1. Evaluate x2 + 3x for x = 8

Answers

Answer 1

Step-by-step explanation:

Putting value of x

(8)2 + 3(8)

64 + 24

= 88

Answer 2

Answer:

The answer is 88

Step-by-step explanation:

since x=8

x^2= 64

3x=3×8

=24

x^2+3x= 64+24

=88


Related Questions

I really need help on this sooo yeah​

Answers

Answer:

XVW

Or

WVX

Step-by-step explanation:

Since it's an isosceles triangle, it can either be:

XVW

Or

WVX

Here is a list of numbers: -10, -11, -8, 17, -17, 4, -11 ,12 ,12 ,-4 State the median.

Answers

Answer:

The answer is (-6).

Step-by-step explanation:

Order the numbers from smallest to largest.

Then start eliminiating one from left, one from right until you get the median. Since in our case the median is in between (-8) and (-4). Sum the numbers and divide them by 2.

Good luck!

-6 is the median of the listed numbers you’ve stated

2.65 multiply by 100

Answers

Answer:

265

Step-by-step explanation:

Answer:

265

Step-by-step explanation:

gimme brainliest plz

What is the volume of a cylinder with base radius 3 and height 8? Either enter an exact answer in terms of \piπpi or use 3.14, for \piπpi and enter your answer as a decimal.

Answers

First find the area of the base, and multiply that by the height. That's the answer.

Area of the base: pi * 3*3 = 3.14*9 = 28.26
Volume of the cylinder: 28.26*8 = 226.08 cubic units

answer is 72 then pi symbol

Eric is reading a book that has 144 pages. He reads 8 pages a day. How many days will it take Eric to finish reading the book?

Answers

Answer:

It will take him 18 days to finish the book.

Step-by-step explanation:

[tex]144/8=18[/tex]

Answer:

18

Step-by-step explanation:

You divide 144 by 8 and get the answer.

Martina is currently 12 years older than her cousin Joey. In 4 years she will be 3 times as old
as Joey. Use this information to answer the following questions.

Answers

[tex]\Huge{\underline{\underline{\sf{\red{AnSwEr:}}}}}[/tex]

[tex]\boxed{\sf{Martina's \: Present \: age = 14 \: years}}[/tex]

[tex]\boxed{\sf{Her \: cousin's \: Present \: age = 2\: years}}[/tex]

[tex]\Huge{\underline{\underline{\sf{\green{ExpLaNaTion:}}}}}[/tex]

= Let Martina's cousin's age be = n

= Let her age be = n+12

After four years,

Cousin's age = n+4

Her age = n+12+4=n+16

But according to the question her age = 3(n+4) = 3n+12

Thus,

3n+12=n+16

3n-n=16-12

2n=4

n=4/2

[tex] \boxed{ \sf {n = 2}}[/tex]

Thus ,

Her cousin's present age = n = 2

Her cousin's present age = n = 2Her present age = n+12 = 2+12=14

Is 4.39463 a natural number

Answers

Answer:

i wanna say yes it is a natural number, i hope this helps

answer n.8 for me pls

Answers

Answer:

Step-by-step explanation:

(13)2−(2x+7)=0

19x2−2x−7=0

9(19x2−2x−7)=9(0)

x2−18x−63=0

(x−21)(x+3)=0

Therefore, the value of x are

x - 21 = 0 and x + 3 = 0

x = 21 x = -3

What is the volume?
17 cm
13 cm
5 cm
It’s a triangular prism.

Answers

Answer:

1105 cubic centimetre

Step-by-step explanation:

volume of rectangular prism

[tex] = 17 \times 13 \times 5 \\ = 1105 \: {cm}^{3} [/tex]

PLZZ HELPPP!!! Each edge of a wooden cube is 6 centimeters long. The cube has a density of 0.71 g/cm3
.

What is the mass of the wooden cube?

Enter your answer in the box.
g

Answers

Answer:

153.36g

Step-by-step explanation:

Density is defined as the ratio of mass per unit volume of a material.

Density = Mass/Volume

Given the edge of a cube which is equivalent to its length L to be 6cm.

Density of the cube = 0.71g/cm³

Volume of the cube = L³

Volume = 6³

Volume of the cube = 216cm³

Mass = Density × Volume

Mass of the cube = 0.71×216

Mass of the cube = 153.36grams

Answer:

153.36 grams

Step-by-step explanation:

Density is mass divided by volume: d = m/v.

Here, we already know that d = 0.71 g/cm³.

We can find the volume of hte cube. The volume of a cube is denoted by:

V = s³, where s is the side length

The cube's length is 6, so plug this in:

V = s³

V = 6³ = 216 cm³

Plug these values in:

d = m/v

0.71 g/cm³ = m / 216 cm³

m = 0.71 * 216 = 153.36 grams

The answer is 153.36 grams.

Answer please?????!!!!

Answers

Answer:

x = 3

Step-by-step explanation:

4x + 3 + 7x = -2x + 42

11x + 3 = -2x + 42

13x = 39

x = 3

Answer:

x=3

Step-by-step explanation:

4x+3+7x=-2x+42

combine like terms

11x+3=-2x+42

add 2x to both sides

13x+3=42

subtract 3 from both sides

13x=39

divide both sides by 13

x=3

What is the upper quartile in the box plot? A box-and-whisker plot. The number line goes from 100 to 125. The whiskers range from 104 to 125, and the box ranges from 107 to 122. A line divides the box at 119.

Answers

Answer: cncnnc

Step-by-step explanation:

true false no my

Answer:

Ya'll the answer is 122

Step-by-step explanation:

I checked in with the AI helper and he would always help me, also I got the answer from the AI.

:) hope this helps

      and if your ever stuck on a question,

       Ginny the AI will come to help u Byeeeee :D

Point A (-3, 5) is rotated 180º about the origin. What are the coordinates of A' after the rotation?

Answers

Final answer:

A point when rotated 180º about the origin flips the sign of the coordinates. Thus, point A' after rotating point A (-3,5) 180º about the origin would have coordinates (3,-5).

Explanation:

A rotation of 180º about the origin essentially changes the signs of the coordinates. If we have Point A as (-3, 5), after a 180° rotation about the origin, you'll get Point A', which will be the opposite of Point A. That means it turns (-3, 5) to (3, -5).

Rotation about the origin flips the point across both axes. This is based on a rule in mathematics: When we rotate a point 180° about the origin, (x, y) becomes (-x, -y).

The coordinates of A' after the 180° rotation are (3, -5).

Learn more about Rotation here:

https://brainly.com/question/34828607

#SPJ2

What’s common denominators for 2/5 and 3/5

Answers

Answer:

5

Step-by-step explanation:

The fractions already have a common denominator of 5

A square in a rectangle have the same perimeter. The length of a side of the square is 4x-1. The length of the rectangle is 2x+2 and the width is 2x

Answers

The value x is 1, if the perimeter of square and rectangle are same. The perimeter of square and rectangle is 12 units.

Step-by-step explanation:

The given is,

                A square in a rectangle have the same perimeter

                The length of a side of the square is 4x-1

                The length of the rectangle is 2x+2 and width is 2x

Step:1

                Let, a - Side of square

                        l - Length of the rectangle

                       w - Width of the rectangle

Step:2

                Formula for perimeter of square is,

                                    [tex]p=4a[/tex].............................(1)

                Formula for perimeter of rectangle is,

                                   [tex]p=2(l+w)[/tex]....................(2)

Step:3

                From given,

                            Equation (1) = Equation (2)

                                 [tex]4a = 2 (l+w)[/tex]

               where,

                         a = 4x-1

                          l = 2x+2

                         w = 2x

               Substitute the values,

                       4 ( 4x-1 ) = 2 ( 2x+2+2x )

                            16x - 4 = 2 (4x + 2)

                            16x - 4 = 8x + 4

                          16x - 8x = 8                      

                                   8x = 8

                                     x = 1

Step:4

         Substitute the values of x,

                   a = 4(1)-1 = 3

                     l = 2(1)+2) = 4

                   w = 2(1) = 2

          Perimeter of square and rectangle is 12 units

Result:

           The value x is 1, if the perimeter of square and rectangle are same. The perimeter of square and rectangle is 12 units.

Help please, I’m stressing and I’m going to have a mental break down

Answers

Answer:

Step-by-step explanation:

Volume = surface area of base * height

[tex]=\frac{25}{4}*\frac{8}{5}\\\\=5*2=10\\\\=10 units^{3}[/tex]

An icicle is in the shape of an inverted cone with a diameter of 9 mm and a height of 27 mm. In cubic millimeters, how much frozen water is in the icicle? Use 3.14 for . Round your answer to the nearest hundredth.

Answers

Answer:

volume ≈ 572.27 mm³

Step-by-step explanation:

The icicle is in the shape of an inverted cone with a diameter of 9 mm and a height of 27 mm. To find how much in cubic millimetres the frozen water is in the icicle can be calculated below.

In other words the question want us to find the volume of the cylinder. The volume of the cone can be represented as follows:

volume of a cylinder = 1/3πr²h

where

r = radius

h = height

diameter =  9 mm

height = 27 mm

r = diameter/2 =  9/2 = 4.5

volume = πr²h

volume = 1/3 × 3.14 × 4.5² × 27

volume = 1/3 × 3.14 × 20.25 × 27

volume = 1/3 × 63.585 × 27

volume = 1716.795/3

volume = 572.265 mm³

volume ≈ 572.27 mm³

Answer:

572.27 mm³

Step-by-step explanation:

what’s the fraction fro 5/12+(-7/12)

Answers

Answer:

-.167= -1/6

Step-by-step explanation:

5/12+(-7/12)

=(5 × 12) + (-7 × 12)

_______________

          12 × 12

=-24/144

= -24 ÷ 24

      ________

        144 ÷ 24

= - 1

       _______

              6

Which could be the area of one face of the triangular prism? Select three options.

A triangular prism. The rectangular sides are 12 by 10, 12 by 8, and 12 by 6. The triangular sides have a base of 8 and height of 6.
[Not drawn to scale]
24 square units
48 square units
72 square units
96 square units
144 square units

Answers

Answer:

(A)24 square units

(C)72 square units

(D)96 square units

Step-by-step explanation:

Triangular face

Height of the Triangle=6 Units

Base of the Triangle=8 Units

Area of the Triangular Face

[tex]=\frac{1}{2}bh\\ =\frac{1}{2}*8*6\\=24 $ square units[/tex]

Rectangular Faces

Area of Rectangular face with dimension 12 by 10=12 x 10=120 Square Units

Area of Rectangular face with dimension  12 by 8= 12 X 8=96 Square Units

Area of Rectangular face with dimension 12 X 6=12 x 6=72 Square Units

From the options, the areas are:

24 square units 72 square units 96 square units

Answer:

acd

Step-by-step explanation:

What is the measure of B, in degrees?

Answers

because both sides are given as 10, the two bottom inside angles would be the same

Ju Wenjun is an ecologist who studies the change in the tiger population of Siberia over time. The relationship between the elapsed time ttt, in years, since Ju Wenjun started studying the population, and the number of tigers, N(t)N(t)N, left parenthesis, t, right parenthesis, is modeled by the following function N(t)=650⋅(1625)t
Complete the following sentence about the rate of change in the tiger population.
Round your answer to two decimal places.
The number of tigers decays by a factor of \dfrac45
5
4

start fraction, 4, divided by, 5, end fraction every

Answers

Answer:

The number of tigers decays by a factor of

                                                                         [tex]\dfrac{4}{5}[/tex]    every    0.50 years  

Explanation:

The correctly written function is

         [tex]N(t)=650\cdot \bigg(\dfrac{16}{25}\bigg)^t[/tex]

Convert 16/25 into its equivalent form (4/5)²

          [tex]N(t)=650\cdot \bigg(\dfrac{4}{5}\bigg)^{2t}[/tex]

If you make t = 1/2, this is half-year, the population of tigers will decay by a factor of 4/5 in that time. Every time the half-year passes, the population is multiplied by 4/5, which means that the polulation will decay by a factor of 4/5 whenever half a year elapses.

Hence, the number of tigers decays by a factor of 4/5 every 0.50 years.

The tiger population model indicates a decay by a factor of 4/5 every year. This factor shows the yearly reduction rate for the tiger population in Siberia.

To determine the rate of change in the tiger population modeled by the function N(t) = [tex]650 \cdot \left(\frac{16}{25}\right)^t,[/tex] we look at the decay factor in the exponential function. The base of the exponent, [tex]\frac{16}{25}[/tex], indicates that the population is decaying.

This decay factor can be expressed as [tex]\frac{4}{5}[/tex], where every year, the number of tigers decays by a factor of  [tex]\frac{4}{5}[/tex]. Thus, we can complete the sentence as follows:

The number of tigers decays by a factor of  [tex]\frac{4}{5}[/tex] every year.

Estimate by rounding each number to the nearest ten thousand and then subtract

Answers

Answer:

50,000

Step-by-step explanation

80,000 - 30,000 = 50,000

80,000-30,000=50,000

Lucia has $600 in her checking account. She wants to spend part of this money on a computer. She wants to have exactly $250 left in her checking account after buying the computer. The equation shown can be used to find t, the amount of money in dollars that Lucia can spend on the computer: t + 250 = 600 Which solution represents the correct answer? *

Answers

Answer:

t = 350

Step-by-step explanation:

subtract 250 from each side, and then you'll have t = 350

Answer:

350

Step-by-step explanation:

600 minus 250 =350

350 plus 250 =600

I basically did the inverse operation to solve this equation    

Complete the point-slope equation of the line through (-1,6) and (1,5).
Use exact numbers.
Y= 6

Answers

Answer:

Y-6=-1/2(x-(-1) )

Step-by-step explanation:

The Equation for the point-slope of the line is y - 6 = -1/2(x + 1).

What is the slope of a line?

A line's slope is defined as the ratio of the change in y coordinates to the change in x coordinates.

Both the net change in the y-coordinate and the net change in the x-coordinate are denoted by y and x, respectively.

Given coordinates (-1,6) and (1,5).

the slope of line is given by,

m = (y₂- y₁)/(x₂ - x₁)

y₂- y₁ = 5 - 6 = -1

x₂ - x₁ = 1 - (-1) = 2

m = -1/2

to find the equation at y = 6

when y = 6, x = -1

the equation is given by

y - y₁ = m(x - x₁)

y - 6 = -1/2(x -(-1))

y - 6 = -1/2(x + 1)

Hence equation of a line is y - 6 = -1/2(x + 1).

Learn more about the slope of a line;

https://brainly.com/question/16180119

#SPJ5

15 Points! Can someone help me with this?

Answers

Given:

Spinning top is in the shape of a square pyramid.

Side length of the base = 32 mm

Height of the pyramid = 32 mm

To find:

Volume of the spinning top

Solution:

Volume of the square pyramid:

[tex]$V=\frac{1}{3} b^{2} h[/tex]

[tex]$V=\frac{1}{3} \times (32)^{2} \times 32[/tex]

[tex]$V=1024 \times 32[/tex]

[tex]V=10922.66[/tex] cubic millimeter

The volume of the spinning top is 10922.66 cubic millimeter.

Select the correct answer. If the graph of function g is 6 units below the graph of function f, which could be function g? f(x) = -2x + 7
A. g(x) = -2x − 6
B. g(x) = -2x + 20
C. g(x) = -6x + 7
D. g(x) = -2x + 1

Answers

D. g(x) = -2x + 1
this is because if you wanted the function to be six below, the slope would not change but the y-intercept would go down 6

Answer:

D

Step-by-step explanation:

A birthday hat is the same shape as a *

triangle
cone
ice cream scoop

Answers

Cone. Come on bruh how old are u



Suppose you only look at the height of the bars on the graph. Which conclusion would you MOST LIKELY reach?
A) Twice as many Democrats as Republicans agreed with the court.
B) Twice as many Republicans as Independents agreed with the court.
C) Three times as many Democrats as Republicans agreed with the court.
D) The total number of Republicans and Independents agreeing with the court is half the number of the Democrats that agreed.

Answers

Answer:c

Step-by-step explanation:

NEED HELP ASAP
which set of numbers could represent the lengths of the sides of right triangle

A. 7,9,11

B. 12,18,22

C. 10,15,20

D. 8,15,17​

Answers

We have to use Pythagorean Theorem to solve this. We square the two smallest sides, then add. If the sum is the square of the largest side, then it's our answer.

A. 7, 9, 11

49 + 81 = 130 121

B. 12, 18, 22

144 + 324 = 468 484

C. 10, 15, 20

100 + 225 = 325 400

D. 8, 15, 17

64 + 225 = 289 = 289

So, our answer is D

PLZ HELP!!!!!
3x/2 − 5/12
= 1/4

Answers

Answer:

x=4/9

Step-by-step explanation:

you have to multiply both sides by 12 to get 18x-5=3 then add 5 to both sides which would get you 18x=8, then divide both sides by 18 and you will get 4/9.

Other Questions
1. Solve by setting the linear factors equal to zero.(x+4)(x-3) = 0a) x = 4 and x = -3b) x = 2 and x = 1c) x = -4 and x = 3d) x = -2 and x = 1 Explain how settlers influence the final border between the united states and britain in the pacific northwest Select the correct value for the indicated bond angle in each of the compounds. 90, 180, 109.5, 120, Kara used information from three books for a report she wrote. She is creating a list of her sources. Which information is LEAST important for the list?A)Author B) Title of bookC) City of publicationD) Number of pages in a book The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along this template from left to right. Which end of the DNA template is 5 and which end is 3? Give the sequence and identify the 5 and 3 ends of the RNA copied from this template. An experiment consists of selecting a letter at random from the letters in the word IRRESISTIBLE and observing the outcomes. What is the appropriate sample space for this experiment Choose the best word to complete the sentence below. After their house was _______, the Smiths went out and bought all new furniture. a. demolished b. renovated c. accumulated d. none of the above Please select the best answer from the choices provided A B C D When children are near a pool, pond, or stream, the supervising adultA. should wear a whistle.B. should wear a life jacket.C. must be within an arm's length.D. needs to check on the children every five minutes. if tan 0= -3/8 which expression is equivalent to cot0? A fairground ride spins its occupants inside a flying saucer-shaped container. If the horizontal circular path the riders follow has a 6.75 m radius, at how many revolutions per minute are the riders subjected to a centripetal acceleration equal to that of gravity What should you expect to happen if you participate in a poetry workshop? Gothic archtiture rarely used on the outstide of cathedrals and churhes. true or false Theo's Survey ResultsEye ColorBrown BlueBoy2525GenderGirl2525Theo recorded the gender and eye color of students walking in the hallway at his middle school. What is theexperimental probability in simplest form that the next student he sees will be a boy with brown eyes? A group of adults plus one child attend a movie at Cineplex 15. Tickets cost $9 for adults and $6 for children. The total cost for the movie is $78. Write an equation to find the number of adults in the group. Add your results to those of your partner to produce a total of 20 tosses. Assuming that you expect ten heads and ten tails in 20 tosses, how close are these results to what was expected? five rock songs and six hip-hop songs on a disk jockeys playlist for a radio show. If the disc jockey shuffle the songs randomly, what is the possibility that all hip-hop song are played consecutively The measure of central angle RST is radians. What is the area of the shaded sector? 4Pi units squared8Pi units squared16Pi units squared20Pi units squared find the area of that shape please and show work The Smiths spend 8% of their budget on entertainment. Their total budget this year is $3,000 more than last year, and this year they plan to spend $3,600 on entertainment. What was their total budget last year? Circumference and Area of a circle #5 please