The first person to develop a functioning robot that could complete human tasks Friedrich Kaufmann in Dresden, Germany. The robotic became on show till as a minimum April 30, 1950.
Who was the first human robot?The first humanoid robotic changed into a soldier with a trumpet, made in 1810 with the aid of using Friedrich Kaufmann in Dresden, Germany. The robotic changed into on show till as a minimum April 30, 1950. In 1928, one of the first humanoid robots changed into exhibited on the annual exhibition of the Model Engineers Society in London.
In famous culture. Fictional robots known as Unimate, designed with the aid of using the person Alan von Neumann, Jr.
Read more about the robot :
https://brainly.com/question/991208
#SPJ2
The primary cause of recent global warming is believed to be ________.
What cardiovascular disease creates a large number of abnormal white blood cells?
during _____, the cell uses information from messenger RNA to produce proteins
Answer: Translation.
Explanation: Translation is a step in the protein synthesis where the genetic information is carried from the DNA in the form of series of three base code words.
Each code represents a particular amino acid. During this step only the coding is decoded to produce the specific sequence of the amino acids in the polypeptide chain.
1.04 properties of water
Water is a unique substance with properties such as being tasteless, odorless, and transparent, and existing in all three physical states naturally. It is a polar molecule and an excellent solvent, with high melting and boiling points due to strong hydrogen bonding. These properties are essential for life and various chemical reactions.
Water is an extraordinary substance with several unique properties that are essential for life. Firstly, water is a liquid at standard temperature and pressure, and it is tasteless, odorless, and transparent. The color of water and ice has a slight blue hue in large quantities, while small amounts appear colorless. Water can exist naturally in all three physical states: solid, liquid, and gas. This versatility is crucial for the planet's water cycle.
Chemically, water is a polar molecule, consisting of two hydrogen atoms bonded to an oxygen atom, creating a dipole moment where the oxygen atom has a partial negative charge, and the hydrogen atoms have partial positive charges. This polarity contributes to water's role as an excellent solvent, sometimes referred to as the 'universal solvent,' because it can dissolve many substances, facilitating numerous chemical reactions.
Water also has unusually high melting and boiling points for a small molecule, at 0°C and 100°C, respectively. This is due to strong intermolecular hydrogen bonding between water molecules. Additionally, water has a high specific heat capacity, meaning it can absorb a lot of heat before increasing in temperature, and a high heat of vaporization, which is the energy required to convert it from liquid to gas. Interestingly, water's solid phase (ice) is less dense than its liquid phase, allowing ice to float, which is crucial for the survival of aquatic life during freezing conditions.
Water is tasteless and odorless.Water is transparent, enabling sunlight to penetrate for aquatic photosynthesis.Water is an excellent solvent, referred to as the 'universal solvent.'Water has high melting and boiling points due to strong hydrogen bonding.Water has a high specific heat capacity and high heat of vaporization.Complete Question:
What are some properties of water?
Do you think building eco friendly homes that reduce greenhouse gas emissions could have positive effects on biodiversity? Explain your reasoning.
Eco friendly homes help to reduce the depletion of resources and a consequent loss of biodiversity due to scarcity of resources.
What is biodiversity?The term biodiversity has to do with the very many species of organisms that exists in the ecosystem.
The idea of ecofriendly homes aims to reduce the concentration of the greenhouse gases thereby stopping the sharp rise in the temperature of the surroundings.
This process would help to reduce the depletion of resources and a consequent loss of biodiversity due to scarcity of resources.
Learn more about biodiversity:https://brainly.com/question/13073382
#SPJ2
In _____, an energized molecule directly adds a phosphate group to adp, but _____ uses a concentration gradient of protons as the energy source required to phosphorylate adp.
Answer:
phosphorylation; ATP
Explanation:
Phosphorylation is the name of one of the processes that occur in mitochondria during cellular respiration. With phosphorylation, cells gain a reservoir of energy for metabolic activities. In this process electron transfer from electronic donors to electronic acceptors occurs. This transfer is the redox reactions that enable the process of energy release, biologically usable for ATP biosynthesis.
In this case, an energized molecule would add a phosphate group to the ADP for ATP formation. However, ATP would use a proton gradient as the energy source needed to phosphorylate ADP.
This mutation results from the insertion of two nucleotides into the original sequence which causes the reading frame of the sequence to change this kind of mutation is known as
Answer:
Frameshift mutation
Explanation:
There are many different types of mutations in genetics, one such mutation is known as a frameshift mutation.
Codons are sequences of three nucleotides that determine the amino acid it codes for, and when something changes with these sequences, then we have a mutation.
In a frameshift mutation, nucleotides are added or deleted in such a way that the reading frame changes. For example:
If we have the nucleotide sequence- AUG UGC ACG UAC UUG CAG...
We can see that the reading frame reads three nucleotides per amino acid, however if an extra two nucleotides are added in a random location, then there is a shift- AUG UGC AUA CGU ACU UGC AG... (the underlined indicate the added nucleotides).
Now every amino acid after the frameshift mutation would be incorrectly coded for.
Which of the biomolecules below includes a polydentate ligand called a porphyrin? hemoglobin chlorophyll cytochrome c carbonic anhydrase?
The biomolecule from the given option that includes a polydentate ligand named Porphyrin is called Hemoglobin.
What is Porphyrin?A porphyrin is a molecule with large rings made up of four pyrroles, which are smaller rings composed of four carbons and one nitrogen. These pyrrole molecules are linked together by a sequence of single-double bonds, forming a large ring known as tetrapyrrole.
Porphyrins are responsible for the red hue color of blood in mammals. These porphyrin molecules are used in the formation of -heme groups in mammals.
The nitrogen molecules in the ring's core have the ability to house an iron molecule that is responsible for the red color of blood called Hemoglobin.
Learn more about porphyrin here:
https://brainly.com/question/16522092
Mrs. j. is a 63-year-old woman who has a history of hypertension, chronic heart failure, and sleep apnea. she has been smoking two packs of cigarettes a day for 40 years and has refused to quit. three days ago, she had an onset of flu with fever, pharyngitis, and malaise. she has not taken her antihypertensive medications or her medications to control her heart failure for 4 days. today, she has been admitted to the hospital icu with acute decompensated heart failure.
Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3')? view available hint(s) where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3')? it would not bind the target dna. ttttagccatttacgattaatcg ttttagccatttacgattaatcg ttttagccatttacgattaatcg?
It would bind to the part that has a complementary sequence. Since A pairs with T and C pairs with G then it would bind to ttagc sequence on the DNA strand. The two DNA pieces would also align in anti-parallel alignment.
_______ iron is found in some foods that provide all the amino acids humans require in their diet. heme flat nonheme raw
The right option is Heme Iron
Heme iron is a form of iron found
in some foods that provide all the amino acids humans require in their diet. Heme
iron is present in animal foods such as red meats, fish and poultry and it is
readily absorbed and not well regulated by the body as the body has no way to remove excess iron.
Answer:
Heme Iron
Explanation:
Iron from the diet of humans is absorbed through the intestinal mucosa cells, mainly in the duodenum, and is transported in the bloodstream and extracellular fluid bound to a plasma protein called transferrin. Two types of iron are provided by the diet: heme iron and non-heme iron. Heme iron is present in animal foods, such as beef, chicken and fish, and non-heme iron, in addition to being offered by red meat, is also found in cereals and other vegetables.
Heme iron is soluble in small bowel conditions and is easily absorbed into the intestinal mucosa without the interference of chemical and / or dietary factors. For this reason, it is highly absorbed: about 15% of the heme iron ingested by the normal individual and 35% in the one with low iron stores. Heme iron is found in some foods that provide all the amino acids humans need in their diet.
How do scientists use the Doppler effect to measure the actual motion of stars?
The Doppler effect helps scientists determine a star's radial velocity and rotational speed by analyzing spectral lines for shifts. Redshifts indicate a star moving away, blueshifts indicate an approach, and line broadening suggests rotation.
Scientists use the Doppler effect to measure the actual motion of stars in several ways. They can measure a star's radial velocity, the speed at which it moves toward or away from us, by observing the Doppler shifts in the star's spectrum. When the star moves away from Earth, the spectral lines show a redshift; when it approaches, they exhibit a blueshift. This shift in the wavelength of light can be used to determine the speed of the star relative to the observer.
The Doppler effect can also reveal if a star is rotating by observing the widening of spectral lines, a phenomenon known as line broadening. Light from the edge of the star rotating toward us shifts toward shorter wavelengths (blueshift), while light from the receding edge shifts to longer wavelengths (redshift). Consequently, the spectral lines we observe from the star are broader than those from a non-rotating star, and the amount of broadening can indicate the star's rotational speed.
Additionally, high-resolution spectroscopy allows astronomers to detect subtle variations in a star's radial velocity caused by the gravitational pull of an orbiting planet, leading to planet detection. These minuscule changes do not depend on the star's distance, as long as high-quality spectra can be obtained by large telescopes.
I need help on what to color!!!
Compare and contrast eukaryotic cells with prokaryotic cells. Which type of cell might have been the first one to evolve and explain why this may have been the first.
Answer:
Prokaryotic cells are single-celled organisms that lack membrane-bound organelles and eukaryotic cells contain membrane-bound organelles.
Prokaryotic cell lack nucleus and its genetic material is circular in form which is present in its cytoplasm while eukaryotic cell has a membrane-bound nucleus which contains linear DNA.
Prokaryotic cells might have been the first ones to evolve because prokaryotic cell is simple in organization while eukaryotic cell are more complex.
Eukaryotic cells contain some organelle like mitochondria and chloroplast which resembles the prokaryotic cell because both have linear DNA and 70s ribosome.
So it supports endosymbiotic theory which says that a large prokaryotic cell engulfs a small prokaryotic cell and both remained in symbiotic association with each other and evolved to form eukaryotic cells.
How do mycorrhizal fungi benefit plants?
Mycorrhizal fungi benefit plants in several ways: Nutrient absorption, Water Uptake, Soil Structure, Protection against Pathogens etc.
1. Nutrient Absorption: Mycorrhizal fungi form a symbiotic relationship with plant roots, greatly increasing the surface area for nutrient and water absorption. The fungal hyphae can access nutrients such as phosphorus, nitrogen, and micronutrients that are otherwise less available to plants due to limited mobility in the soil.
2. Water Uptake: The extensive network of fungal hyphae can absorb water from a larger volume of soil, which is particularly beneficial during periods of drought. This helps to improve the plant's drought resistance.
3. Soil Structure: The hyphae of mycorrhizal fungi can help to stabilize soil structure, which improves soil aggregation and porosity. This leads to better aeration and water retention in the soil.
4. Protection Against Pathogens: Mycorrhizal fungi can protect plant roots from pathogens by competing with them for space and nutrients, and by producing compounds that inhibit the growth of pathogenic microorganisms.
5. Stress Tolerance: Plants with mycorrhizal associations often show increased tolerance to various environmental stresses, including salinity, heavy metal toxicity, and extreme temperatures.
6. Enhanced Growth: By improving nutrient and water uptake, mycorrhizal fungi can enhance plant growth and vigor, leading to increased biomass production and crop yields.
7. Ecosystem Diversity: Mycorrhizal fungi contribute to the diversity of plant communities by facilitating the establishment of certain plant species, which in turn supports a greater diversity of above-ground organisms.
8. Carbon Sequestration: The symbiotic relationship between mycorrhizal fungi and plants can lead to increased carbon sequestration in the soil, as the fungi receive carbon compounds from the plant and store some of it in the soil.
9. Nutrient Cycling: Mycorrhizal fungi play a crucial role in nutrient cycling within ecosystems by facilitating the decomposition of organic matter and the transfer of nutrients from the soil to the plant.
In summary, mycorrhizal fungi are essential for plant health and soil fertility, and they play a key role in sustainable agriculture and ecosystem functioning.
In which of the following processes does mitosis play a vital role?
1. the production of gametes for sexual reproduction
2. the production of new body cells to replace old cells
3 the production of additional embryonic cells following fertilization
Answer: 2. the production of new body cells to replace old cells
Mitosis is a form of cell division that results in two daughter cells that are identical (genetically) to each other and to its original cell. It plays a vital role in the life cycle of most living things.
In single-celled (unicellular) organisms such as bacteria, mitosis is a type of asexual reproduction, making identical copies of a single cell.
In multicellular organisms, mitosis produces new cells to replace old cells and promote growth and repair.
Answer:
The production of new body cells to replace old cells;
The production of additional embryonic cells following fertilization.
kidneys couldn't work without the
because
Choose all the answers that apply. Which of the following organelles are found in plant cells but not in animal cells?
(1) cell membrane
(2) cell wall
(3) chloroplasts
(4)vacuole
(5)nucleus
The organelles are found in plant cells but not in animal cells are cell wall and chloroplast. Thus, option B and C are correct.
What is the difference between plant cell and animal cell?
The main difference between plant cell and animal cell is that plant cell contain cell wall and chloroplast and animal cell does not contain cell wall as well as chloroplast. Plant cell contain chlorophyll that provide green color to the plants.The main function of the cell membrane has to keep away the toxic material out of the cell.
Cell membrane has been defined as a wall that differentiate and protect the inner structure of the cell from the outer environment. The main function of the cell membrane has to keep away the toxic material out of the cell. The cell membrane contain channels as well as the receptors that gives the permission to only selective permeable membrane to enter into the cell.
Therefore, The organelles are found in plant cells but not in animal cells are cell wall and chloroplast. Thus, option B and C are correct.
Learn more about plant cell and animal cell here:
https://brainly.com/question/1493437
#SPJ6
Match these cell cycle checkpoints to their role in genome integrity is the dna replicated with out damage?
The cell cycle is regulated by checkpoints (G₁, G₂, and M) that ensure genome integrity by assessing DNA integrity, chromosomal replication, and proper attachment of the kinetochores to spindle fibers, respectively.
Explanation:The cell cycle events are regulated at key points known as checkpoints. These checkpoints help maintain the genome integrity by ensuring that all the necessary actions have taken place correctly before the cell moves to the next phase.
First, the G₁ checkpoint is where the integrity of the DNA is assessed. If any damage to the DNA is detected, the cell cycle is halted until repairs are made. This is to prevent the replication of defective DNA.
The G₂ checkpoint is the phase where cell size and protein reserves are evaluated, and importantly it ensures all the chromosomes have been replicated without damage. If any irregularities are spotted, the cell cycle stops to either complete correct replication or repair the damaged DNA.
Lastly, the M checkpoint or the mitotic checkpoint works during the mitosis phase. Here, proper attachment of each kinetochore to a spindle fiber is assessed. The cell cycle will not proceed until all sister chromatids are correctly attached to the spindle fibers.
Learn more about Cell Cycle Checkpoints here:https://brainly.com/question/29639561
#SPJ3
Explain how an incubator helps with this cloning experiment.
Population growth how is population growth naturally regulated answer key
The natural regulation of population growth can occur through a variety of factors that are intrinsic to the ecosystem and the species themselves. These factors can be categorized into two main types: density-dependent factors and density-independent factors.
Density-Dependent Factors:
1. Competition for Resources: As the population size increases, the availability of resources such as food, water, and space becomes limited. This leads to increased competition among individuals, which can result in decreased birth rates and increased death rates due to starvation, stress, and disease.
2. Predation: Predators tend to eat more from abundant prey populations, which can help control the growth of these populations. As the prey population grows, the number of predators may also increase, further regulating the prey population.
3. Disease: Diseases can spread more rapidly in dense populations. High population density facilitates the transmission of pathogens, which can lead to increased mortality rates.
4. Parasitism: Similar to predation, parasites can have a significant impact on host populations. Higher host densities can lead to higher parasite loads, which can reduce host survival and reproductive success.
5. Territoriality and Intraspecific Competition: Many animals defend territories that provide the necessary resources for survival and reproduction. As populations grow, the size of these territories may shrink, leading to reduced reproductive success and increased mortality due to aggression and stress.
Density-Independent Factors:
1. Weather and Climate: Extreme weather events such as droughts, floods, storms, and temperature extremes can affect populations regardless of their density. These events can cause widespread mortality that is not related to the size of the population.
2. Natural Disasters: Earthquakes, volcanic eruptions, and fires can destroy habitats and cause mass mortality, impacting population sizes independently of population density.
3. Human Activities: Human-induced changes to the environment, such as pollution, habitat destruction, and the introduction of invasive species, can also regulate population growth. These factors can have catastrophic effects on populations, often independent of population density.
Carrying Capacity:
The carrying capacity of an environment is the maximum population size that the environment can sustainably support. When a population reaches or exceeds the carrying capacity, the limiting factors mentioned above become more pronounced, and the population growth is naturally regulated to bring it back to a sustainable level.
In summary, population growth is naturally regulated by a combination of density-dependent and density-independent factors. These regulatory mechanisms ensure that populations do not exceed the carrying capacity of their environment for extended periods, thus maintaining ecological balance.
Which characteristic do euglenoids and algae share
Answer: The answer is B. please mark me as brainliest
Explanation: I took the test
On a hot, dry day, plants close their stomata to conserve water. what impact does this have on photosynthesis?
When plants close their stomata to conserve water on hot, dry days, the rate of photosynthesis is inhibited due to lower carbon dioxide intake, which is necessary for the Calvin cycle, and an increased internal oxygen concentration that can lead to photorespiration, reducing photosynthesis efficiency.
On a hot, dry day, plants close their stomata to conserve water, which can have a significant impact on photosynthesis. The closing of stomata reduces the uptake of carbon dioxide (CO2), which is a crucial component for the photosynthetic process. This leads to a decrease in the rate of photosynthesis because the reduced CO2 levels directly affect the Calvin cycle where CO2 is fixed and converted to sugars. Additionally, the closing of stomata to conserve water also prevents the escape of oxygen (O2), which results in an increase in internal O2 concentration, potentially leading to photorespiration, a process that competes with photosynthesis and decreases its efficiency.
The text indicates that the clusters of teenage suicides that occasionally occur in some communities may be the result of
Describe the function of each organ through which food passes as it moves through the digestive tract.
Final answer:
The digestive system consists of several organs through which food passes: mouth, pharynx, esophagus, stomach, small intestine, and large intestine.
Explanation:
The digestive system consists of several organs through which food passes as it moves through the digestive tract:
1)Mouth: Ingestion of food occurs in the mouth. Chewing breaks down the food into smaller pieces.
2)Pharynx: The pharynx is a passage that leads from the mouth to the esophagus.
3)Esophagus: The esophagus connects the pharynx to the stomach and uses peristalsis to push food down into the stomach.
4)Stomach: The stomach is a muscular organ that mixes food with digestive juices and continues the breakdown process.
5)Small Intestine: The small intestine is where most of the absorption of nutrients from food takes place. It is lined with villi, which increase its surface area for better absorption.
6)Large Intestine: The large intestine absorbs water from the remaining food waste and forms it into feces, which will be eliminated through the anus.
an air mass that originates in the pacific ocean west of brazil is most likely what
Answer:
Warm and wet
Explanation:
Air masses are large portions of air that have relatively homogeneous internal temperature, pressure and humidity conditions, influenced by the region where they are formed. The place of formation of the air mass is called the region of origin, this is where the air mass will acquire its characteristics of temperature, pressure and humidity. Therefore, an air mass originating from western Brazil, will have common characteristics of a tropical region, that is, this air mass will be wet and have a high temperature.
For this reason, we can guarantee that an air mass that originates in the Pacific Ocean west of Brazil is likely to be warm and wet.
Final answer:
An air mass originating in the Pacific Ocean, west of Brazil, would be classified as maritime tropical (mT), implying that it is A. warm and wet.
Explanation:
An air mass that originates in the Pacific Ocean, west of Brazil, is most likely warm and wet. Air masses are classified based on temperature and moisture. Since the Pacific Ocean is a large body of water, an air mass originating there would pick up moisture, making it "maritime" (m) or wet. The geographic location near the equator indicates that the air mass would be "tropical" (T), and thus warm. The combination of maritime and tropical characteristics leads us to classify the air mass as maritime tropical (mT), which is warm and moist.
In a complex food web what would be the most likely result of removing one species of a secondary consumer
_____ is is an inflammation of the nerve that connects the forearm to the palm of the wrist.
Answer: Carpal tunnel syndrome (CTS) is an inflammation of the nerve that connects the forearm to the palm of the wrist.
Explanation: Carpal tunnel syndrome is an inflammation in hand. Excess pressure in the hand is the reason of Carpal tunnel syndrome. Pain , swelling , numbness in the hand are the common symptoms of Carpal tunnel syndrome. CTS can be treated by applying cold packs on the swelling , by avoiding excess pressure on hand and by giving rest to the hand.
What type of manufacturing is most responsible for TCE releases?
CAN SOMEONE HELP ME PLZ
Which of these is a characteristic of a parasite?
It is a helpful organism.
It lives inside or on a host.
It makes its own food.
It is always visible to the naked eye.
Answer:
It lives inside or on a host.
Explanation:
BAM!