Answer:
8/16 or 50% is the likelihood of getting SSYy.
Explanation:
To predict the outcome of the occurrence of SSYy, let's make a punnet square:
SY SY sY sY
Sy SSYy SSYy SsYy SsYy
Sy SSYy SSYy SsYy SsYy
Sy SSYy SSYy SsYy SsYy
Sy SSYy SSYy SsYy SsYy
8/16 of the plants will have a chance of having the genotype: SSYy This means that the there will be a 50% chance that the genotype of the offspring will be SSYy.
What role do photosynthetic play in the process of photosynthesis ?
Answer:
Photosynthetic organisms capture energy from sunlight with pigments.
Explanation:
Answer:
photosynthesis is the process by which plant make their own food in the presence of light....
Explanation:
the factors required for photosynthesis are:
sunlight
chlorophyll
carbon dioxide
water
plants need carbon dioxide,water,chlorophyll and sunlight
How can you (and scientists) tell that a model is good? What kinds of tests can you run to assess the validity of a climate change model?
Model validity can be assessed by analyzing past and present data, such as glacier dimensions, water levels, tree rings, and greenhouse gas levels. Scientific research aiming to develop a deeper understanding of these factors and carbon dioxide concentrations in the atmosphere can also help improve model accuracy.
Explanation:A good model, whether physical or computer-based, is built around a hypothesis and can effectively test this hypothesis. The validity of these models, such as those used in climate change considerations, can be assessed through a variety of tests.
For example, scientists can predict the rise in Earth's temperature by analyzing previous and current data such as the dimensions and locations of glaciers, as well as the water levels in lakes, rivers, and oceans. Analysis of annual tree rings and greenhouse gas levels in the current atmosphere are also methods employed to validate climate change models.
Additionally, scientific questions that lead to an improved understanding of temperature acclimation or advancements in modeling atmospheric carbon dioxide concentrations can further enhance the accuracy of these models. This combination of past data, current measurements, and ongoing scientific inquiry helps ensure that models provide a realistic representation of our planet's changing climate.
Learn more about Climate Change Model Validation here:https://brainly.com/question/33409989
#SPJ3
Thedreaded pathogenic bacterium J. grocious makes a toxin called BalD. There are two allelic forms of balD, with the balD-1 allele encoding the more potent form of the toxin, and balD-2 allele encoding the less potent form of the toxin. Every person in Champaign-Urbana is infected with one of two possible strains of J. grocious, which differ only in whether the strain carries balD-1 allele or balD-2 allele. If the allelic frequency of J. grocious strains carrying the balD-1 allele is 0.8 in Champaign (population = 80,000), and 0.6 in (Urbana = 50,000), then what is the allelic frequency of J. grocious strains carrying the less toxic balD allele within the population of the combined cities of Champaign-Urbana?
Answer:
0.27
Explanation:
Please see attachment
1) Social media and technology have given teenagers more ways to act negatively toward each other. 2) Teens say they believe social media has a positive impact on their lives, with some reporting that it makes them feel "depressed, less popular, less confident, and worse about themselves." 3) These teens are being bullied or are judging themselves because of what they see or experience through technology. 4) Teens should be monitored when they are online to prevent them from acting negatively toward each other. Which sentence should be revised because it presents conflicting information? Which sentence should be revised because it shows bias?
Answer:
sentence 2 then 4
Explanation:
The sentence should be revised because it shows bias is
2) Teens say they believe social media has a positive impact on their lives, with some reporting that it makes them feel "depressed, less popular, less confident, and worse about themselves."
4) Teens should be monitored when they are online to prevent them from acting negatively toward each other.
What is conflicting information?Conflict is serious disagreement and argument about something important. If two people or groups are in conflict, they have had a serious disagreement or argument and have not yet reached an agreement.
Learn more about conflicting information here: https://brainly.com/question/25462203
#SPJ2
Nylon-eating bacteria were discovered growing in ponds containing waste products from a nylon manufacturer. Further study revealed that the enzymes the bacteria used to digest the waste products were different from enzymes produced by other bacteria. Also, the enzymes were not effective on any material other than the nylon waste products. Nylon is an artificial product that was invented in 1935. What does this information MOST likely suggest about the development of the bacteria?
Select one:
a. Bacteria that can digest nylon have a reproductive advantage in the pond.
b. The availability of food forced a change in the living things in the area.
c. Bacteria can create enzymes to digest anything in their environment.
d. Natural selection eliminated the other bacteria in the pond ecosystem.
Answer:
d. Natural selection eliminated the other bacteria in the pond ecosystem.
Explanation:
Natural selection is a type of selection in which nature selects the most suited species or organisms for a particular environment. In this pond environment, only nylon eating bacteria survive due to the availability of food in the form of nylon while all other bacteria die due to the unavailability of food or they are unable to consume nylon in the pond. So that's why nylon eating bacteria survived and other bacteria removed from the pond.
Choose all of the following that are examples of SECONDARY SUCCESSION? a. wild fire b. volcanic eruption c. glacier melting d. flood e. tsunami f. abandoned parking lot
Answer:
i think it would be A for wild fire, D for flood and E for Tsunami
Explanation: wild fire are one of the most common ways for a secondary succession that can bring change when the environment is disturbed or damaged. For instance, by allowing fast-growing plants to grow and provide a source of food and shelter for many animals to use and eventually draw them back into the ecosystem. Both flooding and tsunamis help push older organisms and other stuff from the environment to create for room for other plants and animals to come and keep the ecosystem healthy and ongoing.
i hope this can help you with your work mate!
Secondary succession is the reestablishment of a damaged ecosystem in areas where the soil is left intact. Natural disasters like wildfire and floods, or human activities causing areas to be abandoned are examples of secondary succession.
Explanation:Secondary succession refers to the series of community changes that occur in previously colonized but disturbed or damaged habitats. Examples of disturbances include fires, floods, windstorms, and human activities such as deforestation. Therefore, the correct answers from your set of options are a. wildfire, d. flood and f. abandoned parking lot. When these events occur, they eliminate or reduce the local vegetation, alter the availability of resources, and create opportunities for new species to colonize.
In the case of a wildfire, the area becomes devoid of life but the nutrients are returned to the ground in the form of ash, making the soil ready for new life. Similarly, floods and abandonment of areas such as parking lots create a void that nature quickly tries to fill, leading to secondary succession. The species that establish first (pioneer species) will change the environment in a way that either promotes or hinders the establishment of other species.
Learn more about Secondary Succession here:https://brainly.com/question/26675203
#SPJ2
Which image represents cytokinesis in an animal cell
Answer:the third image represents
Explanation:
Cytokines is the third image
To be classified as organic, a chemical’s molecules must be
Answer:
based on carbon
Explanation:
Answer:
based on carbon
Explanation:
Combinatorial control of gene expression a. involves every gene using a different combination of transcriptional regulators for its proper expression. b. is seen only when genes are arranged in operons. c. involves only the use of gene activators that together regulate genes appropriately. d. involves groups of transcription regulators working together to determine the expression of a gene.
Answer:
The true statement will be - D
It is a involvement of groups of transcriptional regulators which work together to determine the expression of a gene.
Explanation:
Combinatorial gene regulation is a mechanism by which small numbers or groups of transcriptional factors or regulators can control the expression of a much larger gene with temporal and spatial patterns.
The process by which a cell regulates the conversion of DNA to RNA to increase gene activity is known as Transcriptional regulation. A single gene can be regulated by altering the RNA which is transcribed.
The gene control allows the cell to respond to a variety of intracellular and extracellular signals.
Combinatorial control of gene expression involves groups of transcription regulators working collectively to regulate the expression of a gene. Every gene can potentially use a unique combination of these regulators for its adequate expression. It's not confined to operons or with the use of only gene activators.
Explanation:The combinatorial control of gene expression refers to a mode of gene regulation where groups of transcription regulators work collectively to determine the expression of a gene. This principle infers that every gene can potentially use a unique combination of transcriptional regulators for its appropriate expression. However, it's not exclusive to genes arranged in operons or involving only gene activators. This control is a complex process which involves both activators and repressors that bind to specific DNA sequences, thereby increasing or decreasing the transcription of genes.
Learn more about Combinatorial Control here:https://brainly.com/question/33439981
#SPJ3
In his early work on the Citric Acid Cycle, Hans Krebs made measurements of oxygen consumption by suspensions of muscle cells. He found that addition of succinate, fumarate or malate to the cell suspension stimulated oxygen consumption, and that the amount of oxygen consumed was about 10-fold more than the amount needed for the complete oxidation of the added compound. Moreover, the succinate, fumarate or malate was not consumed by the cell suspension but was still detectable at the end of the experiment. What is the correct interpretation of these observations
Answer:
TCA sequence succinate, fumarate or malate is that the intermediary composite. separately kind that influence interruption conjointly comprises product of metabolic process (pyruvate) that is the 1st substrate of TCA sequence once it react with acetyl radical CoA and change its state. This change state particle additional regenerate into iso-citrate and alpha-keto glutarate. Throughout the adaptation of iso-citrate to alpha- keto glutarate oxygen is utilized and greenhouse emission is free. That’s the reason why oxygen utilization is increased.
what happens in anaphase 2
Answer:
During anaphase II, the third step of meiosis II, the sister chromatids of each chromosome separate and move toward opposite poles.
Explanation:
For each of the following sentences, fill in the blanks with the best word or phrase selected from the list below. Not all words or phrases will be used; each word or phrase should be used only once. Transporter proteins and ion channels function in membrane transport by providing a ________1__________ pathway through the membrane for specific polar solutes or inorganic ions. A _________2_________ is highly selective in the solute it transports, binding the solute at a specific site and changing conformation so as to transport the solute across the membrane. For an uncharged molecule, the direction of passive transport across a membrane is determined solely by its ________3__________ gradient. On the other hand, for a charged molecule, the _________4_________ must also be considered. The Na K pump is responsible for maintaining high extracellular sodium ion concentrations. This pump carries out a type of transport called _________5_________ . Group of answer choices 1
Answer:
I believe the answer choices are:
passive, symport, free diffusion, hydrophobic, ion channel, hydrophilic, light-driven, passive transport, facilitated diffusion, concentration, amino acid, membrane potential, active transport, transporter protein, noncovalent, amphipathic.
Transporter proteins and ion channels function in membrane transport by providing a 1. hydrophilic pathway through the membrane for specific polar solutes or inorganic ions. A 2. transporter protein is highly selective in the solute it transports, binding the solute at a specific site and changing conformation so as to transport the solute across the membrane. For an uncharged molecule, the direction of passive transport across a membrane is determined solely by its 3. concentration gradient. On the other hand, for a charged molecule, the 4. membrane potential must also be considered. The Na+/ K+ pump is responsible for maintaining high extracellular sodium ion concentrations. This pump carries out a type of transport called 5. active transport.
Explanation:
Polar or water soluble solutes can only interact with the hydrophilic domains of transport proteins.Transporters, along with permeases and carriers, are a type of membrane transport proteins. Transport proteins bind the solute molecules and undergo conformational changes to transfer the molecule across the membrane.Uncharged molecules moves across membranes based on their concentration gradient i.e. the difference of concentration between the intra and extracellular environment. Whereas, charged molecules and ions require a membrane potential to be transported. One example is the Na+/K+ pump.Na+/K+ pump is an ATP dependent ion channel that utilizes the enzyme Na+/K+-ATPase to break down ATP into ADP and inorganic phosphates.Body fluid accounts for more than 50% of a healthy adult’s body weight and water plays a critical role in human health.
Three possible body functions are listed below. Decide which are functions of water and which are not.
Body Functions
yes or no
Acts to maintain body temperature
Protects against bacterial infections
Provides lubrication for organs
Dehydration occurs when water excretion __________________________ water intake. Individuals at risk include the elderly, infants, people exercising heavily for prolonged periods in the heat, and individuals suffering from both short and prolonged bouts of vomiting and diarrhea. Most problems associated with dehydration can be avoided if they are recognized and treated early. If left untreated, however, dehydration can lead to severe consequences including seizures, brain damage, shock, or even death.
Answer:
- These are functions of body water:
Acts to maintain body temperature (YES).Protects against bacterial infections (YES) .Provides lubrication for organs (YES).- Dehydration occurs when the excretion is higher than the intake.
Explanation:
1. One of the main functions of water in the body is to dissolve substances and facilitate their transport, which occurs in the blood flow and in the transport of transcellular substances. This allows the water to fulfill the function of:
Maintain body temperature, contributing to changes in circulation that lead to the maintenance and loss of heat. Protection against infection, by conducting leukocytes and immune system cells to the site of infection. Lubrication and cleaning of tissues and organs, where water is part of the bloodstream and other body fluids that remove waste products and can keep organic surfaces lubricated (urine, synovial fluid, serous fludi, among others).2. Water balance refers to the maintenance of an adequate amount of water in the body, which depends on intake and excretion.
When water intake decreases or excretion increases, there is a water imbalance -linked to the electrolytes dissolved in it- leading to dehydration and electrolyte imbalance in the body.
These can be causes of dehydration:
a) Decreased intake, due to not having water or liquids to ingest.
b) Increased water loss due to:
increased sweating in hot environments. Vomiting. Diarrhea. Polyuria, or increased urine volume.ATP is a source of free energy that drives unfavorable reactions. Which of the processes are coupled to the dephosphorylation of ATP?
A. the exergonic hydrolysis of creatine phosphate
B. reversible isomerization of glucose‑6‑phosphate to fructose‑6‑phosphate during glucose catabolism
C. de novo (from scratch) anabolism of nucleotides
D. myosin action during muscle contraction
Answer:
Explanation:
ATP is a source of free energy that drives unfavorable reactions. Which of the processes are coupled to the dephosphorylation of ATP?
C. de novo (from scratch) anabolism of nucleotides
D. myosin action during muscle contraction
You are studying body color in an African spider and have found that it is controlled by a single gene with four alleles: B (brown), br (red), bg (green), and by (yellow). B is dominant to all the other alleles, and by is recessive to all the other alleles. The bg allele is dominant to by but recessive to br. You cross a brown (B/by) spider with a pure-breeding green spider. Predict the phenotype of the progeny.
Answer:
50% are brown.50% are green.Explanation:
Given;
B allele is for brown color, so B = brown,
br= red,
bg= green,
by= yellow.
B is dominant over all;
bg is dominant over by;
br is dominant over bg;
by is recessive to all other alleles.
Here, cross between brown (B/by) and pure green (bg/bg).
B/by× bg/bg
progeny
Genotype= B/bg, B/bg, by/bg and by/bg.
Phenotype= B/bg= brown;
by/bg= green
So, 1/2 are brown and 1/2 are green.
In this genetics problem, we are predicting the phenotype of the progeny from a cross between a heterozygous brown spider and a homozygous green spider. Given the dominance relationships of the alleles, the offspring can be either brown (B/bg) or green (by/bg).
Explanation:This question pertains to genetics, specifically, allele dominance. In the given scenario, the B (brown) allele is dominant over all other alleles which means a spider will be brown if it has at least one B allele. The by (yellow) allele is recessive to all other alleles, indicating that a spider will only be yellow if it inherits the by allele from both parents and doesn't have any B allele. The bg (green) allele is dominant to by but recessive to br, hence, a spider will be green if it doesn't have a B or br allele and at least one bg allele.
When a brown spider (B/by) is crossed with a pure-breeding green spider (bg/bg), the offspring will inherit one allele from each parent. Thus, there are two possibilities: B/bg and by/bg. As B is dominant to all, the phenotype of B/bg spider will be brown. For by/bg, since bg is dominant to by, the phenotype will be green. Therefore, the expected phenotypes of the offspring are either brown or green.
Learn more about Genetics here:https://brainly.com/question/32287923
#SPJ3
How would a change to the sequence of nucleotides in a DNA segment affect the
mRNA transcribed from the DNA?
Answer:
The mRNA that was transcirbed determines what amino acid would be attached.
Explanation:
For instance, lets say the complementery mRNA codon said GAU, the amino acid assosioted with this codon is aspartic acid. If the sequence were to change to GAA then the amino acid would be glutamic acid. I hoped this helped! If need any clarifications tell mehhhhh!!
Yes, any change in the gene sequence WILL AFFECT the mRNA transcribed from the DNA. However, a change in the mRNA sequence MAY or MAY NOT affect the protein translated from the mRNA.
During gene transcription, a fragment of DNA is used as a template to create an exactly complementary messenger RNA (mRNA) sequence.
In consequence, any change in the DNA nucleotide sequence will produce a change in the complementary mRNA sequence.
Subsequently, this mRNA travels to the ribosome where it is used as a template to create a protein by a process called 'translation'.
During translation, triplets of nucleotides or 'codons' are read by the ribosome in order to add specific amino acids in the nascent polypeptide chain.
There are codons that encode for the same amino acid, thereby a change in the mRNA sequence may or may not produce changes in the protein synthesized from the mRNA. It is for that reason that the genetic code is said to be redundant.
In conclusion, any change in the gene sequence WILL AFFECT the mRNA transcribed from the DNA. However, a change in the mRNA sequence MAY or MAY NOT affect the protein translated from the mRNA.
Learn more in:
https://brainly.com/question/7239640?referrer=searchResults
Plz Help if anyone know this I’m really struggling especially because this question is just 50 points it’s self.
Answer: The inner planets are Mercury, Venus, Earth, and Mars
Explanation:
The inner planets are also called the terrestrial planets by astrologers. This is because they have a distinguished characteristics which make them.distinct from the outer plantets. They are small Rocky planets and they are made up of silicate , iron and nickel metal.
These planets are arranged based on their distance from the sun i.e from the closet to the sun to there farthest.
They are Mercury, Venus, Earth and Mars.
Which of the following would have the greatest ecosystem diversity? Group of answer choices a lake a prairie the land an organic farmer uses to raise crops to feed his dairy cattle a large island in the tropics that has snowcapped mountains
Options:
a lake a prairie the land an organic farmer uses to raise crops to feed his dairy cattle a large island in the tropics that has snowcapped mountainsAnswer:
a large island in the tropics that has snowcapped mountains
Explanation:
The land a farmer uses is likely to be quite highly regulated in order to ensure that his dairy cattle thrive. That means the growth of certain plants will be controlled, and this will likely impact diversity.
A lake and a prairie could have diverse and balanced ecosystems. However, due to the limited habitat are likely only to harbour specific organisms. E.g. the lake will only harbor organisms that thrive in water environments.
A large island will, first of all, have a lot of space to support diversity. It is in the tropics, meaning it will have species suited to a hot and wet environment. Since it is an island, there will also be the involvement of sea/ocean dwelling creatures. However, there is also mountainous habitat that has snow, meaning it is high up and cold. This provides a habitat for even more species adapted to different environments.
Therefore, the island will be the most diverse.
Answer:
a large island in the tropics that has snow-capped mountains
Explanation:
A tropical land area/ecosystem will by far have the greatest diversity in the ecosystem.
Biodiversity is the variation of life forms in an area. This is usually a function of the number of lives an area can support.
The tropics have abundant energy and the net production is very high. Since there is availability of food for most organisms, different life form will find it easy to thrive in such an area. Tropical regions of the world are the most biodiverse in the world with a rich fauna and floral abundance.Select the statement that best describes homeostasis:
A. internal mechanisms that decrease physiological variables.
B. prevention of changes from happening within the human body.
C. maintenance of a dynamic state of equilibrium within the human body.
D. spontaneous induction of changes to alter the internal state of the body.
Answer: C. maintenance of a dynamic state of equilibrium within the human body.
Explanation:
Homeostasis is the maintenance of body equilibrium. This is done by constantly adjusting to the changes in the body system. There is a set point in the body homoestasis ensure that irrespective of the changes in the body system it goes back to the set point.
The changes in the environment is sensed by the receptor which then send signals to the brain from where the receptors picks it up and respond. The respond could either contrast or relaxes in its response.
Homoestasis is maintained by negative feed back and it is controller in the nervous system in mammals.
Answer:
C. maintenance of a dynamic state of equilibrium within the human body.
Explanation:
Homeostasis is a phenomenon which organisms undergo in order to maintain a dynamic state of equilibrium. Homeostasis helps mainly in the balance of the body’s temperature and fluid.
When organisms are exposed to external conditions such as heat, cold etc , the body tries to balance the internal body system for its optimal functioning and survival. Excess heat can cause dehydration and death but the body uses the sweating mechanism in which the skin excretes little water and then it cools off on the skin thereby reducing the heat content.
According to the text, which statement best describes stem cells? A Stem cells hold genes that send messages to the brains of babies. B Stem cells can change into specific cells and then turn back into stem cells again. C Stem cells are undifferentiated cells that can become any other kind of cell. D Stem cells first develop in adults and are passed on to their offspring.
Stem cells are undifferentiated cells that have the potential to develop into different cell types and are important in the body's development and repair.
Explanation:According to the text, stem cells are undifferentiated cells that can become any other kind of cell. Stem cells have the ability to differentiate into various cell types and can be found in both embryos and adult tissue. They play a crucial role in the development and repair of the body by replenishing damaged or lost cells. Unlike other cells, stem cells can self-renew and maintain their undifferentiated state, making them valuable resources for medical research and potential therapies.
Learn more about Stem Cells here:https://brainly.com/question/34281766
#SPJ11
1 Which of the following is not a household use of water?
A. laundry
B. drip irrigation
C. bathing
D. watering the lawn
Answer:
Drip Irrigation
Explanation:
First of, using process of elimination, laundry, bathing, and watering the lawn are all household uses of water. Drip irrigation is a way of watering large areas of land, like on a large scale farm. Hope this helps!
A chromosomes has the following segments, where represents the centromere: M N O P Q R S T Give the chromosome sequences that would result from the following mutations: a. Deletion of MN b. Pericentric inversion of NOP c. Inversion of RS, followed by tandem duplication of QRST
Answer:
a. O | | PQRST
b. MP | | ONQRST
c. MNO | | PQSRTQRST
Explanation:
Deletion of MN: this refers to the removal of the MN segment from the seuence. thus we will have:
MNO | | PQRST - O | | PQRST
Pericentric inversion of NOP: this is a type of chromosomal rearrangement in which the order of sequence of changed through a 180 degrees orientation and this involves the centromere. thus, we will have
MNO | | PQRST - MP | | ONQRST
Inversion of RS: this does not include the centromere and is called a paracentric inversion.
MNO | | PQRST - MNO | | PQSRT
then followed by tandem duplication of QRST. Thus we will have:
MNO | | PQSRTQRST
Which of these is an example of parasitism?
Your answer:
A lion defends its territory.
A squirrel stores food in a tree hole.
A polar bear kills and eats a seal.
Which type of response identifies a specific pathogen in the body?
A(n)
response
Answer:
specific immune response.
Explanation:
The two divisions of immune response that identifies pathogens in the body are; The specific immune response and non-specific immune response.
The non-specific immune response acts fast as soon it recognize the pathogens, then attack and destroy it. It's action is so fast that it destroy infections within some minutes. While
specific immune response, act as post agent that attack and destroy pathogens that are could not be destroyed by the non-specific defenses response, though it takes hours for the specific immune response to respond to pathogens.
Note: A pathogen is reffers to as a biological agent that bring disease or to its host body.
Answer:
A(n) immune response.
Explanation:
I took the assesment and it said this was the answer.
How might pausing be detected? Match the words in the left column to the appropriate blanks in the sentences on the right. ResetHelp Pausing can be detected by gel electrophoresis and autoradiographyPausing can be detected by blank in experiments involving transcription blank with blank. After incubation, isolate labeled R N A products and subject to blank. Any paused species will accumulate and can be detected. in experiments involving transcription in vivoPausing can be detected by blank in experiments involving transcription blank with blank. After incubation, isolate labeled R N A products and subject to blank. Any paused species will accumulate and can be detected. with radiolabeled nucleotidesPausing can be detected by blank in experiments involving transcription blank with blank. After incubation, isolate labeled R N A products and subject to blank. Any paused species will accumulate and can be detected.. After incubation, isolate labeled RNA products and subject to gel electrophoresis and autoradiographyPausing can be detected by blank in experiments involving transcription blank with blank. After incubation, isolate labeled R N A products and subject to blank. Any paused species will accumulate and can be detected.. Any paused species will accumulate and can be detected.
RNA transcription pauses can be identified using gel electrophoresis and autoradiography in vivo experiments with radiolabeled nucleotides. The isolated RNA products are subjected to gel electrophoresis where any paused species can be detected.
Explanation:Pausing can be detected by gel electrophoresis and autoradiography in experiments involving transcription in vivo with radiolabeled nucleotides. This process allows for the identification of any paused species in the transcription process. Scientists can probe nucleic acid samples for the presence of these sequences, separating these fragments according to size using gel electrophoresis. These fragments are then subjected to autoradiography. When the RNA products are isolated after incubation, they are subjected to this process. Any paused species will accumulate over time and can be detected due to the radiolabeled nucleotides used in the process.
Learn more about Detection of Pausing here:https://brainly.com/question/30021493
#SPJ11
are nucleic acids proteins
Answer:
Proteins are polymers of amino acids while nucleotides are sugar molecules covalently bonded to nitrogenous bases, which can be either a purine or prymidine
Firmicutes have contrasting approaches to reproduction. Select an approach for a firmicutes that inhabits a place where substrates will run out and require relocation to the GI track allowing the microbe to access substrates and start vegetative growth again (like a rodent's GI tract):
a. Multisporulation as in Metabacterium polispora
b. One reinforced endospore as in Bacillus subtilis
c. Internal cell division as in Epulopiscium fishelsoni
d. Highly motile arthrospores as in the case of Streptomycetes
Answer:
b. One reinforced endospore as in Bacillus subtilis
Explanation:
The Firmicutes are a phylum of bacteria, most of which have gram-positive cell wall structure. A few, however, such as Megasphaera, Pectinatus, Selenomonas and Zymophilus, have a porous pseudo-outer membrane that causes them to stain gram-negative.
Metabacterium polyspora is an unusual multiple endospore-producing bacterium isolated from the cecum of guinea pigs. This bacterium is physically similar to the phylogenetically related surgeonfish intestinal symbiont Epulopiscium fishelson.
Epulopiscium spp. are a group of Gram-positive bacteria that have a symbiotic relationship with surgeonfish. These bacteria are known for their unusually large size, many ranging from 200–700 μm in length.
Streptomyces is the largest genus of Actinobacteria and the type genus of the family Streptomycetaceae. Over 500 species of Streptomyces bacteria have been described. As with the other Actinobacteria, streptomycetes are gram-positive, and have genomes with high GC content.
Bacillus subtilis, known also as the hay bacillus or grass bacillus, is a Gram-positive, catalase-positive bacterium, found in soil and the gastrointestinal tract of ruminants and humans.
Scientists are studying the structure and function of receptor x, a single-polypeptide protein that is found in the membrane around certain types of cells. receptor x contains no alpha-helices or beta sheets. a specific molecule outside the cells is recognized and bound by receptor x. the binding of the molecule to receptor x causes the cells to have a particular response. identify the process used to form the covalent peptide bonds that join amino acids into a polypeptide
The process used to form the covalent peptide bonds joining amino acids into polypeptide is : Condensation reaction
Although your question is incomplete attached below is the missing data related to your question.
Covalent Peptide bonds are bonds formed between the carboxyl group of a molecule reacting with the amino group of a different molecule producing water molecule as part of its product. and this process is known as dehydration synthesis mechanism ( aka Condensation reaction )
Hence the process used to form the covalent peptide bonds joining amino acids into a polypeptide is Condensation reaction
Learn more : https://brainly.com/question/11007378
Final answer:
The covalent peptide bonds forming polypeptides are created during protein synthesis, specifically in the translation stage. Receptor X involves in signal transduction by binding to an external ligand and initiating an intracellular response without the ligand entering the cell.
Explanation:
The process used to form the covalent peptide bonds that join amino acids into a polypeptide is called protein synthesis. Specifically, this takes place during a stage called translation, where ribosomes translate mRNA sequences into polypeptide chains using tRNA molecules that bring the specific amino acids. These amino acids are then connected through peptide bonds, resulting in a long chain that folds into a functional protein. Regarding Receptor X, its response to a molecule binding can be thought of as part of signal transduction, a process where an extracellular signal is converted to an intracellular action. Receptor X, as described, is a cell-surface receptor that is involved in signalling without the need for the ligand to enter the cell.
The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along this template from left to right. • Which end of the DNA template is 5’ and which end is 3’? • Give the sequence and identify the 5’ and 3’ ends of the RNA copied from this template.
Answer:
1) The right end is the 5' region and the left end is the 3' region
2) 5'-UAACGGUGCAUCGAUAGCAUGC-3
If the statement is true, write true. If the statement is false, replace the italicized word or phrase to make it true. 9. Penicillin is a drug that comes from a fungus. Another fungus is the source of antiheadache drugs for organ transplant patients. 10. People eat fungi such as truffles, mushrooms, and the yeast in bread. Fungi also give flavor to cheeses and soda drinks. 11. Respiration produces airy bread and the alcohol in beer and wine. 12. The use of fungi and bacteria to remove pollution is called enviroremediation
Answer:
Each statement is followed by an indication for whether the statement is true or false and an explanation:
9. Penicillin is a drug that comes from a fungus. Another fungus is the source of antiheadache drugs for organ transplant patients.
The first part of this statement is true, penicillium is the fungus that produces penicillium. However, there isn't a record of antiheadache drugs being produced from a fungus for organ transplant patients, or otherwise for that matter.
10. People eat fungi such as truffles, mushrooms, and the yeast in bread. Fungi also give flavor to cheeses and soda drinks.
True. Not all types of fungi are harmful to us, there are several ways we take advantage of micro-organisms and this is just on example.
11. Respiration produces airy bread and the alcohol in beer and wine.
True. The yeast cells undergo aerobic respiration in case of making bread, it's the carbon dioxide they release that causes the bread to rise. During anaerobic respiration, the yeast cells produce alcohol - this process is also called as fermentation.
12. The use of fungi and bacteria to remove pollution is called enviroremediation
False. Environmental remediation is a general term for removing pollution in the environment. When bacteria and fungi are used to help in this process, it is referred to as Bioremediation.
Hope that answers the question, have a great day!
9. True
10. True.
11. True.
12. False.
The following information should be considered:
9. It is true because penicillium is the fungus that generated penicillium. But, there isn't a record of antiheadache drugs being generated from a fungus for organ transplant patients
10. True. As we know that Not all types of fungi should be harmful to us, there are various ways we take advantage of micro-organisms .
11. True. The yeast cells undergo aerobic respiration by making bread, it's the carbon dioxide they release that causes the bread to rise. During anaerobic respiration, the yeast cells generated alcohol - this process is also called as fermentation.
12. False. Environmental remediation is a general term for removing pollution in the environment. At the time When bacteria and fungi are used to help in this process, it is known as Bioremediation.
Learn more: https://brainly.com/question/24908711?referrer=searchResults