3. consider the forces acting on a car. when the car is accelerating, it will move in the direction of the net force. this is because the force of the engine is large enough to overcome the forces of friction and air resistance. however, objects do not always move in the direction of the net force. explain how this would be the case for a car coming to a stop at a traffic light. your answer should include a diagram showing the forces acting on the vehicle.

Answers

Answer 1

The force that accelerates the car is the static friction force.

What is acceleration?

Acceleration is a rate at which velocity changes with time, in terms of both speed and direction. A point or an object moving in a straight line is accelerated if it speeds up or slows down.

According to the condition,

When the car is accelerating, it will move in the direction of the net force. this is because the force of the engine is large enough to overcome the forces of friction and air resistance.

However, objects do not always move in the direction of the net force.

To accelerate something, there needs to be a force from the outside. For the car accelerating from rest, the only thing acting on it in the forward direction is the friction due to the ground.

The force that accelerates the car is the static friction force. It is the only external force acting forward on the car and is therefore responsible for its acceleration per Newton's second law.

That force is the equal and opposite reaction to the force the wheel exerts backward on the ground per Newton's third law.

The below diagram shows the exact answer.

Learn more about  acceleration here:

https://brainly.com/question/12550364

#SPJ2

3. Consider The Forces Acting On A Car. When The Car Is Accelerating, It Will Move In The Direction Of

Related Questions

Help me asap its due today

Answers

Answer:

[tex]3.54* 10^{22}[/tex] N

Explanation:

Using the formula you gave:

[tex]F_g = \frac{6.67*10^{-11}*2.0*10^{30}*5.97^{24} }{(1.5*10^{11})^2 }[/tex]

Which of the following statements is true concerning mechanical waves and electromagnetic waves?

A
Both electromagnetic waves and mechanical waves require a medium to travel through.

B
Mechanical waves require a medium to travel through; electromagnetic waves do not.

C
Electromagnetic waves require a medium to travel through; mechanical waves do not.

D
Neither electromagnetic waves nor mechanical waves require a medium to travel through.

Answers

Answer:

B

Explanation:

Electromagnetic spectrum includes visible light which we see all the time reflecting off objects to give them colours, mechanical waves like sound require something to move in, its the reason why people say you can't scream in space because space is a giant vacuum. No not the kind you use to clean up the mess you made from breakfast. The kind that has no air. So sound can be heard on earth as it is not a vacuum, air moves freely and transfers sounds vibrations all around you to be absorbed by walls and other stuff in comes in contact with.

Extra information:

Sound travels further in water because the molecules are closer together meaning that transferring the energy is easier. This is how Blue wales can communicate from hundreds of miles away.

Ingrid is moving a box from the ground into the back of a truck. She uses 20 N of force to move the box 5 meters. If she uses an inclined plane to reduce her force to 10 N which of the following statements will be true?

A. She will decrease the amount of work done.
B. She will make her work efficiency 100 percent.
C. She will increase the distance the box moves.
D. All of the above.

Answers

Answer:

C

Explanation:

What is meant by the phrase "color by subtraction of
light?"

Answers

Answer: adding green, red, and blue light produces white light

Explanation:the process of color subtraction is a useful way of predicting the color appearance of an object, if the color of the light and pigments are known. If you use the complementary color scheme, the colors of light that will be absorbed by a given material are determined.

Final answer:

The phrase "color by subtraction of light" describes the process where color is created by absorbing certain wavelengths while reflecting others, used in subtractive color theory applications like printing and photography.

Explanation:

Subtractive Color Theory

The phrase "color by subtraction of light" refers to the subtractive color theory, which is a method of creating color by filtering out certain wavelengths of light. This concept is commonly used in color printing and photography, where colors are produced by absorbing parts of the light spectrum and reflecting the rest. For example, when blue paint is applied to a canvas, it absorbs all colors except for blue, which is reflected back to the eyes of the viewer.

In subtractive color mixing, the primary colors are red, yellow, and blue. When these are mixed, they produce the secondary colors of green, orange, and purple. This is the opposite of additive color theory, where colors are created by mixing different lights (red, green, and blue) and the combination of all creates white light. The sensation of color in photographic transparencies is achieved by the substrate absorbing specific wavelengths of light — for instance, to display blue, the material must absorb yellow light.

Subtractive color theory is essential in the development of the CMYK color model, which uses cyan, magenta, and yellow as primary colors, and is central to processes such as full-color printing and other applications where pigmentation and light reflection play a critical role in color creation.

A 500 kg empty elevator moves with a downwards acceleration of 2 m/s2. What is the tension force of the cable on the elevator? 5000 N 4000 N 6000 N 1000 N

Answers

Answer:

T = 4000 N

Explanation:

We have,

Mass of an elevator, m = 500 kg

It is moving downward with an acceleration of [tex]2\ m/s^2[/tex]. It is required to find the  tension force of the cable on the elevator. We know that when the elevator is moving downward, the net force on it is given by :

[tex]F=m(g-a)[/tex]

g is acceleration due to gravity

[tex]F=500\times (10-2)\\\\F=4000\ N[/tex]

So, the tension force of the cable on the elevator is 4000 N.

A light bulb is connected to a 2V supply and experiences a current of 6.4A. What is the power rating of the bulb?

Answers

Answer:

12.8 Watts

Explanation:

P = VI

P = (2 V) (6.4 A)

P = 12.8 W

The power rating of the bulb will be 12.8 Watts. Power rating is an efficiency perameter.

What is the power rating?

The maximum power input allowed to pass through a piece of equipment is known as the equipment's power rating.

The given data in the problem is;

V is the voltage supply=  2V s

I is the current = 6.4A.

P is the power rating of the bulb =?

The power rating of the bulb is found as;

[tex]\rm P = VI \\\\ \rm P = 2 \times 6.4 \\\\ \rm P =12.8 \ Watt[/tex]

Hence the power rating of the bulb will be 12.8 Watts.

To learn more about the power rating refer to the link;

https://brainly.com/question/13787703

What is the mass of an object that is hanging 12.6 m above the surface of the earth and has a gpe of 2778.3 J

Answers

Final answer:

To find the mass of an object hanging 12.6 m above the surface of the earth is approximately 22.04 kg.

Explanation:

The mass of an object can be determined using the formula for gravitational potential energy (G.P.E). G.P.E. is calculated using the formula G.P.E. = mgh, where m is the mass in kg, g is the acceleration due to gravity which is approximately 10 m/s², and h is the height in meters.

To find the mass, rearrange the formula to: m = G.P.E. / (g * h).

Substituting the given values into the formula, we have m = 2778.3 J / (10 m/s² * 12.6 m). Solving this equation gives us the mass of the object.

Calculating the mass, m

= 2778.3 J / (10 m/s² * 12.6 m)

m ≈ 22.04 kg


pls help asap
What is the mechanical advantage of this pulley system?

A. 1/2
B. 1
C. 2
D. 3

Answers

I’m pretty sure the answer is a

Answer:

D

Explanation:

i took lots of time on the lesson

A slinky forms it’s third harmonic standing wave when the input frequency is 24 Hz. What is the fundamental frequency of the slinky? Will an input frequency of 28 Hz create a standing wave? Explain your answer.

Answers

Answer: The fundamental frequency of the slinky = 8Hz

An input frequency of 28 Hz will not create a standing wave

Explanation:

Let Fo = fundamental frequency

At third harmonic,

F = 3Fo

If F = 24Hz

24 = 3Fo

Fo = 24/3 = 8Hz

If an input frequency = 28 Hz at 3rd harmonic

Let find the fundamental frequency

28 = 3Fo

Fo = 28/3

Fo = 9.33333Hz

Since Fo isn't a whole number, it can't create a standing wave

Which sound wave features are being described?

Answers

Answer:

Number of wavelengths

-----------------------------------  :  ⇒ Frequency

              Time

Distance traveled

--------------------------  :  ⇒ Speed

          Time

Some features of sound wave that describes the motion of the sound wave include wavelength, speed and frequency.

Features of sound wave

There are several features of sound wave that decribes the motion of the sound wave and some of the features include;

Wavelength: This is the distance traveled by the sound waveFrequency: This the number of cycles per unit time made by the sound waveSpeed: This is the rate of change of distance with time of motion of the wave.

Learn more about sound wave here: https://brainly.com/question/1199084

5. Describe the sequence of mechanical
energy events that lets you hear the muffled
sound of a radio from inside your neighbor's
closed house. Write your response in your
Science Journal. sc.7.P.10.3

Answers

Answer:

Answer:

Starting from the beginning.

There is a radio signal that is received by the radio.

The radio interprets the signal and produces a current in response to it.

That current goes to a membrane that oscillates producing sound, the oscillation of the membrane is the first mechanical energy event here.

These oscillations can travel in material mediums, for example, the air. Then there is a production of waves (soundwaves) that travel in the air (second event).

Those waves now hit the wall that separates you and your neighbor, as the wall is made of a material, the soundwaves can travel through it, but they will be dispersed (a part of the waves rebounds on the wall, and another part is dissipated as the wave travels through the wall), there is also a transmitted part of the wave, that is now in your house. (this change of medium will be the third event). Now only the lower frequencies survive, this is why the sound is "muffled".

Those remaining frequencies now travel in your house, and when they reach your ear, your ear sends a signal to your brain and your brain interprets them as sound. The wave interacting with your ear will be the fourth and last mechanical energy event.

Explanation:

Final answer:

The sequence of mechanical energy that allows you to hear a muffled radio sound includes the radio's speaker vibrations creating sound waves, which then cause a house's walls to vibrate and transfer the sound externally.

Explanation:

The sequence of mechanical energy events that allow you to hear the muffled sound of a radio from inside your neighbor's closed house starts with the radio producing sound waves. These sound waves are created by the vibration of the radio's speakers, which cause the air molecules around them to vibrate as well. The vibrating air molecules then transfer the energy to the walls of the house, which vibrate slightly and in turn, transfer some of this vibrational energy back to the air on the outside of the house. Despite being reduced in energy, these vibrations can still create sound waves in the outside air that may reach your ears as a muffled sound.

During the process, energy is conserved as it changes forms, from the electrical energy used to power the radio turning into sound energy, which is then transformed into mechanical energy as the house's walls and structure vibrate. Ultimately, when these vibrations reach your ears, tiny bones in your inner ear vibrate, translating these mechanical vibrations into electrical signals that your brain interprets as sound.

What do we call the substances that react together (break/form chemical bonds) to form new substances?

A)reactants

B)products

C)none of the answers are correct

D)catalysts

Answers

Answer: A) reactants

Explanation:

Reactants are the substances that have chemical reactions when they are combined, whereas the product is what comes from the reactants’ chemical reactions.

Answer:

A)reactants

Explanation:

I think the correct answer is reactants because the substances that go into a chemical reaction are called reactants.

Sorry if it's wrong:(

Explain why decomposition use solar energy?

Answers

Answer: Decomposition uses solar energy because for hydrogen and oxygen.

Explanation:

PLEASE HELP BRAINLIEST!!! 15 MIN!!!
A current can be produced in a coil of wire _____.

a.as a core of iron is being thrust through the coil
b.when a magnet rests in the coil
c.when a core of iron rests in the coil
d.as a magnet is being thrust through the coil

Answers

D.as a magnet is being thrust through the coil

D.

A current can be produced in a coil of wire as a magnet is being thrust though the  coil.

Brainliest, please?

Describe the relationship between force and mass when the acceleration of two objects remain constant

Answers

Answer:

If they both remain constant they ain't moving, It states that the rate of change of velocity of an object is directly proportional to the force applied and takes place in the direction of the force. It is summarized by the equation

Explanation:

How does reverberation explain why your voice sounds different in a gym than it does in your living room

Answers

Sound can reach the inner ear by way of two separate paths, and those paths in turn affect what we perceive. Air-conducted sound is transmitted from the surrounding environment through the external auditory canal, eardrum and middle ear to the cochlea, the fluid-filled spiral in the inner ear. Bone-conducted sound reaches the cochlea directly through the tissues of the head.
When you speak, sound energy spreads in the air around you and reaches your cochlea through your external ear by air conduction. Sound also travels from your vocal cords and other structures directly to the cochlea, but the mechanical properties of your head enhance its deeper, lower-frequency vibrations. The voice you hear when you speak is the combination of sound carried along both paths. When you listen to a recording of yourself speaking, the bone-conducted pathway that you consider part of your “normal” voice is eliminated, and you hear only the air-conducted component in unfamiliar isolation. You can experience the reverse effect by putting in earplugs so you hear only bone-conducted vibrations.
Some people have abnormalities of the inner ear that enhance their sensitivity to this component so much that the sound of their own breathing becomes overwhelming, and they may even hear their eyeballs moving in their sockets.

Reverberation is why your voice sounds different in a gym compared to a living room; hard surfaces in a gym increase reverberation time, creating echoes that can make sound seem mushy, while softer surfaces in a living room shorten it, providing clearer sound quality.

Reverberation explains why your voice sounds different in a gym compared to your living room due to the unique acoustic properties of different environments. In a gymnasium, the hard surfaces result in a longer reverberation time as sound waves bounce off and overlap each other, creating what is known as the comb effect. This often leads to mushy or muddled musical sounds and makes speech more difficult to understand due to the multiple echoes. Conversely, a living room typically has softer surfaces and objects that absorb sound, resulting in shorter reverberation times and a clearer, more intimate sound quality.

Reverberation provides us with clues about the size of a space and its material composition, affecting our perception of sound. For instance, large concert halls are designed with optimal reverberation times to enhance music, while spaces intended for speech, like lecture halls, aim for shorter reverberation to maintain speech clarity. Adjusting the level of reverberation can also add fullness to recorded voices or create the illusion of a different performance space.

1. If a Creature Cat's Ferrari With an initial speed of 15 m/s, accelerates at a rate of 60/m/s/s for 5 s, what
will the final speed be?

Answers

Answer:

v = 315m/s

Explanation:

a = v - u /t

a = acceleration 60m/s2

v = final speed

u = initial speed 15m/s

t = time 5 secs

Therefore

60 = v - 15 /5

Cross multiply

v - 15 = 60 x 5

v - 15 = 300

Add 15 to both sides

v - 15 + 15 = 300 + 15

v = 315m/s

How much work is done by gravity when a pine cone (of mass 50g) falls from the top of a tree, 9 m high?

Answers

4.5 Joules. I think it'd be 4.41, but when you round it, it's 4.5.

Final answer:

The work done by gravity on a 50g pine cone falling from a 9 m high tree is 4.41 Joules, as calculated using the gravitational potential energy formula.

Explanation:

The amount of work done by gravity on a falling object is equal to the change in the object's gravitational potential energy (GPE). The GPE formula is GPE = mgh, where m is the mass in kilograms, g is the acceleration due to gravity (9.8 m/s² on Earth), and h is the height in meters. For a pine cone with a mass of 50g (which is 0.05 kg) falling from a height of 9 m, the work done by gravity is:

GPE = mgh = (0.05 kg) x (9.8 m/s²) x (9 m) = 4.41 Joules

Thus, 4.41 Joules of work is done by gravity when the pine cone falls from the top of a 9 m high tree.

HELP ASAPPP PLZZZ I HAVE A TIMER WILL GIVE YOU THE 30 POINTS

Answers

It holds the atoms together (aka your last option)

An endothermic reaction is defined as a reaction that _____.
A. requires heat or light
B. releases heat or light
C. has more than one product
D. has more than one reactant

Answers

Answer:

B.) Releases heat or light

Explanation:

B. Releases heat or light

5. What two factors can increase the force of air resistance for an object?

Answers

Answer:

The two most common factors that determine the air resistance are the speed of the object and its cross-sectional area. Greater speed causes greater air resistance, and increased area increases air resistance as well. It also depends on an object's shape.

To keep the topic simple, it can be said that the two most common factors that have a direct effect upon the amount of air resistance are the speed of the object and the cross-sectional area of the object. Increased speeds result in an increased amount of air resistance.

If you wanted to soundproof a room what insulator would you use

Answers

Answer:

foam but thats what i heard from other people

Explanation:

Answer:

If you want to make your insulation even more effective at blocking and absorbing noise that passes through walls or ceilings, you can add a few finishing touches before replacing the drywall. As I’ve explained in my article on the best wall soundproofing, you can add a layer of MLV over the insulation .

Explanation:

Waves move faster in..

A) low-temperature gasses.
B) low-temperature solids.
C) high-temperature gases.
D) high-temperature solids.

Answers

High temperature solids (d)
It would be high temperature solids

Explain Einstein's General Relativity Theory. ​

Answers

Answer:

The general theory of relativity (or general relativity for short) is a major building block of modern physics. It explains gravity based on the way space can 'curve', or, to put it more accurately, it associates the force of gravity with the changing geometry of space-time.

General relativity is a metric theory of gravitation. At its core are Einstein's equations, which describe the relation between the geometry of a four-dimensional pseudo-Riemannian manifold representing spacetime, and the energy–momentum contained in that spacetime.

Which statement best summarizes Newton's law of action-reaction? *
Friction slows objects.
All forces act in pairs.
Force equals mass times acceleration.
O
An object in motion tends to stay in motion.​

Answers

Answer:

The correct answer is the third

Force equals mass times acceleration

Explanation:

Newton's second law says that force equals mass times the acceleration of the body

            F = m a

This is the most used way to solve problems

The correct answer is the third

Newton's third law states that forces always work in pairs, by action and reaction

Newton's first law states that an object per macerate with constant speed unless some force modifies this state.

The pitch of a sound wave is related to wrich property?
A Wavelength
B. Amplitude
C. Volume
D . Frequency

Answers

Answer:

Frequency

Explanation:

It would be D- Frequency
the frequency of a sound wave is what your ear understands as pitch

NEED HELP please.
1.) A laser beam is reflected by a plane mirror. It is observed that the angle between the incident and reflected beams is 46 degrees. What is the angle of the incident?;


2.) A ray of light reflects from a plane mirror with an angle of incident of 25 degrees. What is the angle between the plane of the mirror and the reflected beam?

Answers

Answer:

1. 23°

2. 65°

Explanation:

1.

The law of reflection provides that for the same medium, the angle of reflection equals the angle of incidence.

Similarly, here, angle of incidence and reflection will be 46°÷2=23°

2. Since the normal, angles of reflection and incidence lie on the same plane and also the angles of reflection and incidence are equal then the angle between the plane of the mirror and the reflected beam will be given by 90-25=65°

Final answer:

To address the two light reflection questions: 1.) The angle of incidence, when the angle between incident and reflected beams is 46 degrees, is 23 degrees. 2.) When a light ray reflects from a mirror with an angle of incidence of 25 degrees, the angle between the plane of the mirror and the reflected beam is 65 degrees.

Explanation:

The question involves understanding the law of reflection, which states that the angle of incidence is equal to the angle of reflection. This law is fundamental in analyzing how light interacts with reflective surfaces such as mirrors.

1.) If the angle between the incident and reflected beams is 46 degrees, then considering the law of reflection, we must recognize that the angle of incidence is half the angle between the beams because the incident ray and the reflected ray make equal angles with the normal to the mirror surface. Therefore, the angle of incidence is 46 degrees / 2, resulting in an angle of incidence of 23 degrees.

2.) Given an angle of incidence of 25 degrees, the reflected beam will also be at an angle of 25 degrees with the normal (due to the law of reflection). The angle between the plane of the mirror and the reflected beam, which is asked for, is not the same as the angle of reflection. In this case, since angles are measured from the normal, the angle between the mirror plane and the reflected beam is 90 - 25 = 65 degrees.

Which compound should require the highest temperature to melt? LiF, NaF, LiCl, NaCl

Answers

Answer: lif

Explanation:

lif is the answer i checked it and the person above is one hundred percent wrong. lif is the right answer.

what can you infer about fossil fuels from their name

Answers

Answer:

Fossil fuels come from the ground and are millions of years old

Explanation:

Fossil fuels come from the ground. i can infer and tell because most fossils are in the ground and also fossils are millions of years old. Fossil fuels are hydrocarbons, primarily coal, fuel oil or natural gas, and is from the remains of dead plants and animals. In  dialogue, the term fossil fuel also includes hydrocarbon-containing natural resources that are not derived from animal or plant sources.

What is your volume of the object?
30 cm3
35 cm3
42 cm3
54 cm3

Answers

The answer is 54 cm3
Other Questions
Solve for r 12-1/5r=2r+1 What are two causes of soil loss? Jana made a table to help her review the types of mutations for an exam. She started with the sequence THE MAN SAT TALL. Which statement best describes Janas error in the table? The insertion sequence should be the deletion sequence. The substitution sequence should be the insertion sequence. The insertion and deletion sequences should be switched. The substitution and deletion sequences should be switched. This group was formed in the Georgia General Assembly in 1960 for the purpose of gathering public reaction to Federal orders to integrate public schools within the state. From the Khan Academy Video on Impact of Media Evolution on Politics (Slide #2), what example of early newspapers influenced the ratification (passing) of our US Constitution? (Hint: we learned this earlier in the yearwhat group believed in a Strong Central Government?) What are the three domains of life?Plantae, Animalia, and Fungiclass, kingdom, and phylumEubacteria, family, and EukaryaBacteria, Archaea, and Eukarya 5c + cd, c = 1.5 d = 15 11. A wasp lays its eggs on a caterpillar. When the wasp eggs hatch, the larva will eat the caterpillarand kill it. *(2 Points)OA. ParasitismOB. MutualismOC. Commensalism what is the length of bc in the triangle below Research paper assignment Why didnt America help in the French Revolution? Was it justified? What was a characteristic of the rulers of the Zhou dynasty? A photo is printed on a 20-inch by 24-inch piece of paper. The photo covers 320 square inches and has a uniform border. What is the width of the border? At the local airport, you set off the alarm on the magnetometer. If you announce, "Never mind, I don't want to fly today," Can the security officials still detain you and search you for weapons? PLEASE HELP!! DUE TODAY! I GIVE BRAINLIEST Why can a theory never become a law Why do you think Dreiser wrote this piece? What is he attempting to say by writing about his brother? Solve for x. Write both solutions, separatedby a comma.5x2 + 2x - 7 = 0 What causes the trade winds? Read the following paragraph and answer the question below.1Wuthering Heights is in the midst of the desolate English moors. 2Outside the gates of this solitary dwelling, the landscape expands into dreary shades of brown and gray, with only the craggy cliffs on the distant horizon to break the monotony. 3Wildlife and foliage are scarce. 4The few trees that do live must eke out their existence: the north wind blows constantly. 5The house itself, built to withstand the tumults of wind and rain, is cold and forbidding. 6The stone walls and earthen floors offer no relief from the bone-chilling dampness of northern England. 7In sharp contrast to Wuthering Heights is Thrushcross Grange. 8Situated in a sheltered valley, Thrushcross Grange is calm and peaceful, and is surrounded by lush flower gardens. 9The refined elegance of Thrushcross Grange differs as much from Wuthering Heights as the rose differs from the thorn. 10The contrast between these two settings is symbolic of the ultimate conflicts in Emily Bronte's novel Wuthering Heights.Name the shape of the paragraph. __________ .A)regular triangle B)inverted triangle C) diamond D) rectangle Below is the double-stranded DNA sequence of part of a hypothetical yeast genome. Within this sequence is a small gene, PICO8, that codes for an 8 amino-acid peptide (assume traditional start codon). Transcription of PICO8 starts at the Transcription Start Site (TSS) after the promoter and proceeds in the direction of the arrow. Transcription stops at the end of the transcription terminator. 5' - CTATAAAGAGCCATGCATATCTAGATAGTAGGCTCTGAGAATTTATCTCACT - 3 3 - GATATTTCTCGGTACGTATAGATCTATCATCCGAGACTCTTAA ATAGAGTGA - 5 promoter terminator Which strand of DNA is the CODING strand? (TOP OF BOTTOM?) Select only ONE answer choice. A. Top B. Bottom C. Either can serve as the codong strand D. There isn't enough information to determine which is the coding strand