2. Which of the following is not a use of por?
to refer to a length of time
to express gratitude
to indicate a destination
to show movement through, along, or around

Answers

Answer 1
Por is used to refer to a length of time (or duration); e.g. estaremos aquí por una hora ("we will be here for an hour").

Por is used to express gratitude; e.g. gracias por la ayuda ("thank you for the help").

Por is not used to indicate a destination; para would in used in such a case. For example, voy para la tienda ("I am going to the store").

Por is used to show movement through, along, or around; e.g. voy por la calle ("I go through the street").

Answer:
to indicate a destination

Related Questions

Resposta do enigma na igreja a 5 velas entra 3 ladrao e 2 ladra cada ladrão leva 1 vela

Answers

I think its 2 remaining candles.

¿Qué pasó la última vez que fuiste de vacaciones?

Answers

PLEASE RATE 5 STARS

¡Fui a Florida y lo pasé muy bien!

Vayas a la tienda.
Correct
Incorrect

Answers

incorrect
Ves* one person
vayas is for one person but it doesnt go in the contest your trying to use it in.

Imagine that you are igven the opportunity to create your own TV channel and select the programing that appears on your channel. Write a TV listing page from a television guide in which you name and describe the programs you would show including the type programs that they are what are about anda critics opinion of each one use as man Spanish vocabulary words and phrases as possible in your listing remember to add an opinion to yor portfolio

Answers

this has to be in spanish????????

two spanish questions. 10 points.

Answers

1. a) Yo nunca he hablado de eso.
2. d) Ella lo he conocido por un ano.
Is the first la primera (1)

Tú oyes ___ tu mamá.

The "personal a" is necessary.

The "personal a" is not necessary.

Answers

Tú oyes ___ tu mamá.

The "personal a" is necessary.<-------

The "personal a" is not necessary.
(with a)you hear your mom
(without a)you listen to your mom

The "personal a" is necessary.<-------

Which verb form correctly completes this sentence? Es dudoso que mucha gente ___________ comer mariscos. prefieren prefiera prefieran prefiere

Answers

prefiere es su respuesta

Sup,

The correct verb to correctly complete the sentence would be preferia.
I added a screenshot just in case.

I hope that helped...

XD

Decide if the obligation was met in the past. Mi mamá tuvo que ir a la escuela de mi hermano.

Answers

It was in past. My mom had to go to my brother's school.

Completa la frase con la mejor respuesta. (Complete the sentence with the best response.) Tomamos fotos con ________ .

A el mensajero instantáneo

B la cámara digital

C la dirección electrónica

D la pantalla

Answers

I think its B la cámara digital.
Completa la frase con la mejor respuesta. (Complete the sentence with the best response.) Tomamos fotos con ___la cámara digital _____ . 

B la cámara digital 
The sentence is translated to We take photos with a        .

a cámara digital  is translated to digital camera. 

Plz give me branliest

magine you are shopping in a bookstore. Tell about something that you see in the bookstore that you like or dislike. Answer the following question using gustar. Include mucho, muchísimo, poco, or nada in your response. ¿Qué te gusta en la librería? ____________________ When entering your answers for fill in the blank and essay questions, please be sure to use accent marks and/or correct punctuation to avoid your answer being marked incorrect. You may copy and paste the accented character or punctuation mark from this list if needed: á é í ó ú ñ Á É Í Ó Ú ¿ ¡ (4 points)

Answers

I hope this helps:


Me gusta cuántos libros tiene la biblioteca y cuántas cosas hay para leer. No me gusta cuánto tienes que pagar por los libros. Aunque los libros pueden ser caros, sigo pensando que la biblioteca es un gran lugar para comprar y leer libros. Me gusta mucho.

Plz branliest
Me de ler libros de comedia..
No me gusta de ler libros de romance.

¿Quién roba una tienda?
la ley
el juez
el ladrón
el abogado

Answers

The answer is El ladrón means a robber or criminal

hayan censurado
ha cuidado
han cuidado
haya dejado
haya estado
han formado
has formado
ha influido
haya opuesto
ha sido
haya sido
hayamos vuelto

LEOPOLDO No me sorprende que los miembros del Instituto de Cinematografía (1) la película.

ÁNGELA ¡Qué mala suerte! Lo siento mucho.

LEOPOLDO Pero dudo que el presidente del Instituto (2) de acuerdo con la censura. Creo que (3) presionado.

ÁNGELA No estoy segura de que (4) presionado. Pienso que te (5) una opinión equivocada de él.

LEOPOLDO ¿No crees que el presidente se (6) a la censura?

ÁNGELA No pienso que él se (7) convencer por la opinión de otros. Creo que tiene mucho poder y él siempre (8) mucho su imagen pública.

Answers

What's your question exactly?

Answer:

1. hayan censurado

2. haya estado

3. ha sido

4. haya sido

5. has formado

6. haya opuesto

7. haya dejado

8. ha cuidado

Explanation:

All the verbs here are in perfect preterit, which is a tense used to express an action happened in the past that are either still going on in the present or it's not clear if they have ended. Perfect preterit is always formed by the proper conjugation of the verb "haber" and the verb being used. However, some verbs are in indicative form and others are in subjunctive. Indicative form is used to indicate or state facts or actions, subjunctive form is used to express conditionals, supposition or hypothetical scenarios.

is the following sentence grammatically correct or incorrect?

¿quieres saber la respuesta? -sí, las quiero saber

Answers

in the sentence (si, las quiero saber) las is incorrect. its suppose to be la 
it is incorrect, it should be ¿Quieres saber la respuesta? -Sí, la quiero saber.

¿Cuál de las siguientes frases es un mandato negativo? No hablas mucho. No reciclas papel. No salgas de la casa.

Answers

Una frase que es un comando negativo incluye lo siguiente; C. No salgas de la casa.

En el idioma español, el imperativo informal se puede definir como un modo gramatical que se utiliza en órdenes o solicitudes dirigidas a alguien con quien el hablante o escritor tiene una relación informal.

En términos generales, el verbo en modo imperativo se utiliza comúnmente para hacer solicitudes, dar órdenes y expresar deseos.

En español, los mandatos negativos se forman de manera diferente dependiendo de si el mandato está dirigido a alguien a quien te dirigirías informalmente (usando la forma "tú") o formalmente (usando la forma "usted" o "ustedes").

La frase "No salgas de la casa" es un mandato negativo

¿Cuál de las frases es un mandato negativo?

La frase "No salgas de la casa" es un mandato negativo porque utiliza la forma imperativa negativa del verbo "salir".

los mandatos negativos se utilizan para dar órdenes o instrucciones en las que se niega que se realice una acción específica.

En este caso, la orden es "no salir de la casa", lo que significa que se está indicando a alguien que no debe salir de la casa.

Question

¿Cuál de las siguientes frases es un mandato negativo?

No hablas mucho.

No reciclas papel.

No salgas de la casa.

Escoge todo lo que se encuentra en Honduras.

playas en el mar Caribe
La Patagonia
tacos de res
San Pedro Sula
glaciares
Xel-ha
museo Chiminikee
mate
milanesas
la fortaleza en Omoa
ruinas del Tazumal
un naufragio famoso
ruta artesanal
Tegucigalpa
ruta de La Paz
ruta de las flores
ruinas de Copán

Answers

Playas en el mar Caribe
San Pedro Sula
La fortaleza de Omoa
Tegucigalpa
Ruinas de Copán

En honduras se encuentra:

1 Tegucigalpa

2.La fortaleza en Omoa

3. ruinas de Copán

4. playas en el mar Caribe

5. San Pedro Sula

6. museo Chiminikee  

7. un naufragio famoso El Aguila  


El resto de las opciones ubican en:

Glaciares  y La Patagonia (Argentina)

Xel-ha (Cancún, México)

mate (Argentina)

milanesas (Argentina)

ruinas del Tazumal (San salvador)

ruta artesanal (San salvador)

ruta de La Paz (San salvador)

ruta de las flores (San salvador)


La muchacha ____________________ en su dormitorio. (dormir/perder) pierde duerme perde dorme

Answers

It would be the word duerme
duerme en su dormitorio 

Lee las frases e identifica si cada una es subjuntiva o indicativa. Después, escoge la opción que refleja el modo correcto. Read the sentences and identify if the sentence is subjunctive or indicative. Then choose the option that reflects the correct mood for each sentence.
1. My mom wishes I would not drive in the rain.
2. It's obvious they are going to drive to the airport.
3. It's certain that we will all fit in the van.
4. My grandfather hopes that we will come to the party.

Answers

The subjunctive mood is used to talk about desires, doubts, wishes, conjectures, and possibilities.  For example

1. My mom wishes I would not drive in the rain

4. My grandfather hopes that we will come to the party

The indicative mood is used to talk about facts and other statements that are believed to be true and concrete. For example

2. It's obvious they are going to drive to the airport

3. It's certain that we will all fit in the van.

Lee las frases e identifica si cada una es subjuntiva o indicativa. Después, escoge la opción que refleja el modo correcto. Read the sentences and identify if the sentence is subjunctive or indicative. Then choose the option that reflects the correct mood for each sentence.

Answers:

Explanation : The indicative mood expresses something that is considered true, whereas the subjunctive mood expresses desires or possibilities for something to happen.

Subjunctive Mood:

These sentences express desires or possibilities.

1. My mom wishes I would not drive in the rain.

Translation 1: Mi madre desea que yo no conduzca bajo la lluvia.

4. My grandfather hopes that we will come to the party.

Translation 4: Mi abuelo espera que nosotros vayamos a la fiesta.

Indicative Mood:

These sentences express something that is considered true.

2. It's obvious they are going to drive to the airport.

Translation 2: Es obvio que van a conducir al aeropuerto.

3. It's certain that we will all fit in the van.

Translation 3: Es cierto que todos cabremos en la furgoneta.

[tex]\textit{\textbf{Spymore}}[/tex]​

Write sentences by putting these words in the correct order. Use capital letters, the correct preterite form of the verb, and add punctuation.

#1. comenzar / tú / ayer

#2. una / yo / carta / escribir

#3. en / nosotros / San Diego / vivir

#4. para / pagar / padres / cena / mis / la

#5. el / ellos / jugar / béisbol

Write both the infinitive form and the preterite yo form of the following verb.

#1. to pay

#2. to prefer

Choose the appropriate verb in parentheses and write the correct form in the blanks to complete each sentence.

Hoy mi abuelo no come con nosotros. Él ____________________ (almorzar / traer) con unos amigos.


Answers

1- Yo COMENCÉ ayer
2- Yo ESCRIBÍ  una carta
3- Nosotros VIVIMOS en San Diego.
4- Necesito a mis padres para PAGAR la cena.
5- El JUEGA al béisbol con ellos.

infinite form.

1. Pagar
2. Preferir

1-Almorzará

Answers:

a) In spanish (castillian) gramar the Preterite or Simple Past Tense is used to express specific actions completed or concluded in the past that are separated from the present.  

In other words:  

It is applied when the person speaking gives information about the past that is not related to the present.  


Knowing this, let’s begin with the answers:  

1. Right answer: Tú comenzaste ayer.

In this sentence the main verb is comenzar (to begin). This Spanish verb is conjugated in preterite with the second person in singular tú (you) as comenzaste (you began).

In english the sentence is written as follows:

You began yesteray

2. Right answer: Yo escribí una carta.

In this sentence the main verb is escribir (to write). This Spanish verb is conjugated in preterite with the first person in singular yo (I) as escribí (I wrote).

In english the sentence is written as follows:

I wrote a letter

3. Right answer: Nosotros vivimos en San Diego.

In this sentence the main verb is vivir (to live). This Spanish verb is conjugated in preterite with the first person in plural nosotros (we) as vivimos (we lived).

In english the sentence is written as follows:

We lived in San Diego

4. Right answer: Mis padres pagaron para la cena.

In this sentence the main verb is pagar (to pay). This Spanish verb is conjugated in preterite with the third person in plural ellos (they), which is the subject Mis padres, as pagaron (they paid).

In english the sentence is written as follows:

My parents paid for dinner

5. Right answer: Ellos jugaron el béisbol.

In this sentence the main verb is jugar (to play). This Spanish verb is conjugated in preterite with the third person in plural ellos (they), as jugaron (they played).

In english the sentence is written as follows:

They played baseball

b) Write both the infinitive form and the preterite yo form of the following verb.

The infinitive form of a verb is the verb in its basic form (in present), in other words is like the name or presentation of a verb as it appears in grammar or when you search in the dictionary .

It is usually preceded by to, but is not always necessary; this will depend on the context.

On the other hand, “the preterite yo form” of a verb is the conjugation of a verb in preterite or simple past tense with the fisrt person in singular yo (I).

Now, we have two verbs below, to pay (pagar) and to prefer (preferir):

1. to pay

Infinitive form: Pagar Preterite yo form: Yo pagué

2. to prefer

Infinitive form: Preferir Preterite yo form: Yo preferí

c) Right answer: almorzará  

In the sentence below according to the context, the right verb is almorzar (to lunch) conjugated in future with the third person in singular él (he) which is Mi abuelo (My grandfather), as almorzará (he will lunch or he will have lunch).

Therefore, the sentence is:

Hoy mi abuelo no come con nosotros. Él almorzará con unos amigos.

Today my grandfather does not eat with us. He will have lunch with some friends

The option traer (to bring) does not match with the context.


Quien puede sacar un certificado de nacimiento

Answers

Who can get a birth certification
Todos podemos sacar uno

Como podemos conocer la cantidad que representa un por ciento en una grafica circulat?

Answers

A pesar de esto aparentemente sencilloenfoque, el Área de Circulación a menudo se subestima.Foros, planificadores de instalaciones,diseñadores, arquitectos y bienes raíceslos profesionales han ajustado la circulaciónMultiplicador para alcanzar un objetivoÁrea utilizable, en lugar de reducir el espaciorequisitos para espacios individuales y de apoyo.Sin embargo, la circulación es un componente necesariode un programa espacial. Si la cantidad de áreadedicado a la circulación se subestima, elEl área utilizable programable puede no reflejar elcantidad necesaria para acomodar adecuadamenteel nuevo lugar de trabajo.

Say aloud the pairs of words in the table below and compare the sound of the letter in bold of the Spanish word in the left column to the sound of the letter in bold of the English word in the right column. For example, does the –a of América make the same sound as the –a of ancient? Does the –j of jalapeño make the same sound as the –h of house? After determining which letters in bold make the same sound, record the 5 identified pairs of words and submit them to your teacher. Example: jamón ham Similar Sound: j/h Similar Sound: The Spanish letter j makes the same sound as the English letter h. Spanish Sound English Sound América ancient amigo apple indio idea indio indian ¡Hola! Hello! jalapeño house María ladder Jaime ham yate yo-yo churro shower

Answers

1. The Spanish "a" in América (ahhh) does not sound like the English "a" in ancient (ayyy).

The Spanish "a" is more similar to the English "a" in "father." In fact, the Spanish "a" is always the same sound, whereas English has several "a" sounds (the most common being the short "a" - ant - and long "a" - ancient).

2. The Spanish "a" in "amigo" (ahhh) does not sound like the English "a" in "apple."

As always, the Spanish "a" sound does not change (and is more similar to the English "a" in "father," as described in the previous answer). However, the English "a" in "apple" is called the short "a," and is the same as the "a" in "cat," "ant," "had," etc.

3. The Spanish "i" in "indio" does not sound like the English "i" in "idea." 

The Spanish sound for "i" is always the same, and sounds like the English "i" in "is" or "lip." The English "i" in "idea" is a long "i," and sounds like the "i" in "ice cream" or "I'm." 

4. The Spanish "i" in "indio" is the same as the English "i" in "Indian."

As always, the Spanish "i" sound does not change, and is similar to the English "i" in "lip" or "is," as described in the previous answer. This sound in English is called the short "i" sound.

5. The Spanish "h" in "hola" is not the same as the English "h" in "hello."

Although both words start with the same letter, the "h" is silent in Spanish. So, "Hola" really sounds like "oh-la." In English, on the other hand, the "h" is pronounced (although there are some exceptions to these rules in both languages).

6. The Spanish "j" in "jalapeño" is the same as the English "h" in "house."

Although the "h" sound in Spanish is usually silent, the "j" is always pronounced like the "h" in "English." This is why "ham" and "jamón" (ha-mon, literally means "ham") sound similar, even if they are written with different letters.

7. The Spanish "r" in "María" is the same as the "dd" sound in "ladder."

The Spanish "r" is usually one of the more difficult sounds for English speakers to pronounce when speaking Spanish, because it's so different from the English "r." It's easier to pronounce if you practice words like "ladder" and "little," concentrating on the sound that comes out for "dd" and "tt."

8. The Spanish "j" in "Jaime" is similar to the English "h" in "ham."

As discussed in question 6, these different letters have corresponding sounds. Although we say "Jay-mee" in English, in Spanish it is pronounced "hi-meh."

9. The Spanish "y" in "yate" is the same as the English "y" in "yo-yo."

In addition to the Spanish "y" sound, the "ll" in Spanish is also pronounced like the English "y." For example, the verb "llamar" (to name) sounds like "ya-mar."

10. The Spanish "ch" in "churro" is not the same as the English "sh" in "shower."

The Spanish "ch" is more similar to the English "ch" (for example, chick or chill). In fact, the English "sh" sound does not exist in Spanish. 

Sara antes de cumplir los 13 años, ¿ (estudiar) tú otra lengua? josé sí, (tomar) clases de inglés y de italiano. dolores antes de ir a argentina, ¿ (probar) tú y tu familia el mate? tomás sí, ya (tomar) mate muchas veces. antonio antes de este año, ¿ (correr) usted en un maratón? sra. vera no, nunca lo (hacer). sofía antes de su enfermedad, ¿ (sufrir) muchas presiones tu tío? irene sí ... y él nunca (mantenerse) en buena forma. select reference tools. áéíñóúü¿¡ all caps

Answers

SARA Antes de cumplir los 13 años, ¿habías estudiado tú otra lengua? JOSÉ Sí, había tomado clases de inglés y de italiano.

DOLORES Antes de ir a Argentina, ¿habían probado tú y tu familia el mate? TOMÁS Sí, ya habíamos tomado mate muchas veces.

ANTONIO Antes de este año, ¿había corrido usted en un maratón? SRA. VERA No, nunca lo había hecho.

SOFÍA Antes de su enfermedad, ¿había sufrido muchas presiones tu tío? IRENE Sí y él nunca se había mantenido en forma.

Para seleccionar la palabra adecuada en cada caso, es importante considerar el contexto de la oración y el significado previsto de la palabra a utilizar.

Básicamente, el objetivo de este ejercicio es incorporar la palabra en la oración de manera que se mantenga el contexto general y, si es posible, se mejore o se complemente la descripción.

Choose the sentence that best describes the history of Guatemala's capital city.

The capital has always been Guatemala City.

The capital has always been Antigua.

The capital used to be Antigua, but is now Guatemala City.

The capital used to be Guatemala City, but is now Antigua.

Answers

The answer is C. The capital used to be Antigua, but is now Guatemala City.

¿Qué frase es cierta sobre los menonitas del Chaco? Los menonitas hablan los idiomas de los indígenas del Chaco. Los menonitas no se comunican con los indígenas. Los menonitas no salen de sus casas en el Chaco.

Answers

La respuesta es Los menonitas hablan los idiomas indígenas del Chaco.

What are some influences salsa music has?

A. Spanish, Dutch

B. African, Samoan

C. English, Chinese

D. African, Cuban, Puerto Rican and Jazz

Answers

I think is d isn't sure


Ordenacion de datos por metodo burbuja en introduccion de datos ciclo for

Answers

Creo Que la clasificación.

¿Cuál palabra es el opuesto (opposite) de 'inocente'?
castigo
ley
testigo
culpable

Answers

The answer is culpable. 

Answer:

The last one

Explanation:

Culpable

fill in the blank

¿cuándo ves a maría? -___ veo esta tarde

a. la
b. me
c. les
d. te

Answers

the answer is (a) la
The answer is A since it la in feminine and is just one person  

Complete the sentence by writing the subjective form of the verb in parentheses. Ella quiere que ellos ________ (irse) ahora.

Answers

Ella quiere que ellos se vayan ahora
Hope I helped you 
Espero haberte ayudado 

Se puede sacar el certificado de nacimiento puertorriqueño en estados unidos?

Answers

Solamente si usted nacío en los estados unidos si usted nacio en PR no Tiene Que ir a el hospital de nacimiento
Other Questions
What is the length of chord JK? Who was the first northern democrat elected to the presidency since 1968? determine the qotient of 7,684 and 78 Choose the sentence that best describes the history of Guatemala's capital city.The capital has always been Guatemala City.The capital has always been Antigua.The capital used to be Antigua, but is now Guatemala City.The capital used to be Guatemala City, but is now Antigua. As a healthier alternative to french fries, some fast food outlets offer pre-sliced, bagged apples as a side option. the ingredients list often reads, "apples and ascorbic acid." ascorbic acid is another name for vitaminc. what role does the ascorbic acid play in the product? ascorbic acid is a sequestrant that binds free metal ions and reduces the rancidity of fat in the apples. ascorbic acid is an antioxidant that prevents discoloration when the apples are cut and exposed to oxygen. ascorbic acid is a curing agent that prevents the growth of clostridium botulinum. ascorbic acid is a color additive that makes the color of the apples appear more vibrant. What are the causes of problems the milers and other Native American groups face in Guatemala how are people trying to solve these problems Which diagram shows the most useful positioning of a rectangle in the first quadrant of a coordinate plane? Answers are in the pictures. In an attempt to stem the rising tide of illegitimacy rates and single-parent families among the poor, which act mandated two-parent coverage for all state afdc programs? the family support act in 1988 the supplemental security income the affordable care act temporary assistance to needy families Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3')? view available hint(s) where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3')? it would not bind the target dna. ttttagccatttacgattaatcg ttttagccatttacgattaatcg ttttagccatttacgattaatcg? For the electric field shown, which of the following statements describes an increase in voltage?A) A negative charge crosses an equipotential line toward the source charge.B) You cannot tell from the information given.C) A positive charge crosses an equipotential line toward the source charge.D) A positive charge moves along an equipotential line.UPDATE: ANSWER IS C Which organisms are both secondary and tertiary consumers in the food web Laura is completing a craft project that involves covering only the lateral surface of a cylindrical container with fabric. The cylinder has a height of 16.8 in. and a radius of 14.6 in. To the nearest square unit, how much fabric does she need for this project? Use a calculator. Marie has left written instructions directing doctors and family members to avoid or stop using life-sustaining procedures in the event of a terminal condition. such an instrument is called the A solution in which the hydroxide-ion concentration is 1x10^-2 is The difference between two numbers 2.when each number is rounded to the nearest hundred , the difference between them is 100. What Numbers Could these be? What prevents bacteria and materials in the large intestine from flowing backward into the ilieum of the small intestine? "Iconography" is best described as A. identifying, describing, and interpreting subject matter in art. B. writing about artwork. C. organizing a collection of images by style. D. discovering and cataloging artifacts. how to tell if the histogram is is right skewed I ________ hearing about the heros on last night's news. A. recall B. regular C. reduce D. responsible which was an outcome of the Nazi governments final solutionhitler shot himself with a pistolthe allies dropped the atomic bomb millions died in german death campgermany surrendered to the alliesim thinking the answer is A but i just wanna be sure