The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along this template from left to right. • Which end of the DNA template is 5’ and which end is 3’? • Give the sequence and identify the 5’ and 3’ ends of the RNA copied from this template.

Answers

Answer 1

Answer:

1) The right end is the 5' region and the left end is the 3' region

2) 5'-UAACGGUGCAUCGAUAGCAUGC-3

       


Related Questions

In guinea pigs, black fur is dominant and white fur is recessive. A homozygous dominant black guinea pig is bred with a homozygous recessive white guinea pig. The dominant allele is represented by F, and the recessive allele is represented by f. Create a Punnett Square and answer the following question: What is the probability of having white fur guinea pigs with this combination

Answers

Answer:

The following cross represents the parent genotype for the offspring whose phenotype is to be determined.

Homozygous dominant black guinea pig FF

                                  X

Homozygous recessive white guinea pig ff

The probability of having white fur guinea pig offspring is zero in the first generation because all of the offspring will be Ff, which is the genotype for black fur.

Punnett Square:

            F             F

f           Ff            Ff

f           Ff            Ff

Hope that answers the question, have a great day!

Roots also play an important role in water transport. Which plays the most important role in the movement of water through a plant--the absorption of water by the roots or the evaporation of water from the leaves

Answers

Answer: plant--the absorption of water by the roots

Explanation: plants root aids the absorption of water and nutrients from the soil. Water is an important constittuents in plants when's its not adequate it could lead to wilting of the plant. Attach to the root is root hair this is what help in absorption of water and nutrients from the soil before it is been transported round the cell by xylem tissue. Water is moved through osmotic pressure from the region of higher concentration to low. The process of photosynthesis in plant requires water without the function of the root for absorption plants cannot actively photosynthesis. Hence root play an important role in water transport in plant .

Transpiration is loss of water from leave surface. The water been loss is

Individuals with peanut allergies can exhibit a variety of symptoms following exposure to the peanut allergies. These symptoms can include a runny nose, skin reactions such as hives, itching in the mouth and throat, digestive problems such as cramps, diarrhea or vomiting, and shortness of breath or wheezing. This variety of symptoms is a result of:

Answers

Answer:

food-induced anaphylaxis

Explanation:

Peanut allergy involves life-threathening symptoms such as skin reactions such as hives,  itching in the mouth and throat, a runny nose, diarrhea or vomiting, shortness of breath or wheezing and digestive problems.

Sympotoms of peanut allergy is the result of food-induced anaphylaxis, a serious allergic reaction which require treatment with an epinephrine injector.

Peanut allergy are caused when immune systme mistakenly identifies peanut proteins as harmful. With the Direct or indirect contact of peanuts allows  immune system to release such symptom that causes chemicals into the bloodstream.

Hence, the correct answer is food-induced anaphylaxis.

Answer:

The food Induces Anaphylaxis

Explanation:

Peanut allergy is more frequent in children and it occurs due to a medical condition called Anaphylaxis.

Peanut contains protein, symptoms occur when protein in peanut are been seen or read by the immune system as something harmful leading to the release of chemicals in the body the shows the various allergy symptoms.

People could take in peanut through direct consumption of peanut and its product, through body contact with it or Indirectly

this occurs when peanut is accidentally processed with food product leading to it consumption. All this can lead to allergy reaction from Anaphylaxis.

Children with allergy to peanut often outgrow it but there is possibility of it to occur again.

Like DNA, RNA has
bases.

Answers

RNA also contains four different bases. Three of these are the same as in DNA: adenine, guanine, and cytosine. RNA contains uracil (U) instead of thymine (T).

Final answer:

RNA, like DNA, consists of four nitrogenous bases, where thymine (T) in DNA is replaced by uracil (U) in RNA; adenine (A), cytosine (C), and guanine (G) are found in both.

Explanation:

Like DNA, RNA has nitrogenous bases that are essential for storing and transferring genetic information. DNA contains four bases: adenine (A), thymine (T), cytosine (C), and guanine (G). RNA also consists of four bases, but with a crucial difference: instead of thymine, it has uracil (U). The bases adenine, cytosine, and guanine are common to both DNA and RNA. In the structures of DNA and RNA, adenine pairs with thymine/uracil, and guanine always pairs with cytosine. This base pairing is essential for the replication of DNA and the synthesis of proteins, as RNA uses the information from DNA to assemble amino acids into proteins.

The back of a water droplet acts as a mirror. When light hits the back of the water droplet it bounces back to our

eyes. This is called

refraction

evaporation

conduction

reflection

Answers

Answer:

reflection

Explanation:

it’s called Reflection

Third-base wobble allows some tRNAs to recognize more than one mRNA codon. Based on this chapter's discussion of wobble, what is the minimal number of tRNA molecules necessary to recognize the following amino acids?
a. leucine
b. arginine
c. isoleucine
d. lysine

Answers

Answer:

a. leucine

Explanation:

In the case of the amino acid leucine alone, there are six different codons (TTA, TTG, CTT, CTC, CTA, and CTG) that can recognize and translate tRNA. Since there is only one codon to be translated, only one tRNA is required. The anti-codon in the tRNA identifies complementary positions on the codon, and due to the characteristic of the third-base motif, there is no 1: 1 ratio between the number of codons present and the required anti-codon.

Can someone help I’m really going crazy because of quarantine pleaseHELP!

Answers

same i miss my friends :((

Answer:same I miss everyone but I think we are going back to school soon

Explanation:

Which of the following describes empirical evidence?
A
dogs are good pets

B
dogs can speak English

C
dogs have two eyes and two ears

D
pet dogs should be allowed at school prom

Answers

C because it’s evidence based on means of the senses. So seeing for yourself and seeing the dog has 2 eyes and 2 ears
Final answer:

Empirical evidence is information that is verifiable through observation or experimentation. Out of all the presented options, the fact that 'dogs have two eyes and two ears' qualifies as empirical evidence.

Explanation:

Empirical evidence refers to information that can be verified by observation or experimentation. In the listed options, C 'dogs have two eyes and two ears' best describes empirical evidence. This statement is factual and can be supported through observation and experiment, unlike claims that 'dogs are good pets', which is subjective, or that 'dogs can speak English', which is inaccurate, or that 'pet dogs should be allowed at school prom', which is an opinion.

Learn more about Empirical evidence here:

https://brainly.com/question/24121333

#SPJ2

What is the Function of cambium

Answers

Answer:

 the function of the cambium: layer of actively dividing cells between xylem (wood) and phloem (bast) tissues that is responsible for the secondary growth of stems and roots (secondary growth occurs after the first season and results in increase in thickness).

Explanation:

Answer:

Your answer would be "B"

Explanation:

7. How are a white dwarf and a planetary nebula related?​

Answers

The white dwarf will be surrounded by an expanding shell of gas in an object known as a planetary nebula. They are called this because early observers thought they looked like the planets Uranus and Neptune. There are some planetary nebulae that can be viewed through a backyard telescope. :) I hoped this helped !

Final answer:

A white dwarf is the core remnant of a star that has shed its outer layers to form a planetary nebula, and eventually cools into a white dwarf. There are more white dwarfs than planetary nebulae because nebulae are short-lived. In stellar evolution, white dwarfs can be involved in events like novas and Type Ia supernovae when in binary systems.

Explanation:

A white dwarf and a planetary nebula are related in the final stages of a star's life cycle. When a star of a certain size exhausts its nuclear fuel, it expands and sheds its outer layers, creating a planetary nebula. The core that remains eventually becomes a white dwarf, which is the dense remnant of the star's core. Over time, the planetary nebula disperses into space, leaving the white dwarf. This explains why there are more white dwarfs than planetary nebulas in the Galaxy since the planetary nebulas are ephemeral, while white dwarfs can exist for billions of years before cooling to become black dwarfs.

In the Orion Nebula, an active star-forming region, it would be unlikely to find white dwarfs because this nebula is relatively young, and stars within it have not yet evolved to that stage of their life cycle. Additionally, in binary star systems, a white dwarf can receive material from its companion star, potentially leading to novas or even Type Ia supernovae if certain conditions are met, such as exceeding the Chandrasekhar limit or the merger of two white dwarfs.

White dwarfs differ from neutron stars in that a white dwarf is supported against gravity by electron degeneracy pressure, whereas a neutron star is supported by neutron degeneracy pressure. Both are dense, collapsed stars, but neutron stars are the denser and smaller remnants of supernova explosions of more massive stars, while white dwarfs are the remnants of less massive stars.

In the neuron, the sodium-potassium pump helps to

Answers

Answer:

The sodium-potassium pump carries out a form of active transport—that is, its pumping of ions against their gradients requires the addition of energy from an outside source. That source is adenosine triphosphate (ATP), the principal energy-carrying molecule of the cell.

Explanation:

Final answer:

The sodium-potassium pump is vital for establishing a neuron's resting potential by creating a negative charge inside the neuron and using ATP to pump ions against their concentration gradients.

Explanation:

The sodium-potassium pump plays a crucial role in maintaining the resting potential of a neuron. This active transport mechanism uses ATP to move sodium ions out of the neuron and potassium ions into it, both against their concentration gradients. For every ATP consumed, three sodium ions are exported and two potassium ions are imported, which helps to establish a net negative charge inside the neuron. The difference in charge across the cell membrane is essential for the transmission of nerve impulses as it keeps the neuron ready to respond to stimulation.

The sodium-potassium pump is a mechanism of active transport that moves sodium ions out of cells and potassium ions into cells. It helps to maintain a difference in charge across the cell membrane of the neuron, creating an electrical gradient called resting potential. The pump moves both ions from areas of lower to higher concentration, using energy from ATP and carrier proteins in the cell membrane.

Select the correct match. Two plants in the same family are in the same _______. If two plants are in the same order, are they in the same family? If two plants are in the same family, are they in the same order? Do two plants more likely have a recent shared common ancestor if they are in the same order or in the same class? If plant species A and plant species B are in the same family, and plant species C is in a different family, which pair of species listed likely has the more recent common ancestor?

Answers

Answer:

The correct answers are "order; no; order; plant species A and plant species B".

Explanation:

Species are categorized in different taxonomic ranks according to physical and genetic features that establish the degree of similarity between species.  For instance, two species that are in the same order have a more recent common ancestor than two species that have the same class. Also, two species that have the same genus share the other taxonomic ranks that are in an upper section. In this case, two plants in the same family are in the same order (the next taxonomic rank) however, two plants that are in the same order not necessary are in the same family.

Final answer:

Plants are classified into hierarchical taxonomic groups. Two plants in the same family are in the same order, but two plants in the same order are not necessarily in the same family. The more recent common ancestor can be determined based on whether the plants are in the same order or the same class.

Explanation:

In biology, organisms are classified into hierarchical taxonomic groups. Two plants in the same family are in the same order. However, two plants in the same order are not necessarily in the same family. The closeness of a common ancestor can be determined by looking at whether the plants are in the same order or in the same class. If plant species A and plant species B are in the same family, while plant species C is in a different family, the pair of species A and B likely has the more recent common ancestor.

how is the geologic time scale divided?

Answers

Answer: Geologic time is divided into units. Major changes in the earth's surface or climate and the extinction of species help to divide the time scale into smaller units.

Explanation: Rocks grouped within each unit contain a similar fossil record.

Certain substances pass from the blood in the glomerular capillaries into the ultrafiltrate under normal circumstances. Other substances will only appear in the ultrafiltrate under abnormal circumstances. Categorize the following substances' appearance in the ultrafiltrate into normal and abnormal.

1. Albumin (a protein)
2. Amino acid
3. Glucose
4. NaCl
5. Plasma
6. Red blood cell
7. White blood cell

Answers

Normal:
Glucose
Rbc
NaCl
Amino acid
Plasma

Abnormal:
Albumin (protein)
Wbc

Remember that only small molecules can pass from the blood in the glomerular capillaries and this is cause they have thin walls

Final answer:

Under normal circumstances, amino acids, glucose, NaCl, and plasma appear in the ultrafiltrate. Albumin, red blood cells, and white blood cells are considered abnormal.

Explanation:

Under normal circumstances, the appearance of substances in the ultrafiltrate is as follows:

Normal: Amino acids, glucose, NaCl, and plasma

Abnormal: Albumin (a protein), red blood cells, white blood cells

In normal conditions, substances like albumin and blood cells should not be found in the ultrafiltrate. If they are present, it indicates abnormal circumstances such as kidney damage or disease.

Use the diagram below to explain the difference between primary and secondary succession and give an example for each one

Answers

Answer:

Primary succession occurs following an opening of a pristine habitat. Secondary succession is a response to a disturbance.

Primary and secondary succession are two types of ecological succession, which describe the processes of ecosystem development and change over time. Here's an explanation of the differences between primary and secondary succession, along with examples for each:

Primary succession occurs in areas that are devoid of soil or lack any significant life forms. It starts from bare rock, lava flows, sand dunes, or newly formed land surfaces. The process begins with pioneer species, such as lichens and mosses, that can colonize the barren environment.

Secondary succession occurs in areas that have previously supported life but have been disturbed or disrupted by events such as fires, hurricanes, or human activities (e.g., deforestation, abandoned agricultural land).

Therefore, primary succession occurs in areas without soil or previous life, starting from bare rock or other non-living substrates. Secondary succession occurs in areas with existing soil and previous life, following disturbances that disrupt the established ecosystem.

For more details regarding primary succession, visit:

https://brainly.com/question/1785275

#SPJ2

You have a 15kb plasmid. EcoRI cuts the plasmid into 7kb and 8kb pieces, and BamHI cuts the plasmid into 1kb and 14kb pieces. If you do a double digest with both EcoRI and BamHI on your plasmid, which of the following band patterns are possible on your gel?a. Bands at 1kb, 6kb and 8kb.b. Bands at 1kb, 7kb and 8kb.c. Bands at 1kb, 6kb and 14kbd. Bands at 7kb, 8kb and 14kb.

Answers

Answer:

a. Bands at 1kb, 6kb and 8kb

Explanation:

The EcoRI and BamHI are the restriction enzymes which cut the DNA sequence especially a plasmid at specific sites called the restriction sites.

The restriction enzymes produces bands of specific length therefore these restriction enzymes are used to estimate the approximate length of the DNA.

In the given question, the

1. EcoRI- produces two strands of 7 kb and 8 kb

2. BamHI- produces two strands of 1kb and 14kb

This shows that the length of DNA sequence is 15kb

But when the DNA strand are digested with both the enzymes simultaneously then it will produce three bands as:

i) 14 kb can be broken down in 2 bands of 6 kb and 8 kb

ii) 1 kb band is already produced by the Bam HI.

This shows that 1+6+8= 15 kb

Thus, Option-A is correct.

Which is Not a feature found on the ocean floor?

a- Rift valley
b- Trench
c- Continental shelf
d- Estuary

Answers

Answer:

D- Estuary

Explanation:

estuaries are where the tide meets a stream, they happen above the water/not very deep in the water

Answer:

I think it is D

 I have studied this before. :)

The saying "Don’t judge a book by its cover." could be applied to the topic of evolution. For example, humans share 75% of their DNA with chickens. Biologists point to this as evidence that humans and chickens once shared a common ancestor. The advent of DNA technology has given scientists the tools with which to examine how closely related certain species are. DNA analysis allows scientists to construct phylogenetic trees whose branches link together the relatedness of different organisms.

Answers

Answer:

The DNA analysis is very important in evolutionary biology because the level of homology among sequences can be used for tracing the evolutionary relationships among populations, species, genera, families, orders, etc.

Explanation:

The DNA is key for phylogenetic inference because the order of the nucleotide bases in a DNA sequence enables to classify the biodiversity in the tree of life

Final answer:

The saying "Don't judge a book by its cover" underscores the importance of DNA analysis in understanding evolutionary relationships. It illustrates that species with similar appearances may be genetically distant, while those looking different can share significant genetic overlap, such as humans and chimpanzees sharing around 98% of their DNA, indicating a common ancestry.

Explanation:

The saying "Don't judge a book by its cover" applies to evolution by highlighting that the external appearance of species can be deceptive when it comes to their genetic relatedness. With the aid of DNA technology, scientists can directly compare the genes of different species. For instance, humans and chimpanzees share approximately 98% of their DNA, which suggests a recent common ancestor, supporting the theory of evolution.

Phylogenetic trees are constructed using DNA analysis to illustrate the connections between species. The more similar the DNA sequences are, the more recently two species likely shared a common ancestor. Mutations serve as a molecular clock to trace back the lineages and construct these trees. These genetic similarities and differences are powerful tools for understanding the vast evolutionary journey of life on Earth.

A, B, C and D are genes that are linked on the same chromosome. Given the following recombination frequencies, what is the gene order? A-B 15%, B-C 26%, C-D 30%, A-C 11%, A-D 19%, and B-D 4%. (Hint: what are recombination frequencies equivalent to?)

Answers

Answer and Explanation:

We need to know that 1% of recombination frequency = 1 map unit = 1cm. And that the maximum recombination frequency is always 50%.

The map unit is the distance between the pair of genes for which one of the 100 meiotic products results in a recombinant one.

The recombination frequencies between two genes determine their distance in the chromosome, measured in map units. So, if we know the recombination frequencies, we can calculate distances between the four genes in the problem and we can figure the genes order out. This is:

Recombination frequencies:

1% of recombination frequency = 1 map unit (MU)A-B 15% = 15 MUB-C 26% = 26 MUC-D 30% = 30MUA-C 11% = 11 MUA-D 19% = 19 MUB-D 4% = 4MU

We know that 15 plus 4 equals 19. So we can infer that we have the gen sequence A--B--D, because the distance between A-B= 15, and the distance between B-D=4, and finally the distance between A-D=19.

A----B----D

  15↔4

      19

We also know that 11 + 19 = 30. So we can assume that C is next to A at a distance of 11 MU.

C----A-----B---D

   11   15 ↔ 4

     11 ↔19    

         30                

The gene order is C, A, B, D

Final answer:

The gene order on the chromosome, based on given recombination frequencies, is most likely B, D, A, C. The recombination frequency corresponds to the relative distances between the genes on the chromosome, and is measured in centimorgans (cM).

Explanation:

In order to determine the gene order based on given recombination frequencies, we'll use the principle that the recombination frequency between two genes corresponds to their relative distances on the chromosome. Recombination frequencies are measured in centimorgans (cM), where 1 cM equals a 1% chance of recombination occurring between two genes.

First, sum the given frequencies: A-B (15%) + B-C (26%) + C-D (30%) = 71%. However, B-D is only 4%, implying that B and D are very close. The discrepancy can be explained by double crossovers, which are not counted. Thus, the order is most likely B, D, A, C, based on their respective distances from each other.

Next, to find the distance between genes, subtract the lesser frequency from the greater: B-A (15%) - B-D (4%) = 11 cM, and C-D (30%) - C-A (11%) = 19 cM. We can now confirm that the gene order (from least to greatest) appears to be B, D, A, C.

Learn more about Gene Order Determination here:

https://brainly.com/question/30882779

#SPJ3

Which of the following statements is not true regarding mutations? A. Mutations are always harmful B. Mutations may be helpful C. Mutations generate the raw material for natural selection D. Mutations create variety in the gene pool

Answers

Final answer:

Mutations are changes to an organism's DNA and can be harmful, advantageous, or neutral. They are not always harmful.

Explanation:

Mutations are changes to an organism's DNA and are an important driver of diversity in populations. Some mutations are harmful, some are advantageous, and some are neutral. Advantageous mutations lead to changes that improve an individual's survival and/or chances of reproduction. For example, the mutation for resistance to insecticide in mosquitos improved their survival. Neutral mutations have no effect on survival or reproduction. The statement that mutations are always harmful (A) is not true, as mutations can be beneficial or neutral as well.

Learn more about mutations here:

https://brainly.com/question/17130462

#SPJ12

Final answer:

The statement that mutations are always harmful is not true. Mutations can be beneficial, neutral, or harmful and are essential for evolution as they create genetic diversity upon which natural selection can act.

Explanation:

The statement that is not true regarding mutations is: Mutations are always harmful. This is incorrect because mutations can have various impacts, including beneficial, neutral, or harmful effects on the organism. Mutations are the primary source of genetic variation, which is essential for evolution. They provide the raw material upon which natural selection acts. Most mutations are indeed neutral, having no significant effect on an organism's fitness. However, some mutations may confer an advantage in certain environments and will be selected for, thereby becoming more common in the population. Conversely, harmful mutations that negatively impact survival or reproduction are typically eliminated from the population by natural selection. In this way, mutations contribute to the diversity in a population's gene pool and play a critical role in the process of evolution.

Learn more about Mutations here:

https://brainly.com/question/17130462

#SPJ3

Identify each statement as TRUE or FALSE. a. Plants are defined as multicellular, eukaryotic, photosynthetic autotrophs. b. Plants are defined by their chloroplasts, which contain chlorophyll a and b. c. Charophytes and land plants share four derived traits that suggest they share a relatively recent common ancestor. d. Charophytes are embryophytes.

Answers

Answer:

A. True

B. True

C. True

D. False

Explanation:

A. Plants in general are multicellular organisms, they are often referred to as eukaryotic autotrophs because they are make their own foods. They carry out photosynthesis, meaning the obtain their energy from sunlight.

B. Plants can be characterized by the presence of chloroplast, an organelle that helps in absorption of sunlight, because of the presence of green pigment called chlorophyll. There two major forms of chlorophyll in plants which are chlorophyll a and b.

C. Charophytes are a type of green algae, but several studies shows they have similar traits to land plants compared to other algae, making them have a common ancestor as plants. Some of the traits similarities to land plants compared to other algae are: they have similar enzymes, they have similar type of cell division, also their sperm is also similar to that of land plants.

D. Charophytes are not embryophytes. Embryophytes are also referred to as land plants, they are multicellular in nature, they include ferns and mosses. Charophytes are a type of green algae similar in traits embryophytes. Although embryophytes are a sister group to charophytes, they are not the same.

Final answer:

The statements identify key characteristics defining plants as multicellular, eukaryotic, photosynthetic autotrophs with chlorophyll in chloroplasts, shared traits between charophytes and land plants, but incorrectly classify charophytes as embryophytes.

Explanation:

Identify each statement as TRUE or FALSE regarding plants:

a. Plants are defined as multicellular, eukaryotic, photosynthetic autotrophs. TRUEb. Plants are defined by their chloroplasts, which contain chlorophyll a and b. TRUEc. Charophytes and land plants share four derived traits that suggest they share a relatively recent common ancestor. TRUEd. Charophytes are embryophytes. FALSE

Plants, being multicellular eukaryotes, have distinctive features including chloroplasts containing chlorophyll for photosynthesis. Though charophytes share common traits with land plants pointing to a shared ancestry, they are not classified as embryophytes, highlighting the distinction and evolutionary pathway between aquatic and terrestrial plants.

Tryptophan synthase is one of the enzymes synthesized from the trp mRNA. In wildâtype E. coli, the trp mRNA has a short halfâlife, but the tryptophan synthase halfâlife is much longer. To investigate how changes to the stability of the enzyme or its mRNA affect enzyme activity, two strains of E. coli were engineered. Strain A stabilizes the trp mRNA and strain B rapidly degrades tryptophan synthase. The wildâtype, A, and B strains were grown in a medium with glucose as the sole carbon source. After several generations, tryptophan was added to all three cultures and tryptophan synthase activity was measured periodically.

Select the statements that describe the expected change in tryptophan synthase activity after the addition of tryptophan
Note: Evaluate each condition as a simple model, where changes in the stability of trp mRNA or tryptophan synthase do not elicit secondary effects in the cells

A. In the wild-type strain, trp mRNA is unstable and will be degraded rapidly. As the cells continue to divide, trýptophan synthase will be diluted out and enzyme activity per cell will decrease
B. In strain A, the trp mRNA is stable and tryptophan synthase will continue to be synthesized However, as the cultures grow the tryptophan synthase will be diluted and the amount of enzyme activity will slowly decrease
C. In the wild-type strain, the trp mRNA is degraded rapidly. However, since the tryptophan synthase is stable, the enzyme activity per cell will remain unchanged as the cells divide
D. In strain A, the trp mRNA is stable but the presence of tryptophan in the medium will cause the degradation of tryptophan synthase and abruptly decrease enzyme activity
E. In strain B, since both the trp mRNA and tryptophan synthase are rapidly degraded, the enzymee activity will drastically decrease.

Answers

Answer:

Explanation:

we have three strains.

the first  is the wild type which has tryptophan mRNA which gets degraded rapidly and tryptophan synthase which is stable. therefore, in the presence of tryptophan, no new mRNA is formed and whatever tryptophan synthase was present would be diluted out as cells continue to divide.

Strain A has stable mRNA and stable tryptophan synthase. so since the mRNA is present, new enzyme will continue to form from it. However, since no new mRNA is formed, the enzyme activity will get diluted as cells divide, but at a much slower rate than the wild type.

in Strain B , synthase is rapidly degraded and no new mRNA is formed. so the tryptophan synthase activity would decrease drastically.

Final answer:

Based on the conditions presented, we can expect a decrease in tryptophan synthase activity in all strains upon the addition of tryptophan, due to factors like mRNA instability, enzymatic dilution, and rapid enzymatic degradation.

Explanation:

To evaluate the potential changes in tryptophan synthase activity upon the addition of tryptophan, the following can be considered:

A. In the wild-type strain, the trp mRNA is degraded fast, leading to the dilution of tryptophan synthase as cells divide and a subsequent decrease in enzyme activity per cell. B. In Strain A, trp mRNA is stable, hence, continuous synthesis of tryptophan synthase is expected. However, the increase in cell count due to the growth of the cultures can lead to dilution, thus enzyme activity can decrease over time.E. For Strain B, both trp mRNA and tryptophan synthase are rapidly degraded. This leads to an almost immediate and drastic reduction in enzyme activity.

Learn more about Tryptophan Synthase Activity here:

https://brainly.com/question/28136635

#SPJ3

Please help. This is bio question.

Answers

Answer:

D: 1:2:1

Explanation:

The answer is D- 1:2:1

please in your own words. how do energy packets (solar radiation and infrared radiation) interact with the clouds to cool the planet.​

Answers

Energy packets interact with the clouds to cool the planet is given below.

Explanation:

1.  Solar radiation is reflected by the clouds' surfaces. ... The reflection helps to keep the heat in the atmosphere, while the passing through allows the heat to escape the Earth system.

2.Low, thick clouds primarily reflect solar radiation and cool the surface of the Earth. High, thin clouds primarily transmit incoming solar radiation; at the same time, they trap some of the outgoing infrared radiation emitted by the Earth and radiate it back downward, thereby warming the surface of the Earth.

3.Air in the atmosphere acts as a fluid. The sun's radiation strikes the ground, thus warming the rocks. As the rock's temperature rises due to conduction, heat energy is released into the atmosphere, forming a bubble of air which is warmer than the surrounding air. This bubble of air rises into the atmosphere.

4.Once in the Earth's atmosphere, clouds and the surface absorb the solar energy. The ground heats up and re-emits energy as longwave radiation in the form of infrared rays. Earth emits longwave radiation because Earth is cooler than the sun and has less energy available to give off

5.Clouds both cool and warm the earth's surface. They cool the earth by bouncing sunlight back into the atmosphere; they warm it by bouncing light down to Earth's surface. The net cloud effect is what scientists need to obtain. To do that, they measured the total amount of sunlight in a cloudy day.

which of this is a cause if loss of genetic diversity?
1. climate change
2. invasive species
3. pollution
4. interbreeding of animals

Answers

Answer:

2 invasive species

Explanation:

If one species over grows the other there would be little to no genetic diversity. :)

Answer: Its D: Interbreeding of animals

Which do you think is most important about sleep? Write 2-3 sentences to explain

Answers

Answer:Sleep helps keep your heart healthy

A regular sleep pattern can help to lower the levels of stress and inflammation to your cardiovascular system, which in turn can reduce your chances of a heart condition.

Explanation:

Hope this helps

Stay Safe

plz give me brainiest

Answer:

sleep helps your body get energy for the next day.

It is true beacuse you learn it in school and the next day when you wake up you dont feel exhausted or weak. That only happens when you run outside too much. you shouldnt do that during this time, even during quarinten

Explanation:

A micrograph of dividing cells from a rat, a diploid animal, shows a cell where 21 pairs of sister chromatids are being pulled apart.
Which stage of cell division could such a photo have been taken?

a) Anaphase 1 of meiosis
b) Anaphase II of meiosis
c) Anaphase of mitosis O
d) Telophase 1 of meiosis
e) Telophase of mitosis

Answers

Answer:

b) Anaphase II of meiosis

Explanation:

1. Meiosis is the process of cell division in which one cell is divided into four daughter cell, each contains equal number of chromosome, half the number of chromosomes as compared to parental cell.

2. In meiosis I, DNA duplication occurs but the sister chromatids are not separated, only homologous pair of chromosomes are separated, so this is called reductional division.

3. In meiosis II, chromatids are pulled apart and and are separated into different chromosomes, so it is called equational division. There is no DNA duplication in meiosis II.

Final answer:

The correct stage of cell division for the photo showing 21 pairs of sister chromatids being pulled apart in a rat cell is Anaphase of mitosis.

Explanation:

The correct answer to this question would be c) Anaphase of mitosis. During the anaphase stage of mitosis, the sister chromatids of each chromosome are being pulled apart to opposite ends of the cell. We know it must be mitosis because the cell in the micrograph is a somatic (body) cell with a diploid number of chromosomes. In a rat, the diploid number is 42 (21 pairs), matching the number of pairs of sister chromatids being pulled apart.

Learn more about Cell Division here:

https://brainly.com/question/34653200

#SPJ3

g You are performing DNA sequencing reactions as part of your job as a employee at GeneTech, Inc. In your current project, you are attempting to sequence a 700 bp DNA fragment sent by a customer. After the reaction has begun, you realize that due to a decimal error, you accidentally added the fluorescently labeled di-deoxyribonucleoside triphosphates (ddATP, ddGTP, ddCTP, ddTTP) at ten times higher than the desired concentration. What do you expect will be the consequence of this mistake?

Answers

Answer:

The consequence of this error will be the waste of material, since several nucleotides were placed in the reaction and will not be used.

Explanation:

There are several DNA sequencing protocols and although we don't know which one the GeneTech, Inc. employee is using, we can say that the fluorescence-labeled di-deoxyribonucleoside triphosphates will be used to make countless copies of the DNA particle that he wants to sequence.

As we know, DNA replication separates the DNA strands and uses each strand to make copies of new DNA molecules. These copies are made with the DNA polymerase enzyme by adding deoxyribonucleosides to the new tapes. As the enzyme is highly regulated and has a DNA strand as a template for the new strands, it will not add nucleotides beyond what is necessary.

Therefore, by placing excess di-deoxyribonucleoside triphosphates in the reaction, the consequence will be just the waste of product.

What is one half or one rod of the
condensed chromatin called?
A DNA
B chromatin
C chromatid
D chromosome

Answers

The answer is C, chromatid

Final answer:

One half or one rod of condensed chromatin is known as a c) chromatid. The two identical halves of a chromosome are sister chromatids, and they are connected at a structure called the centromere. The first level of DNA organization is aided by histones.

Explanation:

One half of condensed chromatin is called a chromatid. During the cell cycle, specifically after the DNA has replicated during the S phase, eukaryotic DNA condenses and coils into an X-shaped structure known as a chromosome. This chromosome is composed of two identical parts referred to as sister chromatids. These sister chromatids are held together at a region termed the centromere. Before the cell proceeds to division through mitosis, these chromatids are attached at their centromeres, and they will eventually separate to be allocated to each daughter cell.

The correct answer is C. chromatid. Furthermore, in a eukaryotic cell, the first level of DNA organization is maintained by histones which help package the DNA into structural units called nucleosomes. The histones and chaperone proteins aid in condensing the DNA and preventing it from becoming tangled.

what is the complementary RNA called?​

Answers

Answer:

It is miRNAs or microRNA

I hope this helps

Answer: Complementary RNA (cRNA) is a copy of a strand of RNA that will bind to the appropriate region of the original molecule.

Explanation: If the original RNA stand had a base sequence of AUU, for example, the sequence of the cRNA strand would be UAA. I hope this helps :).

Other Questions
1.Solve the following inequalities:- 4x >72 Which equation can be used to find the length of side x? A taxi charges a $3 initial fee,plus $1.50 per mile traveled. What is the total cost of a 4.5- mile taxi trip?A $9.00B $9.50C $9.75D $10.00 How did the U.S. public respond to Operation Desert Storm?A.Many people opposed any type of military intervention in Iraq.B.The public considered Operation Desert Storm a huge success.C.Voters were reluctant to fund more military spending.D.Most U.S. citizens did not know about Operation Desert Storm. when creating content for an audience that may be visually impaired to a point be sure to choose_____? What was the purpose of the open door How does the use of repetition affect the narrators tone in this passage?It creates a dark and mysterious tone.It creates a playful and caring tone.It creates a serious and academic tone.It creates a sarcastic and humorous ton how do scientist determine weather a cell from cancerous tissue is a cancer stem cell Mitotic cell division is considered asexual because: Please choose the correct answer from the following choices, and then select the submit answer button. the daughter cells receive DNA from one parent cell, and the daughter cells are genetically identical. this form of cell division is most similar to binary fission. the daughter cells formed are genetically different. the daughter cells get different mixes of maternal and paternal chromosomes. Tori Amos Corporation began operations on December 1, 2013. The only inventory transaction in 2013 was the purchase of inventory on December 10, 2013, at a cost of $20 per unit. None of this inventory was sold in 2013. Relevant information is as follows.Ending inventory units December 31, 2013100 December 31, 2014, by purchase date December 2, 2014100 July 20, 201450150During the year 2014, the following purchases and sales were made.PurchasesSalesMarch 15300 unitsat$24April 10200July 20300 unitsat25August 20300September 4200 unitsat28November 18150December 2100 unitsat30December 12200The company uses the periodic inventory method.Tori Amos Corporation began operations on DecemberTori Amos Corporation began operations on DecemberCalculate average-cost per unit. (Round answer to 2 decimal places, e.e. 2.76.)Average-cost$Entry field with incorrect answer now contains modified dataTori Amos Corporation began operations on DecemberTori Amos Corporation began operations on DecemberDetermine ending inventory under (1) specific identification, (2) FIFO, (3) LIFO, and (4) average-cost. (Round answer to 0 decimal places, e.g. 2,760.)Specific IdentificationFIFOLIFOAverage-CostEnding Inventory$Entry field with incorrect answer$Entry field with correct answer$Entry field with incorrect answer now contains modified data$Entry field with incorrect answer now contains modified dataTori Amos Corporation began operations on DecemberTori Amos Corporation began operations on DecemberCalculate price index. (Round answer to 4 decimal places, e.g. 2.7600.)Price IndexEntry field with incorrect answer now contains modified dataTori Amos Corporation began operations on DecemberTori Amos Corporation began operations on DecemberDetermine ending inventory using dollar-value LIFO. Assume that the December 2, 2014, purchase cost is the current cost of inventory. (Hint: The beginning inventory is the base-layer priced at $20 per unit.) (Round answer to 0 decimal places, e.g. 2,760.)Ending inventory at dollar-value LIFO$Entry field with incorrect answer now contains modified data Maxtor Technology incurred the following costs during the year related to the creation of a new type of personal computer monitor: Salaries $ 280,000 Depreciation on R&D facilities and equipment 155,000 Utilities and other direct costs incurred for the R&D facilities 72,000 Patent filing and related legal costs 28,000 Payment to another company for performing a portion of the development work 150,000 Costs of adapting the new monitor for the specific needs of a customer 86,000 What amount should Maxtor report as research and development expense in its income statement? Which is a possible negative result of using renewable resources? A fitness center is planning to invest in a specialized exercise equipment. This equipment is highly effective, but the club members could be injured if the equipment is not used correctly. The fitness center sends its exercise instructors to a certified training program to learn how to use these machines correctly. This is best classified as: job/technical training. Please help!! List 2 advantages and disadvantages of each chart below worth 40 points! Which of the following is(are) the solution(s) to | X+10 | = 3x-2? What does the cartoonist send by portraying the Supreme Court justice as a Roman emperor? What is zero uniform velocity motion A ball is thrown vertically upward. After seconds, its height (in feet) is given by the function 56t - 16t^2 . What is the maximum height that the ball will reach? The management of Shatner Manufacturing Company is trying to decide whether to continue manufacturing a part or to buy it from an outside supplier. The part, called CISCO, is a component of the companys finished product. The following information was collected from the accounting records and production data for the year ending December 31, 2017. 1. 8,000 units of CISCO were produced in the Machining Department. 2. Variable manufacturing costs applicable to the production of each CISCO unit were: direct materials $5.00, direct labor $4.35, indirect labor $0.40, utilities $0.39. 3. Fixed manufacturing costs applicable to the production of CISCO were: Cost Item Direct Allocated Depreciation $1,900 $930 Property taxes 560 290 Insurance 950 590 $3,410 $1,810 All variable manufacturing and direct fixed costs will be eliminated if CISCO is purchased. Allocated costs will have to be absorbed by other production departments. 4. The lowest quotation for 8,000 CISCO units from a supplier is $81,590. 5. If CISCO units are purchased, freight and inspection costs would be $0.34 per unit, and receiving costs totaling $1,290 per year would be incurred by the Machining Department.(a) Prepare an incremental analysis for CISCO. Your analysis should have columns for 1. Make CISCO, 2. Buy CISCO, and 3. Net Income Increase/(Decrease). (b) Based on your analysis, what decision should management make? (c) Would the decision be different if Shatner Company has the opportunity to produce $3,000 of net income with the facilities currently being used to manufacture CISCO? Show computations. (d) What nonfinancial factors should management consider in making its decision? A plant takes in carbon dioxide (CO2) from the atmosphere and uses it to make glucose (C6H12O6) through photosynthesis. Later a deer eats the leaves of the plant obtaining the plants glucose. After respiration, the deer exhales carbon dioxide (CO2) back into the atmosphere. This is an example of _________________.