Which sentence uses punctuation and capitalization correctly? A. The train traveled through Washington, Oregon, and California. B. The Train traveled through Washington, Oregon, and California. C. The train traveled through washington, oregon, and california.

Answers

Answer 1
A is the answer and its definitely not B or C
Answer 2

the answer is A. hope i helped


Related Questions

Can you provide me with synonyms for the word "possibility/possibilities"?
Brainliest answer goes to the set I'll use!

Answers

Some synonyms for possibility are prospect, opportunity, hope, and circumstance. Some synonyms for possibilities are prospects, capabilities, and hopes. Hope this helps.

Synonyms for "possibility" include "chance," "opportunity," and "prospect," all of which refer to a potential outcome or situation that might occur, with subtle differences in usage and context.

Synonyms for the word "possibility" include chance, opportunity, and prospect. Each of these terms carries a similar meaning, connoting a potential outcome or a situation that might occur. Chance emphasizes the element of luck or randomness in the potentiality of an event.

Opportunity often implies a favorable situation or a set of circumstances that makes it possible to do something. Meanwhile, prospect usually refers to the possibility of some future event occurring, and is often used in a business or forecasting context. These synonyms allow for variation in expressing the concept of possibility while maintaining the core meaning.

Determine if the equation y = 3(3.4)x represents exponential growth or decay. ...?

Answers

Final answer:

The equation y = 3(3.4)x exhibits exponential growth because the base (3.4) is greater than 1. Thus, as x increases, the value of y also increases.

Explanation:

The equation given, y = 3(3.4)x, is an example of an exponential growth equation. In exponential equations, we typically find that y equals some number (the base) raised to the power of x. If the base is greater than one, as it is in this equation (i.e., 3.4), then we are dealing with exponential growth. In contrast, if the base is between 0 and 1, we are dealing with exponential decay. In this equation, as x increases, the value of y will also increase, signifying growth.

Learn more about Exponential Growth here:

https://brainly.com/question/12490064

#SPJ12

Which words or terms would best be added to a brainstorm list of the positive effects of volunteering in a local community? Check all that apply.

satisfaction
achievement
physical health
conflict
resentment
new friends

Answers

satisfaction

achievement

physical health

new friends

Answer:

satisfaction achievement physical health new friends

Explanation:

By helping others, you help yourself. In the modern world with our extremely busy lives, we rarely find time to think about others and volunteer in any of the thousands of causes in our city, state, country or even the world. However, the benefits of volunteering are huge for you, your family, and your community. The right project can help you find friends, reach out to whoever you need, learn new skills, and even advance your career. Volunteering can also help protect your physical and mental health, among many other benefits.

Based on this sentence from the first paragraph, why does Hamilton think it is important for the United States to be successful?

It has been frequently remarked that it seems to have been reserved to the people of this country, by their conduct and example, to decide the important question, whether societies of men are really capable or not of establishing good government from reflection and choice, or whether they are forever destined to depend for their political constitutions on accident and force.

Its success will give more power to other rulers around the world.
Without the United States, governments around the world will fall apart.
Its success will show that it is possible for people to make their own government.
Without the United States, people will have no reason to behave civilly.

Answers

The answer will be ( Its success will show that it is possible for people to make their own government.) hope i helped

Based on this sentence, Hamilton thinks it is important for the United States to be successful because C- its success will show that it is possible for people to make their own government.

Within this excerpt, Hamilton expresses two alternatives society faces: either it establishes a government on its own or it relies upon external factors. This is the dychotomy that will be resolved according to the US performance.  

Which of the following is characteristic of Anne Bradstreet's writing style? A. simple language B. elaborate vocabulary C. figurative language D. complex sentences

Answers

A. Simple language

She uses the so called plain style.

Answer:

A. simple language

Explanation:

Anne Bradstreet was a prominent poet of North America during the early years of the colonies. She was also the first writer in the colonies to be published. Bradstreet wrote about her role in life, especially as a mother and wife. She also wrote about her religious views, the struggles she experienced and the love she had for her family and her husband. She wrote in simple, accessible language.

Read the passage from How to Live Twenty-Four Hours a Day.

"What? I am to cultivate my mind in the street, on the platform, in the train, and in the crowded street again?” Precisely. Nothing simpler!

Which phrase most helps the reader conclude that the author’s purpose is to persuade?

“cultivate my mind”
“on the platform”
“crowded street”
“nothing simpler”

Answers

Answer: “nothing simpler.”

In this excerpt, the author is clearly trying to persuade the audience. We know this because of his use of the phrase "nothing simpler." By highlighting the simplicity of his argument, he hopes that the audience would be persuaded to see the argument as a simple one as well, and therefore, be convinced of his position.

The phrase that helps the reader conclude that the author’s purpose is to persuade is “nothing simpler”

What is a phrase?

A phrase is known to be a composition of words that has two or more linked words that do not make a clause or does not make sense.

Note that the use of the phrase “nothing simpler” can best  helps the reader to bring to conclusion the author’s purpose in persuading the reader.

Learn more about phrase from

https://brainly.com/question/7744384

#SPJ5

What purpose do the commas serve in the following sentence? Danielle goes to dance class on Tuesday, Thursday, and Saturday.

Answers

To separate the days she goes to class. The commas are there to show that she goes to class on each of those days separately.

hope that helps:)) 
they are there because if u were to write a sentence on this u would have too many ands in the sentence so thats why they made up commas and they do  what the word 'and' does hope this helped

in a christmas carol Why does Scrooge find his "Christmas Past" to be such torture

Answers

Because he hates who he was before, and hates looking back and seeing the people he loved.

He sees Belle talking about him behind his back and she seems to not care about him. He also sees Fan his younger sister and Fezziwig, his old boss. These are all minor FOIL characters

A postulate is not __________.

A.
proven true by undefined terms and definitions
B.
accepted as true without proof
C.
used to justify conclusions
D.
used to describe fundamental relationships between points, lines, and planes

Answers

In geometry, a postulate is accepted as true without proof and is not proven true by definitions. It is used to justify conclusions and establish fundamental geometric principles.

A postulate, in the context of geometry, is accepted as true without proof (Option B). It is a fundamental statement or proposition that is assumed to be true, and from which other statements are logically derived. Postulates are the building blocks of a geometric theory and are used to establish theorems and other mathematical truths. Importantly, a postulate is not proven true by undefined terms and definitions, making Option A incorrect. Postulates are indeed used to justify conclusions and to describe fundamental relationships between points, lines, and planes (Options C and D), making these choices incorrect as answers to the question which seeks what a postulate is not.

Which of the following scenarios best fits the description of magical realism?

A.A small band of forest animals fight an evil warlock who threatens to destroy their homes.
B.A young man journeys to a mystical land in order to break the spell on the king's beautiful daughter.
C.A good witch helps a young girl find her way out of an enchanted land so she can go home again.
D.A young boy becomes friends with a werewolf who helps him stand up to the bullies at school.

Answers

Based on the given scenarios above, that one that best fits the description of magical realism would be this: A young boy becomes friends with a werewolf who helps him stand up to the bullies at school. When we say magical realism, this refers to conventions of fables, myths, and allegory. Hope this answer helps.

Can someone help me please?
In the sentence below identify the main verb.

In addition, the research indicated that girls were more likely to get hurt and twice as lucky to have a concussion.
a. were
b. have
c. get
d. indicated

Answers

I am pretty sure that the main word in the sentence : In addition, the research indicated that girls were more likely to get hurt and twice as lucky to have a concussion. In order to solve the task you should determine the main action! verb. Hope it helps!

true or false? writers might choose to use outlines in sentence or paragraph form when they want to include specific examples or reasons in their outlines.

Answers

It would be, True. Hope that helps you out!
I believe the answer is True :D

What are your methods for brainstorming before writing a paper?

Answers

what I do is write important details or information you think is necessary in bullet points and eventually you use most of that information to turn that into a paper. That is the method I do
Actually, before writing a paper, i always asked :
"what is the problem"

After you figure out a problem that you wanted to explore, then you could work your paper out based on the cause of the problem, why it happen, and the possible solutions of the problem

hope this helps

My mistress’ eyes are nothing like the sun,
Coral is far more red than her lips’ red;
If snow be white, why then her breasts are dun;
If hairs be wires, black wires grow on her head.

In the first lines from Sonnet 130 by William Shakespeare, what is the rhyme scheme?

cdcd

ghgh

efef

abab

Answers

The rhyme scheme is 

abab

Answer:

In the first lines from Sonnet 130 by William Shakespeare, the rhyme scheme is abab.

Explanation:

The sonnets written by Shakespeare have three quatrains and a couplet. The rhyme scheme of the sonnet is abab cdcd efef gg. The sonnets have been written in iambic pentameter. After the third quatrain, a volta appears which shows a turn or change of thought in the sonnet.

Which sentence shows correct subject-verb agreement? A. Anyone interested in weather patterns calls the show and asks a question. B. Anyone interested in weather patterns call the show and ask a question

Answers

The answer is A) Anyone interested in weather patterns calls the show and asks a question.

Answer:

The sentence that shows correct subject-verb agreement is sentence A.

Explanation:

Subject-verb agreement means that the subject and the verb must agree in number. That is, both need to be singular or both need to be plural. The indefinite pronouns (anyone, everyone, someone, no one, nobody) are always singular, so they require singular verbs. In the sentence above, both call and ask are singular, making A the right choice.

choose the model correctly shows 2x.3x

Answers

Can you provide a better description of what you want answered?

What is 35.78 rounded to the nerest scond?

Answers

Example 5 = .50 = .500 = .5000 When rounding to the nearest second, you have to check the numbers that come after the decimal (5.89) to see if you should round up or down. If the number in the tenths column is 5 or more (i.e 4.5, 3.8, 4.9, 1.7, 2.6), you have to round up. If the number in the tenths column is less than five (i.e 1.2, 9.3, 7.4 ect.), you have to round down. Example: 57.28 = 57.00 Get it?

Two brothers were watching a horror film on video late one night. One brother dozed off and dreamed that he was being chased by the crazy man from the movie, who was trying to kill him. In the dream, he hid in a cupboard. There was no sound except his heart pounding, and he had no idea where his crazed captor was. He was terrified! At that moment, the video finished, and his brother put his hand on the shoulder of his sleeping sibling to wake him. The shock at that tense moment was enough that the sleeping brother suffered a massive heart attack and died instantly. True or false?

Answers

is there any other information. It is possible that he did but there isnt enough information to know.
Final answer:

The statement that the sleeping brother suffered a heart attack and died instantly when his brother woke him up is false. While a shock or fright can theoretically lead to a heart attack, it is extremely rare and unlikely to cause immediate death.

Explanation:

The statement that the sleeping brother suffered a massive heart attack and died instantly when his brother woke him up is false. While it is possible for a sudden shock or fright to cause a heart attack, it is extremely rare. In most cases, the body has natural defense mechanisms that protect against such events. It is more likely that the sleeping brother had an existing heart condition or health issue that contributed to his death.



It's important to note that scary dreams or sudden awakenings do not typically lead to immediate death. While the shock and fear might cause temporary distress, the body usually recovers quickly.



If you have concerns about your heart health or have experienced unusual symptoms, it's best to consult with a medical professional for a proper evaluation and diagnosis.

the crucible how abigail influences the proceedings

Answers

We can't help you didn't add enough information

Final answer:

Abigail Williams is a key figure in 'The Crucible,' driving the Salem witch trials with her accusations and dramatic displays of possession, which lead to widespread hysteria and the execution of innocent people.

Explanation:

In Arthur Miller's play The Crucible, Abigail Williams plays a significant role in influencing the proceedings of the Salem witch trials. As one of the first girls in Salem Village to display signs of being afflicted by witchcraft, Abigail quickly takes on a leadership role, accusing others of practicing witchcraft and dramatically demonstrating signs of possession in the courtroom. Her actions and accusations greatly drive the mass hysteria, leading to the imprisonment and execution of many innocent people. Abigail, driven by personal vendettas and a desire for power, manipulates the Puritanical legal system and orchestrates a climate of fear where spectral evidence is taken as truth without question, thus perpetuating the Salem witch trials.

On the 3d of February last I officially laid before you the extraordinary announcement of the Imperial German Government that on and after the 1st day of February it was its purpose to put aside all restraints of law or of humanity and use its submarines to sink every vessel that sought to approach either the ports of Great Britain and Ireland or the western coasts of Europe or any of the ports controlled by the enemies of Germany within the Mediterranean.

It is a war against all nations. American ships have been sunk, American lives taken, in ways which it has stirred us very deeply to learn of, but the ships and people of other neutral and friendly nations have been sunk and overwhelmed in the waters in the same way. There has been no discrimination. The challenge is to all mankind. Each nation must decide for itself how it will meet it. The choice we make for ourselves must be made with a moderation of counsel and a temperateness of judgment befitting our character and our motives as a nation. We must put excited feelings away. Our motive will not be revenge or the victorious assertion of the physical might of the nation, but only the vindication of right, of human right, of which we are only a single champion.


Which best states if the speech is effective or ineffective?

ineffective because it still involves the U.S. in a World War

effective because President Wilson outlines the emotional reasons for entering the war

effective because President Wilson is a good, strong speaker

ineffective because the speech made Congress angry

Answers

The correct answer is B)effective because President Wilson outlines the emotional reasons for entering the war.

Explanation:

The excerpt talks about the speech that the president Wilson had with the Congress, arguing with them about the decision that Germany took to sink all vessels that came and he also outlined the reasons why America should join the war. For the President Wilson was necessary to join the war on the grounds that they needed to fight for people's human rights. and he succeeded in outlining the reasons why America should join the war.

Answer:

B) effective because President Wilson outlines the emotional reasons for entering the war.

Explanation:

This section rotates around feelings and how everybody on this planet is the equivalent humanity. "But why did we win? Because others helped us; because of others related to us and wanted us to have the freedom we possess now.   So what reason do we have to not repay the ones who helped us when we needed it the most?"

Basically, Wilson is reminding everybody that we are all the equal, regardless of where we live or what we will be we are the equivalent. What's more, that implies that we battle with one another, for one another.

What does this scene tell us about the speaker's feelings about America

Answers

_________________________what scene?

Which of these singular nouns has an irregular plural form?

A. Foot
B. House
C. Chimney
D. Bear

Answers

The correct answer is A) Foot. The irregular plural form of this noun is feet. Hope this helps.

Which can be used as the subject of a sentence?

a gerund
a participle
an adjective
an adverb

Answers

A Gerund is a verb that functions as a noun, so your answer would be GERUND. Hope this helps!

Answer:

A gerund

Explanation:

A gerund is a type of verbal that acts as a noun in a sentence, thus, it can also act as a subject. This verbal is formed with the root of a verb + ing, which it's the present participle form. For example: Think + ing = Thinking. Here are some examples:

Skydiving is not that easy.

The gerund Skydiving acts as a noun: It refers to the sport or activity of jumping from an aircraft and performing acrobatic maneuvers in the air under free fall before landing by parachute. And it is also the subject as is the main "thing" being described.

Swimming is a great cardiovascular exercise.

The gerund Swimming acts as a noun as it refers to the skill of swimming or the sport of swimming itself, and it's the subject as well as it is what is being dealt with in the sentence.

How does presenting this story as a poem rather than a myth affect the message? a. The poem is clearer and easier to understand than the myth. b. The myth presents Persephone more sympathetically than the poem. c. The poem allows the reader to empathize with Persephone more than the myth does. d. It doesn’t make any difference to the message at all.

Answers

Thank you for posting your question here at brainly. I hope the answer will help you. Feel free to ask more questions.

I think the answer is c. The poem allows the reader to empathize with Persephone more than the myth does. 

I believe the answer is: c. The poem allows the reader to empathize with Persephone more than the myth does

A myth indicates that there is no proof that the event ever occurred, which make people tend to believe that the story is a work of fiction. Presenting it as poem would more likely to make the people believe that the story is real, which make it easier for them to empathize with the character.

can you answer this riddle? at the back of every igloo, and the middle of the moon, always running around in loops You'll find me,if you look inside the room. What am i?

Answers

The answer is "oo"?
iglOO, mOOn, lOOps, rOOm
i think its oo
igl-oo
m-oo-n
l-oo-ps
r-oo-m

Read the excerpt from Roosevelt's Executive Order No. 9066. I hereby further authorize and direct all Executive Departments, independent establishments and other Federal Agencies, to assist the Secretary of War or the said Military Commanders in carrying out this Executive Order, including the furnishing of medical aid, hospitalization, food, clothing, transportation, use of land, shelter, and other supplies, equipment, utilities, facilities, and services. Which statement best describes President Roosevelt’s use of vocabulary in the excerpt?

Answers

The excerpt from Roosevelt's Executive Order No. 9066 uses objective language to emphasize his authority and garner support in the execution of the order. He used exemplifications to convince the listeners of what he can do for the military forces

In the excerpt, President Roosevelt’s use of vocabulary in order to emphasize his authority and garner support in the execution of the order.

Who is Roosevelt?

Franklin Roosevelt was an American politician and the 32nd president of the United States. In the excerpt from Roosevelt's Executive Order No. 9066, it can be noted that he uses objective language to emphasize his authority and garner support in the execution of the order.

Also, it can be deduced that he used exemplifications to convince the listeners of what he can do for the military forces. This was vital to illustrate the theme in the work.

Learn more about Roosevelt on:

https://brainly.com/question/832342

A system in law enforcement that includes different stages of criminal proceedings [courts, police, lawyers etc.]

A. Criminal justice
B. Forensics
C. Paralegal studies
D. Communications

Answers

The answer is A. Criminal Justice

Answer:

Criminal Justice

Explanation:

Just got it correct on the test.

In Neoplatonism, what are two important elements?

All humans have the Intelligence of the One.
The Soul can be reunited with the One.
The past is the One’s eternal memory.
All existence comes from the One.

Answers

the past is the one's eternal memory

Answer:

2 and 4

Explanation:

On odyssey

Name four of the eight specific changes in focus which indicate that the writer must begin a new paragraph.

Answers

When you begin a new idea or point. New ideas should always start in new paragraphs. If you have an extended idea that spans multiple paragraphs, each new point within that idea should have its own paragraph.
 
To contrast information or ideas. Separate paragraphs can serve to contrast sides in a debate, different points in an argument, or any other difference.
   
When your readers need a pause. Breaks in paragraphs function as a short "break" for your readers—adding these in will help your writing more readable. You would create a break if the paragraph becomes too long or the material is complex.
 
When you are ending your introduction or starting your conclusion. Your introductory and concluding material should always be in a new paragraph. Many introductions and conclusions have multiple paragraphs depending on their content, length, and the writer's purpose.

The four of the eight specific changes in focus which indicate that the writer must begin a new paragraph:

Once you start a modern thought or point. Modern thoughts ought to continuously start in unused sections. On the off chance that you've got an amplified thought that ranges different sections, each unused point inside that thought ought to have its claim paragraph. To differentiate data or thoughts. Isolated sections can serve to differentiate sides in a wrangle about, distinctive focuses in an contention, or any other difference. When your perusers require a delay. Breaks in sections work as a brief "break" for your readers—adding these in will offer assistance your composing more lucid. You'd make a break in case the section gets to be as well long or the fabric is complex. When you're finishing your presentation or beginning your conclusion. Your initial and concluding fabric ought to continuously be in an unused section.

Know more :

https://brainly.com/question/1334265?referrer=searchResults

When is there a flurry of activity in your school.
Please help

Answers

I'm not sure if this is correct, but my school works up into a frenzy when there are rallies taking place.

Answer:

The answer is explained below.

Explanation:

Flurry activity is a term used to describe a sudden commotion or a burst of activity. For instance, at a school, this flurry activity can be seen when students are leaving their rooms in order to go home or change to another location inside the same building. There are some other events, such as conferences, where this type of activity can be seen.

Other Questions
30 POINTS DONT ANSWER IF YOU DONT KNOW THE ANSWER FOR SUREIn the gene TATTCATTGTTATGATTTATTCG, CATTGTTA encodes for pepsin, a digestive enzyme. The rest of the sequence doesnt code for any protein. Which sequence contains a mutation that will affect the formation of pepsin?A. TATTCATTCATTATGATTTATTCGB. TATTCATTGTTATGACTTTATTCGC. TATTCATTGTTATGATTTATTGGCGD. TATTCATTGTTATGATATTCGE. TGCATTCATTGTTATGATTTATTCG A box is given a push so that it slides across the floor. How far will it go, given that the coefficient of kinetic friction is 0.15 and the push imparts an initial speed of 3.5m/s? When was the u.s. constitution written? what is bulimia? can someone explain it to me. Which items describe people's interactions with their environment?Technology does not affect the earth's environment.People adapt to their environment.People adapt their environment.Population growth and the environment are unrelated.Changes to the earth's environment rarely matter.Changes to the earth's environment can be harmful.Changes to the earth's environment can be beneficial. Choose the sentence that has the correct form of the verb ser. Ellas es muy inteligentes. Clara no es cubana. Nosotros son amigos. Yo eres serio. A rate that describes how much smaller or larger the scale drawing is than the real object Write 6% as a decimal. There are two main functions for polysaccharides in living things. Discuss these two functions, and how the structures of polysaccharide molecules support these functions.Now I know that all polysaccharides are made up of the same monomer, glucose. Is this question essentially asking me the use of glucose throughout different organisms? Which of the following represents the graph of f(x) = 2x + 2? algebra help?write a function rule for the area of a triangle with a base of 3 cm greater than 5 times its height. what is the area of a triangle when its height is 6 cm? 6 letter word: a stack of thylakoids in a chloroplast Explain how the powers of the Supreme Court and federal law were extended by significant court cases during the period Algae uses all the energy in sunlight to perform photosynthesis.true or false what is 2 1/2 divided by 1/3 The ratio of the number of red marbles to the number of green marbles in a bag is 2:3. The ratio of the number of green marble to the number of blue marbles is 9:4 There are 76 marbles in the bag. a) Find the number of red marbles in the bag.b) Find the number of green marbles in the bag.C) Find the number of blue marbles in the bag///I already did a and b can you guys help me with c/// Endorphins can help reduce stress and are natural painkillers.TrueFalsei think its true? What was the purpose of having a cabinet?to use people outside of politics for adviceto assist the president in making decisionsto tell the president what to do The price of an item has been reduced by 70% . The original price was $60 . What is the price of the item now? Healthy bones, teeth, and muscles require the mineral?CarbonSodiumCalciumCadmiumIron