil, Light and Darkness. Zarathustra's principle is that there is a Spenta Mainyu spirit, later identified as Ahura Mazda or Hormuz, and an evil spirit Angra Mainyu assimilated to Ahriman, opposites representing day and night, life and death. These spirits coexist in each of the living beings.

Final answer:

The official religion of the Persian Empire was Zoroastrianism, which posits a cosmic battle between good and evil. Persians believed that they could influence this struggle through their moral choices and actions. Despite Zoroastrianism being the state religion, the empire was religiously tolerant.

Explanation:

The official religion of the Persian Empire was Zoroastrianism, whose main belief is that the universe is in a struggle between good and evil. Zoroastrianism, named after its prophet Zoroaster, emphasizes the ongoing battle between two opposing forces: the god of goodness and light, Ahura Mazda, and the evil spirit, Ahriman. Individuals played a pivotal role in this cosmic conflict through their actions and choices, contributing to the ultimate triumph of good over evil.

Persian kings were seen as earthly representatives of Ahura Mazda and aimed to expand their empire under the belief that doing so would hasten the victory of good. While Zoroastrianism was the state religion and promoted by the rulers, the Persian Empire also practiced a policy of religious tolerance, allowing multiple religious traditions to coexist within its vast territories.

Which of the following traits make a person a good voter? Select all that apply
A. Interested in news
B. As a member of a political party
C. Owns property or a business
D. Pays federal taxes
E. Serves as a volunteer or in the arm forces
F. Understands government

Answers

Answer:

Explanation:

A, B,d,F

Interested in news, Pays federal taxes, Understands government are the traits that make a person a good voter.

Options A,D,F

Explanation:

Interested in news: It makes you aware about the situation of your country and even the candidates who are running for the election so that you know which candidate has an intention to work on the objectives that concerns to the country that are crucial.

Pays federal taxes: when you pay taxes you know how much government is taking from you so, must also know about the government's expenditure and how is it beneficial and important to masses.  

Understands government: It's also important that a voter understands the basics about the government system it's powers and about the candidates.

How does the Atlantic Intracoastal Waterway help South Carolina's economy?

Answers

Answer:

Atlantic Inter coastal Waterway is a lifeline for commercial and recreational boaters.

Explanation:

The Atlantic Inter coastal Waterway is the only way to get to the ocean and its affects the Economy of South Carolina.  For generations, tugboats shoved barges along South Carolina’s stretch of the waterway for the timber, paper, and steel industries.

The economy is depended on it as it is the only source of transportation of goods and it's maintenance is quite costly.

What type of metalwork sculpture is pictured below?

Answers

Answer:A baptismal font

Explanation: A baptismal font is a basin, vase, or other receptacle in which water is store for the Christian ritual of baptism.

Answer: A baptismal font

Explanation:

The Baptismal Font at St. Bartholomew's Church is a well-known example of Mosan art.  Even though the Mosan origin of the font has been challenged, the font is still credited to Reiner of Huy, a 12th-century metalworker, and sculptor. The font was created through the lost-wax casting technique, and includes illustrations of five scenes, such as the Baptism of Christ and St. Peter baptizing Cornelius the Centurion.

What was the relationship between John Locke and Thomas Jefferson? John Locke and Thomas Jefferson conducted a famous series of debates at Lloyd's Coffeehouse in London. Thomas Jefferson married John Locke's granddaughter and inherited many of Locke's unpublished papers. Thomas Jefferson paraphrased John Locke in the Declaration of Independence. John Locke quoted Thomas Jefferson in the Second Treatise on Government.

Answers

Answer:

Option C.

Explanation:

Thomas Jefferson paraphrased John Locke in the Declaration of Independence, is the right answer.

John Locke was a philosopher during the Enlightenment period whose executive theories did not support the elected assembly based on inheritance. His views and opinions about the state in the work "Two-Treatises of Government" urged Thomas Jefferson at the time while he drafted the Declaration of Independence for American colonies. Locke suggested opinions about the centrality of resources in human freedom and the beliefs of natural law (which asserts that everyone takes birth with natural rights).

John Locke and Thomas Jefferson had a significant relationship. They engaged in a well-known series of debates at Lloyd's Coffeehouse in London. Thomas Jefferson, on the other hand, married John Locke's granddaughter and received many of Locke's unpublished papers.

Furthermore, in the Declaration of Independence, Thomas Jefferson paraphrased John Locke. Also, in the Second Treatise on Government, John Locke quoted Thomas Jefferson.

John Locke's philosophy greatly influenced Thomas Jefferson. Locke was a key figure in the Enlightenment era, and his writing on liberty, natural rights, and government's role in protecting those rights had a significant impact on Jefferson's political beliefs.

In fact, Jefferson cited Locke as one of the three most important thinkers of all time in his letter to John Adams in 1813. Additionally, Jefferson even went so far as to describe the Declaration of Independence as "an expression of the American mind" and an "outgrowth" of Locke's philosophy.

Furthermore, Jefferson married Locke's granddaughter, Martha Wayles Skelton. Their relationship did not directly impact their philosophical beliefs or their interactions, but it did provide Jefferson with access to Locke's papers.

He received many of Locke's unpublished works, which helped shape his political views and contributed to his own writings.

Overall, the relationship between John Locke and Thomas Jefferson was significant in terms of their shared political beliefs and Jefferson's access to Locke's papers. Their debates and correspondence helped shape the principles of democracy that continue to influence the world today.

To know more about John Locke and Thomas Jefferson here

https://brainly.com/question/13346823

#SPJ11

Write as a square of a binomial:


1: 4x^2+12x+9



2: 10xy +0.25x^2+100y^2

Answers

Answer:

1) (2x + 3)^2

2) (.5x + 10y)^2

Explanation:

1) You know this has to be a squared term, so just look for the roots of the first and last terms. For the first term, [tex]\sqrt[2]{4x^{2} } = 2x[/tex] and for the last term, [tex]\sqrt[2]{9} = 3[/tex]. You can check either by FOIL or the Box Method and you will see that it comes out to the initial formula.

2) Once again, look for the square roots of the first and last terms. In this case, you have to sort the initial equation out so that it looks like a normal trinomial, this is what you get:

[tex]0.25x^{2} + 10xy + 100y^{2}[/tex]

Then you just take the square roots of the first and last terms, which are 0.5x and 10y, respectively.

Final answer:

To write the given expressions as squares of binomials, we can factor and identify the square root of each term.

Explanation:

To write the given expression as a square of a binomial, we need to look for patterns or factors that can be squared. Let's break down each expression:

1. For 4x^2+12x+9, we can rewrite it as (2x+3)^2. The squared binomial is obtained by taking the square root of 4x^2 (which is 2x) and taking the square root of 9 (which is 3).

2. For 10xy+0.25x^2+100y^2, we can rewrite it as (0.5x+10y)^2. The squared binomial is obtained by taking the square root of 0.25x^2 (which is 0.5x) and taking the square root of 100y^2 (which is 10y).

Learn more about Writing expressions as squares of binomials here:

https://brainly.com/question/34163896

#SPJ11

why was evolution debated in the scopes trial of 1925?

Answers

The Scopes Trial, formally known as The State of Tennessee v. John Thomas Scopes and commonly referred to as the Scopes Monkey Trial, was an American legal case in July 1925 in which a substitute high school teacher, John T. Scopes, was accused of violating Tennessee's Butler Act, which had made it unlawful to teach human evolution in any state-funded school.[1] The trial was deliberately staged in order to attract publicity to the small town of Dayton, Tennessee, where it was held. Scopes was unsure whether he had ever actually taught evolution, but he purposely incriminated himself so that the case could have a defendant.

How did the American colonists react to the laws punishing the colonies? Why is this important?

Answers

They were very unhappy about it, since the Act basically said that the British Parliament had the right to pass any law (including a law about new taxes) at any time, whether the colonists agreed with that law or not.

Since the colonists still had no representation in Parliament, this was yet one more motivation for the colonists to consider a rebellion, and a number of American colonial leaders began to advocate for such a rebellion against British rule.

why is this important: because the Americans colonist can stand alone without any help from the British.

I hope that I help you.

Answer:The Intolerable Acts were punitive laws passed by the British Parliament in 1774 after the Boston Tea Party. The laws were meant to punish the Massachusetts colonists for their defiance in the Tea Party protest in reaction to changes in taxation by the British to the detriment of colonial goods.

Explanation:

what type of land did jamestown settle on?

Answers

Answer:

Hunting Land

Explanation:

The site for Jamestown was picked for several reasons, all of which met criteria the Virginia Company, who funded the settlement, said to follow in picking a spot for the settlement. The site was surrounded by water on three sides and was far inland.

The water was also deep enough that the English could tie their ships at the shoreline - good parking! The site was also not inhabited by the Native population.

The settlers were now protected by building a fort against any attacks that might occur from the local Powhatan Indians, whose hunting land they were living on. Relations had already been mixed between the newcomers and the Powhatan Indians.

Answer:

settle in america

Explanation:

In Greek history, the Persian Wars (500s & 400s BCE) were caused by A) conflict over Greek settlements in Asia Minor. B) the lack of democratic rights in Greek city-states. C) the assassination of the Persian king. D) attempts by Sparta to control the Delian League. 2) In the Classical Era, Greek religion could BEST be described as A) animistic. B) monotheistic. C) paganistic. D) polytheistic. 3) Society in ancient Sparta was centered mainly around A) trade. B) the arts. C) democracy. D) the military. 4) Which statement offers the BEST description of a person who would have had full political rights in Ancient Athens? A) all adult males B) all adult Greeks C) all free adult males D) all free men and women 5) The term given to the body of stories about ancient Greek gods and heroes is A) theology B) sociology. C) mythology. D) anthropology. 6) When the city of Athens took over territory outside its walls, it changed from a city to a ____________, which led to the development of a complex government. A) city-state B) county C) nation D) parish 7) The Han Dynasty of China contributed which invention to society that is still used today? A) paper B) stirrups C) steel plow D) typewriter 8) Chinese dynasties- such as the Qin, Han, and Ming- are often said to be imperial dynasties. The term imperial is MOST associated which of these words? A) communism B) democracy C) dictatorship D) empire 9) Which of these was a consequence of the Persian Wars in Greece? A) Athens was annexed by the Achaemenid Empire. B) Athens allied with Persia to defeat Sparta. C) Athens formed the Delian League for military protection. D) Athens expanded their territory into Carthage and North Africa. 10) Which of these was the MOST important reason for the success of the economy of Han China? A) Trading gold with the Roman Empire. B) Sea voyages of Zheng He's navy. C) Mongol control of the Silk Road. D) Han control of Silk Road trade.

Answers

Answer: 1. A -2. D -3. D- 4. C- 5. C- 6. A- 7. A - 8. D 9. C- 10. D

Explanation:

Just took this an made 100 hope this helps

Answer:

Were caused by A) conflict over Greek settlements in Asia Minor.

2) D. Polytheistic 3) D.the military Spartan believe in a strong army and prepared children at the age of 7 to become expert in combat. Women were let at home

4) A) All adult males have full political rights in Ancient Athens

5) C) mythology

6) A city- state 7) A. paper 8) D) Empire 9) B) Athens was allied with persia to defeat Sparta

10) D. Han control of silk road trade.

Explanation:

What are the differences between the Shi’a and Sunni?

Answers

Answer:

One of the most crucial differences between Shia and Sunni Muslims is the importance that the Shiites give to Ali, whom the Sunni do not recognize as being the prophet's rightful successor.

A piece of toast came out of the toaster very overcooked.

What kind of change occurred?

chemical change

change in reaction

phase change

physical change

Answers

Answer: I have to say chemical change

Explanation: Chemical changes occur when a substance combines with another to form a new substance, called chemical synthesis or, alternatively, chemical decomposition into two or more different substances

The overcooked toast represents a chemical change because it undergoes a chemical reaction (the Maillard reaction) that alters its chemical composition and properties. The correct answer is Chemical change.

A piece of toast coming out of the toaster very overcooked is an example of a chemical change.

In a chemical change, also known as a chemical reaction, the substances involved undergo a transformation at the molecular or atomic level, resulting in the formation of new substances with different properties.

In the case of toast, the high heat in the toaster causes a chemical reaction known as the Maillard reaction.

During this process, the carbohydrates and amino acids in the bread's proteins undergo chemical changes, leading to the browning and alteration of the toast's flavour and texture.

The Maillard reaction is responsible for the characteristic aroma and taste of toasted bread.

This differs from a physical change, where no new substances are formed, and the material retains its chemical composition. For instance, if the toast were only heated but not overcooked, it would undergo a physical change involving a phase change from solid to a slightly altered solid (browning).

However, when it becomes very overcooked, the chemical composition of the toast changes significantly, making it a chemical change.

The correct answer is Chemical change.

for such more question on chemical reaction

https://brainly.com/question/1893305

#SPJ2

choose all the items that correctly describe the northwest ordinace of 1787

Answers

Answer:

Explanation:

The Northwest Ordinance, adopted July 13, 1787, by the Confederation Congress, chartered a government for the Northwest Territory, provided a method for admitting new states to the Union from the territory, and listed a bill of rights guaranteed in the territory.

Use the drop-down menu to complete the sentence.

Egypt’s Black Land was caused by A. the damming of the Nile River
B. pollution created by farmers C. the desert surrounding the Nile
D. yearly flooding the Nille

Answers

Answer:

It is D

Explanation:

I just did the same one and the answer was D.

The correct answer is D) yearly flooding the Nile.

Egypt’s Black Land was caused by yearly flooding the Nile.

The black land for Ancient Egyptians was the banks of the Nile River that crossed Egypt. With the flooding of the river that could be prevented by the Egyptians, the black land meant fertile soil, good tp grow crops that benefited so much the people of Egypt. As most of the Egyptian territory was desert, Egyptians had to be careful of growing good crops to feed their families and trade the excedents with other nations,

Tobacco production in Virginia: a. benefited from the endorsement of King James I. b. enriched an emerging class of planters and certain members of the colonial government. c. was under the control of two planters, Walter Raleigh and the Earl of Kent. d. declined after its original success, as Europeans learned the dangers of smoking. e. resulted in more unified settlements, thanks to tobacco’s propensity to grow only in certain areas of Virginia.

Answers

Final answer:

Despite King James I's negative views on tobacco, its production enriched an emerging class of planters in Virginia and was critical to the colony's economic viability. John Rolfe's introduction of a sweeter tobacco variety and policies like the 'headright policy' helped stabilize and grow the settlements. The question regarding Walter Raleigh and the Earl of Kent is inaccurate, as it was John Rolfe who pioneered the tobacco industry in Virginia.

Explanation:

The production of tobacco was pivotal to the early success and stability of the Virginia colony. While King James I of England was personally opposed to tobacco, labeling it a "noxious weed," its popularity in Europe ensured the crop's value and profitability. The Virginia Company greatly benefited from tobacco cultivation as a cash crop, particularly after John Rolfe introduced a sweeter variety from the Caribbean, which was more appealing to European consumers.

Despite King James I's disapproval, the economic success attributed to tobacco did not decline due to health concerns during this period. Instead, the booming tobacco industry enriched a nascent class of planters and was an integral part of the colonial economy, which included the creation of a second tobacco colony, Maryland, by the Calvert family for providing a refuge for English Catholics.

Tobacco cultivation required significant labor, leading to the institution of the "headright policy," which further promoted colonization by granting land to settlers. Therefore, while tobacco was met with some royal criticism, its cultivation and economics led to a more permanent and economically stable Virginia settlement.

which policy did british authorties use to control the indian people after colonizing their territory
A. deporting millions of Indians to prison colonies in the south pacific.
B. Replacing the Indian government with a bureaucracy controlled by the British.
C. Forcing Muslim religious leaders to convince their followers to accept British rule.
D. Banning Indians from raising, selling, or eating cows and pigs.

Answers

Answer:

B. Replacing the Indian government with a bureaucracy controlled by the British.

Explanation:

The British established their own administrative order in India, with the top British officials at the head of it. Nevertheless, they kept local ruling structures in place; state princes or maharajas were allowed to stay in power and rule the business of their provinces while submitting to British central authority.

Other Questions
The bases of one of the strands of DNA in a region where DNA replication begins are shown here. What is the sequence of the primer that is synthesized complementary to the bases in bold? (Indicate the 5' and 3' ends of the sequence.) 5' AGGCCTCGAATTCGTATAGCTTTCAGAAA 3' what is 3.149 rounded to the nearest hundredth What did the Gestapo and SS do? What is different about the number of course options kids get in virtual schools compared to typical schools? I don't know how to solve this: In a pair of complementary angles, one angle measures 18* less than three times the other angle. Find the measure of each angle. Explainthe benefits a recursive algorithm can provide. Usean example from a process in your organization or with which you are familiar. The square of the product of 4 and a number is the sum of the number and 15 Deshawn fuels 2 yachts and 6 barges. Each boat gets 126 gallons of fuel. To find out how much fuel he needs for all boats, deshawn first finds the number of boats, then he uses an algorithm to multiply. Which are the three partial products deshawn could add to find the final product? a valueable preserved biological specimen is weighed by suspeding it from a spring scale. it weighs 0.45 N when it is suspendedin air and 0.081 N when it is suspended in a bottle of alchol what is its dencity? Mantle convection is a process of that creates circular currents in the asthenosphere. As a result, the plates slowly move. Which of the following statements about DNA structure is true? View Available Hint(s) Which of the following statements about DNA structure is true? The nucleic acid strands in a DNA molecule are oriented antiparallel to each other, meaning they run in opposite directions. Hydrogen bonds formed between the sugarphosphate backbones of the two DNA chains help to stabilize DNA structure. Nucleic acids are formed through phosphodiester bonds that link nucleosides together. The pentose sugar in DNA is ribose. You have been assigned to make a recommendation about whether to build a factory manufacturing facility in Arkansas or New Jersey. Average production is estimated at 60,000 units per year. Estimations for cost factors were observed by obtaining cost data over the past year. Fixed costs including the financing of building and equipment, property taxes and insurance as well as overhead staff. Variable costs include repair product development, direct labor, shipping in and out. Our analysis indicated the following costs: Arkansas New Jersey Fixed $3,753,000 $2,221,000 Variable $52.73 $74.99 The difference in cost for production between New Jersey and Arkansas when manufacturing 75000 units is "Which of the following assumptions means that money is the common denominator of economic activity and provides an appropriate basis for accounting measurement and analysis?a. Monetary unit.b. Periodicity.c..Economic entity.d. Going concern." Horton Co. was organized on January 2, 2014, with 500,000 authorized shares of $10 par value common stock. During 2014, Horton had the following capital transactions: January 5-issued 375,000 shares at $14 per share. July 27-purchased 25,000 shares at $11 per share. November 25-sold 18,000 shares of treasury stock at $13 per share. Horton used the cost method to record the purchase of the treasury shares. What would be the balance in the Paid-in Capital from Treasury Stock account at December 31, 2014? Layla works during her meeting to pull together the ideas of her committee members into a coherent whole. Layla is performing a ___________ role.a.Maintenanceb.Relationship-orientedc.Taskd.Social The National Honor Society is an example of a CTSO.True or False? Mrs. Walters is enrolled in her states Medicaid program in addition to Medicare. What should she be aware of when considering enrollment in a Medicare Advantage plan? Of the 64 possible nucleotide codon triplets, how many specify polypeptide chain termination?a. 61b. 1c. 2d. 3e. 64 How to do this and please give me examples pleaseeee ASAP A stack of thylakoids are known as a. Thylakoid discs b. Grama c. thylakoid lumen d. Stroma