While carbohydrates and proteins are necessary for a healthy diet, fats should be avoided whenever possible.
a. True
b. False

Answers

Answer 1
false
fat should be included in a healthy balanced diet

but trans fat should be avoided
Answer 2

Answer:

false

Explanation:

as long as you don't have too much fat you are fine


Related Questions

How do animal cells, Plant cells, freshwater protists, and
bacteriaeach deal with the problem of osmosis ?

Answers

Answer:

Plant cells deal with osmosis by being enclosed in a cell wall.

Animal cells use active transport systems to deal with the problem of osmosis.

Fresh water protists have contractile vacuoles to deal with osmosis.

Many bacteria have cell wall to protect them from osmosis.

Explanation:

Plant cells have a rigid cell wall. If a plant cell is places in a place where the conditions are hypotonic, then the cell will tale up water by osmosis but the cell wall will prevent it from bursting. This condition is termed as the cell being 'turgid'.

As animal cells do not have the rigid cell wall, they use the mechanism of active transport system to stop the cell from bursting during osmosis. In this process, ions are moved out of the cell so that the pressure in the cell due to osmosis can be reduced.

Fresh water protists have a structure present in them called as the contractile vacuole. The contractile vacuole has the capability to remove any excess water from the cell as well storing water if there is not enough water.

Bacteria have peptidoglycan cell walls to prevent osmosis.

Final answer:

Osmosis is managed differently in animal cells, plant cells, freshwater protists, and bacteria; animal cells use osmoregulation, plant cells use a cell wall and vacuoles, protists use contractile vacuoles, and bacteria use a semi-permeable membrane.

Explanation:

Osmosis is the process by which water molecules move from an area of lower solute concentration to an area of higher solute concentration. Animal cells, plant cells, freshwater protists, and bacteria each have their own ways of dealing with osmosis.

Animal cells are dependent on osmoregulation which involves regulation of salt concentrations and water balance. This process is critical to maintaining homeostasis within the cell.

Plant cells have a cell wall which provides additional protection against overhydration. They also have central vacuoles that can store water, allowing plants to maintain the appropriate levels of hydration.

Protists, specifically freshwater forms, have specialized organelles called contractile vacuoles which pump excess water out to prevent the cell from bursting due to osmotic pressure.

Bacteria, meanwhile, use a semi-permeable membrane to control the flow of water into and out of the cell. The membrane allows the bacteria to maintain the correct balance of water and nutrients.

Learn more about osmosis here:

https://brainly.com/question/31028904

#SPJ3

Antibiotics can be used to treat some viral infections.
a. True
b. False

Answers

Answer: False

Explanation:

Antibiotics cannot be used for the treatment of viral infections. Antibiotics can be used to treat bacterial infections only.

Antibiotics cannot be used to treat viral infections as it will not kill virus. Common illness that is caused by the bacteria like urinary tract infection, pneumonia, can be treated by antibiotics.

Antibiotics act by interfering the replication, transcription and translational machinery which could be either enzymes or complexes used during the processes. Since, viruses do not carry out these processes therefore antibiotics do not work on viral infections.

Hence, the given statement is false.

Which of the following processes require the presence of 02 in order to occur?
a. Glycolysis
b. Glycogenesis
c. Fermentation
d. Citric acid cycle
e. More than one is correct

Answers

Answer:

d. Citric acid cycle

Explanation:

The only process in the list that requires the presence of O2 in order to occur is the Citric acid cycle or Krebs cycle. This cycle is part of the aerobic cellular respiration and it occurs only when O2 is available. If there is no oxygen, an alternative process that could happen is fermentation, but this is only carried by some microorganisms and some cells such as muscle cells.  

In fact, oxygen is not needed by citric acid cycle but it is by the next step: the electron transport chain. In this chain, oxygen is the final acceptor of electrons, and without oxygen, the Krebs cycle doesn't occur because the final electron transport chain can't be done.

The molecule that carries amino acids to the ribosome and binds to a mRNA ensuring a proper amino acid sequence in the resulting polypeptide is a(n):
a. tRNA
b. mRNA
c. rRNA
d. sRNA

Answers

Answer: a. tRNA

Explanation: The transference RNA is a nucleic acid that participates of the protein synthesis. tRNA is a small RNA with folding as a trefoil. The tRNA has a site where aminoacid is loaded and a anticodon site that is complementary to the codon in the mRNA, ensuring the proper aminoacid sequence in the resulting polypeptide.

Which of the following statements does not highlight a difference in eukaryotic and prokaryotic translation?
a. the first methionine in eukaryotic translation contains a formyl group
b. in eukaryotes, mRNA is made in the nucleus but translated in the cytoplasm
c. prokaryotes often couple transcription and translation, forming a polysome
d. eukaryotic mRNA does not have Shine-Dalgarno sequence, but prokaryotic mRNA does
e. many eukaryotic proteins are chemically modified after translation, which is a much rarer phenomenon in prokaryotes

Answers

Answer:

The correct answer is a and e.

Explanation:

Translation is the process by which mRNA is translated into proteins. It occurs in both prokaryotes and eukaryotes. In prokaryotes, transcription and translation occur simultaneously while in eukaryotes translation is a separate process occurs in the cytoplasm after transcription.

The first amino acid incorporated in the polypeptide is methionine in eukaryotes and formyl methionine in prokaryotes. After protein synthesis in both eukaryotes in prokaryotes, post-translational takes place like glycosylation, acetylation, alkylation, etc.  

Post translation is important for proteins to provide them heterogeneity and functional activity. Thus, the correct answer is a. the first methionine in eukaryotic translation contains a formyl group and e. many eukaryotic proteins are chemically modified after translation, which is a much rarer phenomenon in prokaryotes.

Explain how the ozone layer forms? And the consequences of the destruction of the ozon layer.

Answers

Answer:

Explanation:

The atmospheric oxygen first combines with UV light of the sun and splits to form single atoms of oxygen.

- These single atom oxygen combines with atmospheric oxygen to form O3 molecules i.e. Ozone

O2 + UV -> O + O

O2 +O ->  O3 (Ozone)

Overall reaction: 3O2 ---sunlight----->  2O3

This forms a thin layer around earth's surface and protects the earth from harmful radiations from the sun.

Consequence of destruction of ozone layer-

Ozone layer is rapidly being depleted by the presence of pollutants in the atmosphere.

As a result there will be less protection from the harmful UV light of the sun.

UVB causes diseases like skin cancer and development of malignant meloma. In addition, UVB has been associated  to the formation of cataracts, a clouding of the eye’s lens.

Basically elemental oxygen is found in the form of a diatomic molecule.When high-energy ultraviolet rays (UV) strikes diatomic oxygen molecule (O2), they split the molecule into two single oxygen atoms, known as atomic oxygen. A freed oxygen atom then combines with another oxygen molecule to form a molecule of ozone (O3).O2 + UV » O + OO2 + O » O3Like this the ozone layer is formed.

Ozone performs an essential function by absorbing harmful radiations from the Sun. This prevents the harmful UV rays from reaching the surface of the Earth where they may damage many life forms.Recently, the ozone layer was getting depleted due to various man-made compounds like CFCs (chlorofluorocarbons).When these compounds reached the ozone layer, they react with ozone molecules.It results in the reduction of the ozone layer.The consequences of the destruction of the ozone layer is devastating.UV rays could find its ways to reach the surface of the earth.Not only the temperature of the earth will increase for this, but it will also cause many diseases like skin diseases and also cancer.

Hope you could get an idea from here.

Doubt clarification - use comment section.

Explain the function of receptors and their location(s) in the cell.

Answers

Answer:

Function: Cell signalling; Location: Cell membranes

Explanation:

Receptors are usually trans-membrane proteins located on cell membranes. Their extracellular part transmits chemical signals from outside the cell into the intracellular where a response is induced.

Plant molecular biologists have recently discovered genes that are responsible for controlling cell division in tomatoes. Why would such a discovery be important to producers of other kinds of fruits and vegetables ?

Answers

They can use those recently discovered genes and insert them in another species (fruits and vegetables) using genetic ingeniery technics so they can speed up the cell division on them, and accordingly increase the production.

Why does allopatric speciation occur more often in animals than sympatric speciation?

Answers

Answer:

Allopatric speciation happens when populations become isolated and the gene flow between populations stops. Is difficult for a population of animals to stop gene flow among the individuals of a population that lives in the same area because animals are dynamic and can actively look for male/females to reproduce.

Homeotic genes
a. encode transcription factors that control the expression of genes responsible for specific anatomical structures.
b. are found only in Drosophila and other arthropods.
c. are the only genes that contain the homeobox domain.
d. encode proteins that form anatomical structures in the fly.

Answers

Answer: a. encode transcription factors that control the expression of genes

Explanation:

Homeotic Genes - They encode transcription factors that determine the location at which specific structures develop. They give organs identity. Homeotic genes act as regulators of development and some mutations found in flies were instrumental in unraveling the macroevolution related mysteries.

Mutations in homeotic genes are often fatal in the early stages of development, however viable mutant flies with strange aberrations have been found, such as the discovery of Antennapedia mutants, in which paws are formed in place of antennae. Homeotic genes regulate the development of specific embryonic segments and are fundamental, among other functions, in determining the anteroposterior axis of metazoans. When we compare flies and humans, homeotic genes resemble both their nucleotide sequence and their relative position on chromosomes.

Which of the following is important for gel electrophoresis to work?
a. negatively charged nucleic acids to migrate through the gel
b. ethidium bromide to provide a means to visualize the DNA in the gel
c. Agarose or polyacrylamide to separate the DNA based on size
d. known molecular weight standards
e. all of the above are important for gel electrophoresis

Answers

Answer:

e. all of the above are important for gel electrophoresis

Explanation:

Gel electrophoresis is the process of separating nucleic acids like DNA on the basis of their molecular size.

DNA is negatively charged due to its phosphate component so it is loaded at the negative pole( cathode ) and it migrates to the positive pole ( anode ). The fragments separate on the basis of their size. Smaller fragments run faster while heavier ones run slower. Hence, it is also important to load a molecular weight standard so that we can find out the size of the sample bands by matching them with the standard bands size.

Ethidium bromide is a dye commonly used to visualize DNA bands. It is mixed with electrophoresis gel making solution. It intercalates within DNA and fluoresces when exposed to UV light so that the DNA bands are visible. Hence, all of these things are important for gel electrophoresis to work.

The production of urine in the nephron begins at the (i) _____________, which is (ii) _______________.
a. (i) glomerulus, (ii) a network of capillaries
b. (i) Loop of Henle, (ii) a U-shaped tube
c. (i) proximal convulated tubule, (ii) a tube draining the glomerulus
d. (i) distal convulated tubule, (ii) a tube entering the collecting duct

Answers

Answer:

a. (i) glomerulus, (ii) a network of capillaries

Explanation:

A pair of the kidney is the main excretory organ in humans. Each kidney made millions of tiny units called nephrons.

Each nephron has a glomerulus. It is tuft (network) of capillaries surrounded by a cuplike structure called Bowman’s capsule.

The network of blood capillaries consists of afferent and efferent arterioles. As blood flows through the glomerulus, the fluid from the capillaries gets filtered by podocytes, a specialised layer of cells, called filtration membrane. This glomerular filtration begins the urine formation process.

You do a cross between two true-breeding strains of zucchini. One has green fruit end the other has yellow fruit. The Fl plants are ell green, but when these are crossed, the F2 plants consist of 9 green : 7 yellow. Explain this result. What a. were the genotypes of the two parental strains? b. Indicate the phenotypes, with frequencies, of the progeny of a testcross of the Fl plant .

Answers

Answer:

a) GG and gg

b) GG: Gg: gg

1: 2: 1

Phenotype ration

Green : yellow

3:1

Explanation:

As mentioned the two true breeding strains of zucchini were crossed.

True breeding means they must be homozygous for their genotype structure.

Let green fruit allele be represented by "G" and yellow fruit allele be represented by "g"

In first cross all green offspring were produced , thus it is clear that green fruit allele is dominant over yellow color fruit.

a) Genotype of the parents is

GG and gg

GG * gg

Gg, Gg, Gg, Gg

b) F1 cross will be between Gg * Gg

Offspring produced - GG, Gg, Gg, gg

Hence

Genotype ratio

GG: Gg: gg

1: 2: 1

Phenotype ration

Green : yellow

3:1

he wings of birds and butterflies have the same function—they enable the organisms to fly. Which statement can be made about the evolutionary relationship between these organisms?

Answers

Birds and butterflies are very anatomically different, so even if their wings perform the same function, they probably evolved separately. This is called convergent evolution. The bat would be another example that fits in this category in regards to flying.

The primary function of the mitochondrion is the production of ATP. To carry out this function, the mitochondrion must have all of the following except
A) the membrane-bound electron transport chain
B) proton pumps embedded in the inner membrane.
C) enzymes for glycolysis.
D) enzymes for the Krebs cycle.
E) mitochondrial ATP synthase

Answers

Final answer:

The mitochondrion absolutely requires a membrane-bound electron transport chain, proton pumps, Krebs cycle enzymes, and ATP synthase. However, it does not need glycolysis enzymes as glycolysis happens in the cytosol, not in the mitochondrion.

Explanation:

The primary function of the mitochondrion is indeed the production of ATP, and it does so via a process called cellular respiration. Most of the factors listed are absolutely essential for the mitochondrion to carry out this primary function. This includes the membrane-bound electron transport chain (Option A), proton pumps (Option B), enzymes for the Krebs cycle(Option D), and mitochondrial ATP synthase (Option E). However, the enzymes for glycolysis (Option C) are an exception. Glycolysis occurs in the cytosol of a cell, not in the mitochondrion, which is why the mitochondrion does not need to have enzymes for glycolysis to produce ATP.

Learn more about Mitochondrial Function here:

https://brainly.com/question/33904496

#SPJ6

Explain how mutations in the photoreceptor genes result in different vision defects.

Answers

Answer:

The human eye is the prime organ of the body, which associates with the photons of light and allows one to see various things. The unique cells found in retina, which does activity of seeing are cones and rods cells. Rods help to see in dim light vision, while on the other hand, cone cells are unique in recognizing different colors.  

These cells comprise photoreceptor proteins that help in trapping photons at particular wavelength. Mutation in the gene encrypting for these proteins results in permanent or temporary vision issues. The extremity of defects relies upon the degree to which mutation takes place.  

The mutation in rod cells photoreceptor proteins leads to night blindness and retinitis pigmentosa. Retinitis pigmentosa refers to an inherited disorder that takes place because of early loss of rod cell, which destructs retina. On the other hand, night blindness does not mean complete blindness night, however, inadequate tendency to see in low light.  

Identically, the mutation in the cone cell also results in vision issues, known as red color blindness and tritanopia. Tritanopia refers to a kind of color blindness, which originates because of insensitivity of blue receiving protein gene towards blue light. On the other hand, red color blindness refers to insensitivity of red receiving cone cells in captivating long-wavelength photons.  

Choose the sex-linked traits from the choices below. Choose all that apply.
a. Height
b. Hemophilia
c. Duchenes Muscular Dystrophy
d. Cystic Fibrosis
e. Sickle Cell Disease

Answers

a. Height

It's true that if you have tall parents, you might be tall too.

But no proof is a sex-linked trait.

b. Hemophilia

This is a disease related to blood coagulation.

It's recessive and linked to X chromosomes.

c. Duchenne Muscular Dystrophy

This is also a recessive sex-linked disease.

Girls can carry but only affect boys.

d. Cystic Fibrosis

This is also a hereditary disease but not linked to sex chromosomes.

e. Sickle Cell Disease

It's a malformation of blood cells and it can be inherited but not linked to sex chromosomes.

Which of the following statements is most accurate or true?
a. The nearly neutral theory posits that the vast majority of substitutions influence the fitness of individuals in a highly negative manner.
b. the nearly neutral theory posits that the vast majority of mutations influence the fitness of individuals in a highly negative manner.
c. the neutral theory posits that the vast majority of mutations do not influence the fitness of individuals.
d. the neutral theory posits that the vast majority of substitutions do not influence the fitness of individuals.

Answers

Answer:

c. the neutral theory posits that the vast majority of mutations do not influence the fitness of individuals

Explanation:

The neutral theory proposed by Motoo Kimura states that the vast majority of changes at the molecular level (DNA) in a population happens due to genetic drift, not by natural selection, this implies that the mutations are neutral and do not give an advantage to the organisms.  

This means that mutant alleles are preserved due to the randomness of life and not because this alleles give selective advantage over other individuals of the population.

Which of these groups of mammals is defined by having multicusped lower molars and a narrow pelvis?
a. allotheria
b. prototheria
c. theria
d. metatheria
e. eutheria

Answers

Answer:

The correct answer will be option-A.

Explanation:

Allotheria is an extinct species of a mammalian group called marsupials which lived during the Mesozoic era.

The Allotheria can be easily distinguished by the few unique characteristics which were considered of non-placental mammals:

1. Presence of molariform teeth with longitudinal cusps in the lower portion of the mouth

2. Narrow pelvis which indicates that they used to give birth to young marsupials and used to feed them.

Thus, option-A is the correct answer.

A claim put forth by some purveyors of health foods is that vitamins obtained from natural sources are more healthful than those obtained by chemical synthesis. For example, pure L‑ascorbic acid (vitamin C) extracted from rose hips is thought to be healthier than pure L‑ascorbic acid manufactured in a chemical plant. Are the vitamins from the two sources different? Can the body distinguish a vitamin's source?

Answers

Answer:

No, the vitamins from the two sources are not different.

No, the body cannot distinguish a vitamin's source.

Explanation:

Pure L-ascorbic acid extracted from rose hips is identical in every way to pure L-ascorbic acid synthesized in a plant.

The only difference that might distinguish the two is the presence of impurities such as byproducts or solvents used in the process of extraction or synthesis. However, "pure" implies that no such impurities are present.

No, the vitamins from two different sources are not different.

Body cannot distinguish a vitamin source.

Synthetic vitamins  contain a much higher dose of nutrients than found in a normal food serving. Synthetic vitamins are consumed through dietary supplements and fortified foods.Other than this there is no such difference between the two.

What are the vitamins?Vitamins are substances that bodies need to develop and function normally. They include vitamins A, C, D, E, and K and the B vitamins  that are thiamin, riboflavin, niacin, pantothenic acid, biotin, vitamin B6, vitamin B12, and folate/folic acid.Vitamin B and C are water soluble others are fat soluble.

To know more about vitamins here

https://brainly.com/question/24324739

#SPJ2

Energy can be carried by______ but matter cannot

Answers

Mass is
The correct answer I assume

Final answer:

Energy, such as light or heat, can be transferred through electromagnetic radiation, which includes visible light and other forms of energy like radio waves, without carrying matter.

Explanation:

Energy can be carried by electromagnetic radiation, but matter cannot. Unlike matter, energy can be transferred without transferring mass and can travel through a vacuum without any medium. For instance, light, which is a form of electromagnetic radiation, has no mass, always carries energy, and can move through empty space, enabling it to transport energy over vast distances. This is demonstrated by light's ability to pass through transparent materials, such as glass, without requiring physical matter to be moved. The unique nature of energy allows it to affect and rearrange matter, transfer as heat, or perform work, without being tangible in the way that matter—with its atoms and mass—is.

What are the major diseases affecting this circulatory system? Are any related to lifestyle or behavioral causes? Can anything be done to minimize the risk of these diseases?

Answers

Answer:

Some of the major circulatory system disease are given below

1) High blood pressure

2) Atherosclerosis and coronary artery disease

3) Heart attack

4) Heart failure

5) strokes

6) Peripheral artery disease

Explanation:

Some of the major circulatory system disease are given below

1) High blood pressure

2) Atherosclerosis and coronary artery disease

3) Heart attack

4) Heart failure

5) strokes

6) Peripheral artery disease

disease which caused due to lifestyle and behavioral are

1) Atherosclerosis and coronary artery disease

2) High blood pressure

3  Heart attack

4) Heart failure

5) stroke

some key point to remember to diminished the chances of circulatory disease are

1) try to avoid  overweight.

2) Don’t smoke.

3) Exercise daily for minimum  30 minutes per day.

4) Maintain a healthy diet consist of low-fat, low-cholesterol and  more fruits,  green vegetables.

5 ) Limit salt & alcohol

Explain how continuous traits, like human height and skin color, are controlled by multiple alleles of multiple genes.

Answers

Answer:

Continuous traits are determined by total dosage of dominant alleles of all the regulatory gene and exhibit wide variation of phenotype within population.

Explanation:

Continuous traits such as skin color and human height are the polygenic traits and are regulated by multiple alleles of many genes. Each allele of each gene contributes to the phenotype and the effects of all the genes are additive to give a continuous trait.

The phenotype is regulated by the total number of dominant alleles of all the regulatory genes present in an individual.

Human skin color is a polygenic trait and is determined by the regulatory enzymes that determine the production of melanin pigment and its distribution.

Here, the genotype AABBCC having a total of 6 dominant alleles imparts extremely dark skin color to the individual while the genotype "aabbcc" does not have any dominant allele and give extremely light skin color.

Assuming no involvement of the Bombay phenotype: a. If e girl has blood type O, whet could be the genotypes and corresponding phenotypes of her parents? b. If e girl has blood type B end her mother has blood type A, what genotype(s) and corresponding phenotype(s) could the other parent have? c. If a girl has blood type Aa and her mother is also AB, what ere the genotype(s) end corresponding phenotype(s) of any male who could not be her father?

Answers

Answer:

a) OO/OO (phenotype O) ; OA (ph A)/OB (ph B)  ; OO(phO)/ OA(ph A); OO(ph O)/OB (ph B).

b) OB (ph B) or BB (phB) or AB (ph AB).

c) OO(ph O)

Explanation:

a) Blood type 0 is recessive. This girls genotype is  OO.

Then, parents need to have at least one allele O each in their genotype. Possibilities genotypes and phenotypes (ph): OO/OO (phenotype O) ; OA (ph A)/OB (ph B)  ; OO(phO)/ OA(ph A); OO(ph O)/OB (ph B).

b) Blood type B is co-dominant with A. If the girl is B, it means her genotype can be OB or BB.

But we are told that  the mother has blood type A. Also co-dominant. This means the girls genotype cannot be BB.

If the girl is OB, it means she got the O allele from her mother.

The other parent then has to be responsible for the B allele. This means the father could have been OB (ph B) or BB (phB) or AB (ph AB).

c) If the girl is AB (I assume misspelling) and her mother ALSO is AB, then the father cannot be OO(phO). Because he has to give the allele A or B to the girl.  

Any other genotype is possible.

What are the three main components of biodiversity?
a. Species diversity, species productivity, and species stability
b. Genetic diversity, species abundance, and species evenness
c. Species richness, species abundance, and species evenness
d. Species diversity, species-area relationship, and species evenness
e. Species diversity, genetic diversity, and habitat diversity

Answers

Answer:

C. Species richness, species abundance, and species evenness

Explanation:

Biodiversity is the variety and variability of all living organisms within a given environment.  The main components that contribute to biodiversity are :

1 - Species richness: It takes into account the number of different species present in an area. So the more species, the more richer that place is.

2 - Species evenness: It describes the relative abundance of the different species in an area. That is, the more similar the abundance (quantity) of a species, the more uniform it will be.

Final answer:

The three main components of biodiversity are species diversity, genetic diversity, and habitat diversity. These are crucial for ensuring natural sustainability, resistance to diseases, and the adaptation to environmental changes.

Explanation:

The three main components of biodiversity are species diversity, genetic diversity, and habitat diversity. Species diversity is the variety of different species within a specific area. Genetic diversity is the total number of genetic characteristics in the genetic makeup of a species, and habitat diversity refers to the range of different habitats present in an area.

Species diversity is important because a high diversity ensures natural sustainability for all life forms. Genetic diversity helps in providing resistance to diseases, and it enables natural populations to adapt to changes in the environment. Habitat diversity allows for a multitude of niches to be occupied by various species, enhancing species and genetic diversity.

Learn more about Biodiversity here:

https://brainly.com/question/13073382

#SPJ12

In a comparison of birds and mammals, the condition of having four limbs is
a. a shared ancestral character.
b. a shared derived character.
c. a character useful for distinguishing birds from mammals.
d. an example of analogy rather than homology

Answers

Answer: a. A shared ancestral character.

Explanation:

A shared ancestral character is the character or feature that two lineages of same or distinct species have in common derived from a common ancester. The four limbs in birds and mammals is the example of this.

Final answer:

Having four limbs is a shared ancestral character among birds and mammals, inherited from a common ancestor. It represents homology, not analogy—meaning it's due to shared ancestry, not independent evolution.

Explanation:

In a comparison of birds and mammals, the condition of having four limbs is a shared ancestral character. This character trait originated from a common ancestor and has been passed down to the executive lineages. This trait does not differentiate birds from mammals, as both groups possess it. It also represents homology rather than analogy, as it originated from shared ancestry and not independent evolution.

Learn more about Shared Ancestral Character here:

https://brainly.com/question/29220081

#SPJ3

Which nucleotide bases are purines?
a. adenine & guanine
b. adenine & thymine
c. guanine & cytosine
d. cytosine& thymine

Answers

Answer:

a. adenine and guanine

Explanation:

A purines nucleotide is a combination of the heterocyclic aromatic rings, the imidazole and pyrimidine ring.  

Why are the lungs highly vascularized? Where does oxygenation of the blood take place?

Answers

Highly vascularized due to blood needing oxygen and needing to release carbon dioxide. They take place between alveoli and capillaries.

The lungs are highly vascularized to facilitate efficient gas exchange between the respiratory system and the circulatory system and Oxygenation of the blood takes place in the pulmonary capillaries.

The extensive network of blood vessels in the lungs ensures that a large surface area of the lungs is in close contact with the blood. This allows for the exchange of oxygen and carbon dioxide between the alveoli (tiny air sacs in the lungs) and the bloodstream.

Oxygenation of the blood takes place in the pulmonary capillaries, which are the smallest blood vessels in the lungs. As blood flows through the pulmonary capillaries, oxygen from the inhaled air diffuses across the thin walls of the alveoli and into the bloodstream. At the same time, carbon dioxide, a waste product of cellular metabolism, diffuses from the blood into the alveoli to be exhaled.

The highly vascularized nature of the lungs ensures that a continuous supply of deoxygenated blood from the heart reaches the pulmonary capillaries, where it is oxygenated. The oxygen-rich blood is then transported back to the heart to be pumped to the rest of the body, supplying oxygen to the tissues and organs.

Learn more about Lungs, here:

https://brainly.com/question/29129215

#SPJ6

Which stage of Cell respiration produces CO2:
a. Glycolysis
b. Fermentation
c. Citric Acid cycle
d. Electron transport chain

Answers

Answer:

The correct answer will be option-C.

Explanation:

Cellular respiration is a slow process which oxidises the food to release energy in the form of ATP.  The process proceeds in 4 stages: glycolysis, link reaction, Citric acid cycle and the electron transport chain.

The citric acid cycle produces energy molecules ATP and reducing equivalents -NADH, and FADH₂ by the oxidizing the acetyl-CoA and releases CO₂.

Thus, Option-C is the correct answer.

Answer: C : Citric acid Cycle

Explanation: Cell respiration or Cellular respiration is term by which food energy is converted into the usable energy source Adenosin triphosphate ( ATP ). Cell respiration is a set of metabolic reactions , processess and pathways.

Citric acid cycle is set of reactions by which maximum amount of CO2 is released. In Citric acid cycle acetyl CoA undergoes releactions in presence of necessary enzymes by which CO2 is released .

Answer the questions that follow for each stage of the cell cycle (G1, S, G2, prophase, metaphase, anaphase, telophase). If necessary, use an arrow to indicate a change that occurs during a particular cell cycle stage (for example, 1→ 2 or yes → no). a. How many chromatids comprise each chromosome during this stage? b. Is the nucleolus present? c. Is the mitotic spindle organized? d. Is the nuclear membrane present?

Answers

Answer: the answer is based on 46 chromosomes assuming humans.

G1.

Chromatids: 46 chromosomes/ 46 chromatid.

Nucleolus: yes. only disappears during mitosis( RNA synthesis is crucial for making proteins all the time)

Mitotic spindle: no. only appears during mitosis.

Nuclear membrane: yes. only disappears during mitosis.

S. DNA replication occurs.

Chromatids: 46 chromosome/ 92 chromatids

Nucleolus: yes

Mitotic spindle: no

Nuclear membrane: yes

G2

Chromatids: 46 chromosome/ 92 chromatids

Nucleolus: yes

Mitotic spindle: no

Nuclear membrane: yes

Prophase:

Chromatids: 46 chromosome/ 92 chromatids

Nucleolus: will disintegrate at the beginning of the phase.

Mitotic spindle: starts to arrange at the beginning of the phase.

Nuclear membrane: starts dissolving at the beginning of the phase.

metaphase, (chromosomes appear in the middle)

Chromatids: 46 chromosome/ 92 chromatids

Nucleolus: no

Mitotic spindle: arranges chromosomes in the middle.

Nuclear membrane: no

anaphase, sister chromatids split and move to either poles of the cell

Chromatids: 92 chromosome / 92 chromatids)

Nucleolus: no

Mitotic spindle: starts to disassemble during early telophase.  

Nuclear membrane: no

telophase at the end of telophase when the cytoplasm finally splits

Chromatids: 46 chromosome / 46 chromatids per cell

Nucleolus: yes

Mitotic spindle: starts to disassemble during early telophase.  

Nuclear membrane: will start to form at the end of telophase.

Remember that is a continuous process it has been named in 4 phases by humans to study it.

Other Questions
What is the most important use of repetition in poetry? What is the root word for spherical? A. sphere B. here or C. her? 4y+2x=180 solve for x and y Distinguish between sister chromatids and non-sister chromatids. The speed of light in a vacuum is 2.998 x 108 m/s. What is its speed in kilometers per hour (km/h)? K speed = What is its speed in miles per minute (mi/min)? speed = mi/min How many core electrons does magnesium (Mg) have? Human-centered technology often recommends _______aoto computer designers and manufacturers, telling them how to make systems and the devices that support them more user-friendly. What impact would low blood pressure have on kidneys? What symptoms might you expect with a decrease in kidney functions? Molteni Motors Inc. recently reported $3.25 million of net income. Its EBIT was $6.25 million, and its tax rate was 35%. What was its interest expense? (Hint: Write out the headings for an income statement and then fill in the known values. Then divide $3.25 million net income by 1 T = 0.65 to find the pre-tax income. The difference between EBIT and taxable income must be the interest expense.) Enter your answer in dollars. For example, an answer of $1.2 million should be entered as 1,200,000. Round your answer to the nearest dollar. What are the three main types of money?A) credit, commodity, representativeB) fiat, commodity, creditC) representative, credit, fiatD) commodity, representative, fiat How much exercise should teens do daily Fiona shares an office with her exminushusband. Her share of the rent and utilities is $625 per month. She is considering moving to a home office which she will not have to share with anyone. The home office will not cost her anything as far as extra rent or utilities. Recently, you ran into Fiona at the gym and she tells you that she has moved into her home office. Fiona is as rational as any other person. As an economics major, you rightly conclude that ______ Can someone help me with this problem? It has to be in PEMDAS order. 16+(4*2/2)-4 I think it's 18 but I'm not sure The bases of one of the strands of DNA in a region where DNA replication begins are shown here. What is the sequence of the primer that is synthesized complementary to the bases in bold? (Indicate the 5' and 3' ends of the sequence.) 5' AGGCCTCGAATTCGTATAGCTTTCAGAAA 3' what is 3.149 rounded to the nearest hundredth What did the Gestapo and SS do? What is different about the number of course options kids get in virtual schools compared to typical schools? I don't know how to solve this: In a pair of complementary angles, one angle measures 18* less than three times the other angle. Find the measure of each angle. Explainthe benefits a recursive algorithm can provide. Usean example from a process in your organization or with which you are familiar. The square of the product of 4 and a number is the sum of the number and 15