A chemist dilutes a 1.0 mL sample of 2.0 M KNO3 by adding water to it. If the concentration of the solution that is obtained is 0.0080 M, what is its volume? Use mc016-1.jpg.

Answers

Answer 1
250 ml.  Use the equation 

 (initial concentration) x (initial volume) = (final concentration) x (final volume)

So:

(2 M) x (1ml) = (.008 M) x (X ml)

X = 250 ml
Answer 2

Answer: The volume of the diluted solution is 250 mL.

Explanation:

To calculate the molarity of the diluted solution, we use the equation:

[tex]M_1V_1=M_2V_2[/tex]

where,  

[tex]M_1\text{ and }V_1[/tex] are the molarity and volume of the concentrated [tex]KNO_3[/tex] solution

[tex]M_2\text{ and }V_2[/tex] are the molarity and volume of diluted [tex]KNO_3[/tex] solution

We are given:

[tex]M_1=2M\\V_1=1mL\\M_2=0.008M\\V_2=?mL[/tex]  

Putting values in above equation, we get:  

[tex]2\times 1=0.008\times V_2\\\\V_2=250mL[/tex]

Hence, the volume of the diluted solution is 250 mL.


Related Questions

during _____, the cell uses information from messenger RNA to produce proteins

Answers

Answer: Translation.

Explanation: Translation is a step in the protein synthesis where the genetic information is carried from the DNA in the form of series of three base code words.

Each code represents a particular amino acid. During this step only the coding is decoded to produce the specific sequence of the amino acids in the polypeptide chain.

Which of the biomolecules below includes a polydentate ligand called a porphyrin? hemoglobin chlorophyll cytochrome c carbonic anhydrase?

Answers

The correct answer is haemoglobin.
Porphyrins are a group of heterocyclic macrocycle organic compounds with the function to absorb strongly in the visible region of the electromagnetic spectrum. Those molecules are composed of four modified pyrrole subunits connected with carbon atoms. Porphyrins are the conjugate acids of ligands. They bind metals, like iron to form complex- heme which is the component of haemoglobin.

The biomolecule from the given option that includes a polydentate ligand named Porphyrin is called Hemoglobin.

What is Porphyrin?

A porphyrin is a molecule with large rings made up of four pyrroles, which are smaller rings composed of four carbons and one nitrogen. These pyrrole molecules are linked together by a sequence of single-double bonds, forming a large ring known as tetrapyrrole.

Porphyrins are responsible for the red hue color of blood in mammals. These porphyrin molecules are used in the formation of -heme groups in mammals.

The nitrogen molecules in the ring's core have the ability to house an iron molecule that is responsible for the red color of blood called Hemoglobin.

Learn more about porphyrin here:

https://brainly.com/question/16522092

What makes up scientific argument

Answers

The major ingredient of scientific argument is scientific evidence and known science concepts. Thus through scientific idea, expectations and observations a scientific argument is given birth to. Scientific argument are usually arrived at by mean of scientific methods. 
The scientific argument should have scientific facts, not just opinions, and supporting ideas that can help its argument be considered by the judges and the public. They have to support to their arguments and present their findings which is not manipulated at all.

Which of the 3 muscles have cells that are shaped like cylinders with pointy ends?

Answers

This would be the smooth muscle type. Skeletal muscles are much more cylindrical, but they do not terminate at a point, so I believe you are referring to smooth muscle cells.

This is the organizational level between Family and Class in scientific classification schemes.

Answers

Order (domain, kingdom, phylum, class, order, family, genus, species)

The organizational level between Family and Class in scientific classification schemes is in order like this domain, kingdom, phylum, class, order, family, genus, species.

What is organisation level in the living things?

In the case of living things first of all they are made up of cell and the cell is known as the basic and fundamental unit of the living things, after that cells combined and they form tissue, or we can say that group of cell is known as tissue.

Tissues combined together and they form muscles and these muscles are of several types and after that muscles combined together and they form organ and each of the organ of the body is made up of different types of tissue. Like heart is made up of such type of tissue that never takes rest.

At last the organs or we can say that two three organs combined together to form the organ system of the body such as nervous system, respiratory system, and these systems combinedly form the whole organism.

Therefore, The organizational level between Family and Class in scientific classification schemes is in order like this domain, kingdom, phylum, class, order, family, genus, species.

Learn more about organizational level here:

https://brainly.com/question/6046013

#SPJ6

The text indicates that the clusters of teenage suicides that occasionally occur in some communities may be the result of

Answers

Social influence I believe is the answer

Population growth how is population growth naturally regulated answer key

Answers

Population growth comes from a balance between food supply and predators. When pray increases food supply decreases, since they are eating them alot. As a result some of the prey dies off since there isn't enough food for them. Then the food supply increases but then suddenly dies off after pray comes backs and eats them. As a result the cycle continues

The natural regulation of population growth can occur through a variety of factors that are intrinsic to the ecosystem and the species themselves. These factors can be categorized into two main types: density-dependent factors and density-independent factors.

Density-Dependent Factors:

1. Competition for Resources: As the population size increases, the availability of resources such as food, water, and space becomes limited. This leads to increased competition among individuals, which can result in decreased birth rates and increased death rates due to starvation, stress, and disease.

2. Predation: Predators tend to eat more from abundant prey populations, which can help control the growth of these populations. As the prey population grows, the number of predators may also increase, further regulating the prey population.

3. Disease: Diseases can spread more rapidly in dense populations. High population density facilitates the transmission of pathogens, which can lead to increased mortality rates.

4. Parasitism: Similar to predation, parasites can have a significant impact on host populations. Higher host densities can lead to higher parasite loads, which can reduce host survival and reproductive success.

5. Territoriality and Intraspecific Competition: Many animals defend territories that provide the necessary resources for survival and reproduction. As populations grow, the size of these territories may shrink, leading to reduced reproductive success and increased mortality due to aggression and stress.

Density-Independent Factors:

1. Weather and Climate: Extreme weather events such as droughts, floods, storms, and temperature extremes can affect populations regardless of their density. These events can cause widespread mortality that is not related to the size of the population.

2. Natural Disasters: Earthquakes, volcanic eruptions, and fires can destroy habitats and cause mass mortality, impacting population sizes independently of population density.

3. Human Activities: Human-induced changes to the environment, such as pollution, habitat destruction, and the introduction of invasive species, can also regulate population growth. These factors can have catastrophic effects on populations, often independent of population density.

Carrying Capacity:

The carrying capacity of an environment is the maximum population size that the environment can sustainably support. When a population reaches or exceeds the carrying capacity, the limiting factors mentioned above become more pronounced, and the population growth is naturally regulated to bring it back to a sustainable level.

In summary, population growth is naturally regulated by a combination of density-dependent and density-independent factors. These regulatory mechanisms ensure that populations do not exceed the carrying capacity of their environment for extended periods, thus maintaining ecological balance.

Because the concordance rate for bipolar disorder among identical twins is _____, biological causal explanations are _____.

Answers

Bipolar disorder is a mood disorder characterized by alternating periods of mania mental illness marked by periods of great excitement, euphoria, delusions, and overactivity), and depression.

Concordance rates or the presence of bipolar disorder among identical twins is reported to be as high as 85%.  Biological causal explanations are: there is considerable overlap between the genes and imbalances in serotonin activity. Omega-3 fatty acids are reported to  provide protection from bipolar disorder

1.04 properties of water

Answers

Properties of water
1. As universal solvent
2. Specific heat capacity
3. High heat of vaporization
4. surface tension

Water is a unique substance with properties such as being tasteless, odorless, and transparent, and existing in all three physical states naturally. It is a polar molecule and an excellent solvent, with high melting and boiling points due to strong hydrogen bonding. These properties are essential for life and various chemical reactions.

Water is an extraordinary substance with several unique properties that are essential for life. Firstly, water is a liquid at standard temperature and pressure, and it is tasteless, odorless, and transparent. The color of water and ice has a slight blue hue in large quantities, while small amounts appear colorless. Water can exist naturally in all three physical states: solid, liquid, and gas. This versatility is crucial for the planet's water cycle.

Chemically, water is a polar molecule, consisting of two hydrogen atoms bonded to an oxygen atom, creating a dipole moment where the oxygen atom has a partial negative charge, and the hydrogen atoms have partial positive charges. This polarity contributes to water's role as an excellent solvent, sometimes referred to as the 'universal solvent,' because it can dissolve many substances, facilitating numerous chemical reactions.

Water also has unusually high melting and boiling points for a small molecule, at 0°C and 100°C, respectively. This is due to strong intermolecular hydrogen bonding between water molecules. Additionally, water has a high specific heat capacity, meaning it can absorb a lot of heat before increasing in temperature, and a high heat of vaporization, which is the energy required to convert it from liquid to gas. Interestingly, water's solid phase (ice) is less dense than its liquid phase, allowing ice to float, which is crucial for the survival of aquatic life during freezing conditions.

Water is tasteless and odorless.Water is transparent, enabling sunlight to penetrate for aquatic photosynthesis.Water is an excellent solvent, referred to as the 'universal solvent.'Water has high melting and boiling points due to strong hydrogen bonding.Water has a high specific heat capacity and high heat of vaporization.

Complete Question:

What are some properties of water?

_____ is is an inflammation of the nerve that connects the forearm to the palm of the wrist.

Answers

Answer:   Carpal tunnel syndrome (CTS) is an inflammation of the nerve that connects the forearm to the  palm of the wrist.

Explanation: Carpal tunnel syndrome is an inflammation in hand. Excess pressure in the hand is the reason of Carpal tunnel syndrome. Pain , swelling , numbness in the hand are the common symptoms of Carpal tunnel syndrome. CTS can be treated by applying cold packs on the swelling , by avoiding excess pressure on hand and by giving rest to the hand.

An example of a salad that could be consumed by a vegetarian to maximize iron absorption would be: iceberg lettuce and ranch dressing. spinach and cottage cheese. all fruit salad. spinach and mandarin orange. iceberg lettuce and carrots.

Answers

The answer is spinach and cottage cheese.

In a complex food web what would be the most likely result of removing one species of a secondary consumer

Answers

If you remove a secondary consumer then, primary consumers have the chance to overpopulated and Tertiary consumers underpopulate or die off because there's no secondary consumers to eat

using the chart, translate the mRNA into amino acids. (amino acids abbreviations plz)

Answers

In order, it's: Met or Start, Ala

The ________ is a microtubule structure that binds to sister chromatids to separate them in anaphase

Answers

The answer is spindle fiber.

In the human body, muscle cells have an increased need for energy during exercise. To help supply this energy, the body will immediately increase -

f the need for waste products to be retained
g food intake to increase the substances
available for respiration
h the breathing rate to supply more oxygen to
cells for the release of energy
j activity in the nervous system to stimulate
intake of carbon dioxide

??????

Answers

The correct answer is option (h) the breathing rate to supply more oxygen to cells for the release of energy.

Breathing refers to the process of inhaling oxygen and exhaling carbon dioxide from the lungs. A normal breathing rate at rest is around 15 breathes per minute which is significantly increased to 40 -50 breathes per minute during vigorous activity or excercise.

During exercise, the breathing rate, pulse rate and lactic acid levels increase in the human body. Muscle cells have an increased need for energy and heart pumps more oxygen to the muscle cells to meet the requirement. Breathing rate increases to supply more oxygen to the muscle cells which is required for the oxidation of the glucose, release of more energy and to get rid of the carbon dioxide.


During exercise, muscle cells require increased energy. To help supply this energy, the body will immediately increase: h. the breathing rate to supply more oxygen to cells for the release of energy.

During exercise, muscle cells have a heightened need for energy to sustain their increased activity. The body meets this demand through a process called aerobic respiration, which occurs in the mitochondria of cells and requires oxygen. To understand why the breathing rate increases, let’s explore the physiological processes involved:

Aerobic Respiration:

Energy Production: Aerobic respiration is the process by which cells produce energy (ATP) by breaking down glucose in the presence of oxygen. The overall equation for aerobic respiration is:

Glucose + Oxygen → Carbon Dioxide + Water + Energy (ATP)

Increased Demand for Oxygen: During exercise, muscle cells consume more ATP to sustain contractions. To produce more ATP, they require more oxygen.

Role of Breathing Rate:

Oxygen Intake: The breathing rate increases to enhance the intake of oxygen. Faster and deeper breaths allow more oxygen to enter the lungs.Oxygen Transport: Oxygen from the lungs is transferred to the bloodstream, where it binds to hemoglobin in red blood cells and is transported to the muscle cells.Efficient Respiration: The increased supply of oxygen supports the higher rate of aerobic respiration, enabling muscle cells to produce the required ATP.

Removal of Carbon Dioxide:

Byproduct Management: Aerobic respiration produces carbon dioxide (CO₂) as a waste product. An increased breathing rate helps expel this CO₂ more efficiently, maintaining acid-base balance in the body and preventing the buildup of CO₂, which can be harmful at high levels.

Additional Physiological Responses:

Heart Rate Increase: Alongside the increased breathing rate, the heart rate also rises to pump more oxygenated blood to the muscles.Blood Flow Redistribution: Blood vessels dilate (vasodilation) to improve blood flow to active muscles, further enhancing oxygen delivery.

CAN SOMEONE HELP ME PLZ
Which of these is a characteristic of a parasite?
It is a helpful organism.
It lives inside or on a host.
It makes its own food.
It is always visible to the naked eye.

Answers

The correct answer is it lives inside or on a host.

A is incorrect because a parasite steals from the host, without giving anything in return. Much like a leech

C is incorrect because leeches almost always use their host as a food source

D is incorrect because parasites can often dig beneath the host's skin to be hidden from sight

Answer:

It lives inside or on a host.

Explanation:

BAM!

What happens when a population is in hardy weinberg equilibrium apex?

Answers

The phenotype frequency does not change. 

A population is not evolving when it is in Hardy-Weinberg equilibrium for a gene, and allele frequencies will not change over time.

What is Hardy Weinberg equilibrium?

According to the Hardy-Weinberg equilibrium, if no disturbing factors exist, genetic variation in a population will remain stable from one generation to the next.

Sum total of all the allelic frequencies is 1.

p² + 2pq + q² = 1

p² = dominant homozygous frequency (AA)

2pq = heterozygous frequency (Aa)

q² = recessive homozygous frequency (aa)

Five factors affect Hardy Weinberg equilibrium:

Gene migration or gene flow: The transfer of genetic material from one population to another. When gene migration takes place multiple times it is known as gene flow.Genetic drift: When gene migration occurs by chance.Mutation: the alteration of a single base unit in DNA, or the deletion, insertion, or rearrangement of larger parts of genes or chromosomes, which changes the structure of a gene and produces a variant form that may be passed down to future generations.Genetic recombination: When chromosomes or chromosome fragments are broken and then rejoined, DNA sequences are rearranged through a process known as genetic recombination.Natural selection: The process through which populations of living things adapt and change is known as natural selection.

Learn more about  Hardy Weinberg's principle here:

https://brainly.com/question/7670970

#SPJ2

Describe the function of each organ through which food passes as it moves through the digestive tract.

Answers

The digestive system is made up hollow organs that consists of the mouth, esophagus, stomach, small intestine, large intestine and anus, sequentially. The supplementary organs are the liver, pancreas and the gall bladder.

The food enters first through the (1) MOUTH where mastication or the mechanical breakdown of food particles takes place. After the food is being swallowed it passes through the (2) ESOPHAGUS which is the conduit between the pharynx and (3) STOMACH which secretes acid and enzymes that chemically breaks down food that is termed as chyme. It comprises 10% of the digestion  and absorption. The chyme or partially digested food goes to the (4) SMALL INTESTINE where 90% of the digestion and absorption takes place. Its main functions is to absorb the nutrients and minerals from the chyme. (5) The LARGE INTESTINE is where the water from the remaining indigestible food matter is being absorbed. It also transmits the useless waste material from the body where it is excreted through the (6) ANUS

Final answer:

The digestive system consists of several organs through which food passes: mouth, pharynx, esophagus, stomach, small intestine, and large intestine.

Explanation:

The digestive system consists of several organs through which food passes as it moves through the digestive tract:

1)Mouth: Ingestion of food occurs in the mouth. Chewing breaks down the food into smaller pieces.

2)Pharynx: The pharynx is a passage that leads from the mouth to the esophagus.

3)Esophagus: The esophagus connects the pharynx to the stomach and uses peristalsis to push food down into the stomach.

4)Stomach: The stomach is a muscular organ that mixes food with digestive juices and continues the breakdown process.

5)Small Intestine: The small intestine is where most of the absorption of nutrients from food takes place. It is lined with villi, which increase its surface area for better absorption.

6)Large Intestine: The large intestine absorbs water from the remaining food waste and forms it into feces, which will be eliminated through the anus.

Compare and contrast eukaryotic cells with prokaryotic cells. Which type of cell might have been the first one to evolve and explain why this may have been the first.

Answers

Eukaryotic cells and prokaryotic cells contain a cytoplasm and ribosomes. Eukaryotic cells have organelles and a nucleus.

Prokaryotic cells were most likely to evolve first because of the simple structure.

Answer:

Prokaryotic cells are single-celled organisms that lack membrane-bound organelles and eukaryotic cells contain membrane-bound organelles.  

Prokaryotic cell lack nucleus and its genetic material is circular in form which is present in its cytoplasm while eukaryotic cell has a membrane-bound nucleus which contains linear DNA.

Prokaryotic cells might have been the first ones to evolve because prokaryotic cell is simple in organization while eukaryotic cell are more complex.  

Eukaryotic cells contain some organelle like mitochondria and chloroplast which resembles the prokaryotic cell because both have linear DNA and 70s ribosome.  

So it supports endosymbiotic theory which says that a large prokaryotic cell engulfs a small prokaryotic cell and both remained in symbiotic association with each other and evolved to form eukaryotic cells.

Which branch of medical anthropology emphasizes that cultural systems, including medical systems, are symbolic systems and that people's ideas and practices about sickness and health need to be situated in their own symbolic cultural contexts? demographic medical anthropology evolutionary medical anthropology interpretive medical anthropology structural medical anthropology?

Answers

That branch would be interpretive medical anthropology.

That branch would be interpretive medical anthropology.

The diagram shown above, illustrates the _______ cycle. A) carbon B) nitrogen C) phosphorus D) water

Answers

the answer is carbon i had just taken the test.

What type of manufacturing is most responsible for TCE releases?

Answers

Trichloroethylene is used for industrial degreasing operations. It is used as an industrial solvent in the process of manufacturing metal parts. It is used also for vapour degreasing and cold cleaning of metal, and removing oils and tars. It is also widely used for dry cleaning of fabrics.  

) briefly explain the difference between oxidation and reduction electrochemical reactions

Answers

in electrochemical cell there is an oxidation and reduction such as ( zn - cu ) in galvanic cell the zn lose 2 electrons and its called oxidation reaction (anode ) and cu is gain the electron that the zn lose it so it it is called reduction  reaction (cathode)
and its notation zn^/zn^+2//cu^+2/cu 

an air mass that originates in the pacific ocean west of brazil is most likely what

Answers

Answer:

Warm and wet

Explanation:

Air masses are large portions of air that have relatively homogeneous internal temperature, pressure and humidity conditions, influenced by the region where they are formed. The place of formation of the air mass is called the region of origin, this is where the air mass will acquire its characteristics of temperature, pressure and humidity. Therefore, an air mass originating from western Brazil, will have common characteristics of a tropical region, that is, this air mass will be wet and have a high temperature.

For this reason, we can guarantee that an air mass that originates in the Pacific Ocean west of Brazil is likely to be warm and wet.

Final answer:

An air mass originating in the Pacific Ocean, west of Brazil, would be classified as maritime tropical (mT), implying that it is A. warm and wet.

Explanation:

An air mass that originates in the Pacific Ocean, west of Brazil, is most likely warm and wet. Air masses are classified based on temperature and moisture. Since the Pacific Ocean is a large body of water, an air mass originating there would pick up moisture, making it "maritime" (m) or wet. The geographic location near the equator indicates that the air mass would be "tropical" (T), and thus warm. The combination of maritime and tropical characteristics leads us to classify the air mass as maritime tropical (mT), which is warm and moist.

. what is causing ellie's thyroid to secrete too much hormone?

Answers

Secreting too much of thyroid hormones is a condition called hyperthyroidism. Causes of hyperthyroidism are different and may happen when the entire gland is overproducing thyroid hormone or a single nodule ("hot")  is responsible for the excess hormone secretion. Some of the causes of hyperthyroidism include thyroiditis (inflammation of the thyroid), clinical conditions like Graves' disease (an autoimmune disease that affects thyroid), thyroid adenoma (benign tumor of the thyroid gland), hypersecretion of thyroid stimulating hormone (TSH)…

Answer:

Ellie's problem is probably being caused by Grave's disease.

Explanation:

Graves Disease is an autoimmune disease, that is, caused by a defect in the immune system that leads to inflammation of the thyroid by the autoantibodies themselves, defense proteins that exist to protect our body from infections and aggressors. The result is that the thyroid begins to secrete more hormone than it should, causing some problems to the body.

Porth's the composition of the cerebrospinal fluid is similar to extracellular fluid with the exception of

Answers

is it magic... i have issues

Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3')? view available hint(s) where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3')? it would not bind the target dna. ttttagccatttacgattaatcg ttttagccatttacgattaatcg ttttagccatttacgattaatcg?

Answers

It would bind to the part that has a complementary sequence. Since A pairs with T and C pairs with G then it would bind to  ttagc sequence on the  DNA strand. The two DNA pieces would also align in anti-parallel alignment.






What cardiovascular disease creates a large number of abnormal white blood cells?

Answers

White blood cells also called leukocytes are the cells that help fight infection causing protection of the body against a disease or foreign substance. An example is a leukemia which then creates a large number of abnormal white blood cells.

Match these cell cycle checkpoints to their role in genome integrity is the dna replicated with out damage?

Answers

Final answer:

The cell cycle is regulated by checkpoints (G₁, G₂, and M) that ensure genome integrity by assessing DNA integrity, chromosomal replication, and proper attachment of the kinetochores to spindle fibers, respectively.

Explanation:

The cell cycle events are regulated at key points known as checkpoints. These checkpoints help maintain the genome integrity by ensuring that all the necessary actions have taken place correctly before the cell moves to the next phase.

First, the G₁ checkpoint is where the integrity of the DNA is assessed. If any damage to the DNA is detected, the cell cycle is halted until repairs are made. This is to prevent the replication of defective DNA.

The G₂ checkpoint is the phase where cell size and protein reserves are evaluated, and importantly it ensures all the chromosomes have been replicated without damage. If any irregularities are spotted, the cell cycle stops to either complete correct replication or repair the damaged DNA.

Lastly, the M checkpoint or the mitotic checkpoint works during the mitosis phase. Here, proper attachment of each kinetochore to a spindle fiber is assessed. The cell cycle will not proceed until all sister chromatids are correctly attached to the spindle fibers.

Learn more about Cell Cycle Checkpoints here:

https://brainly.com/question/29639561

#SPJ3

Choose all the answers that apply. Which of the following organelles are found in plant cells but not in animal cells?
(1) cell membrane
(2) cell wall
(3) chloroplasts
(4)vacuole
(5)nucleus

Answers

The animals cell doesn't have cell wall and chloroplasts, I think? I'm sorry if I got wrong.

The organelles are found in plant cells but not in animal cells are cell wall and chloroplast. Thus, option B and C are correct.

What is the difference between plant cell and animal cell?

The main difference between plant cell and animal cell is that plant cell contain cell wall and chloroplast and animal cell does not contain cell wall as well as chloroplast. Plant cell contain chlorophyll that provide green color to the plants.The main function of the cell membrane has to keep away the toxic material out of the cell.

Cell membrane has been defined as a wall that differentiate and protect the inner structure of the cell from the outer environment. The main function of the cell membrane has to keep away the toxic material out of the cell. The cell membrane contain channels as well as the receptors that gives the permission to only selective permeable membrane to enter into the cell.

Therefore, The organelles are found in plant cells but not in animal cells are cell wall and chloroplast. Thus, option B and C are correct.

Learn more about plant cell and animal cell here:

https://brainly.com/question/1493437

#SPJ6

Other Questions
There are many methods used to obtain energy for use in our daily lives. Some of these methods have possible environmental consequences to rivers, groundwater, and organisms. One type of pollution involves excess carbon dioxide being released into the air. Some of the carbon dioxide reacts with water to form acid rain. Which energy sources can release carbon dioxide and carbon monoxide waste into the atmosphere? A)wind and solar B)wind and nuclear C)solar and nuclear D)coal and petroleum Which of the choices below is not a function of testosterone?a. contributes to male sexual behavior and spermatogenesisb. stimulates the male pattern of developmentc. stimulates mammary gland developmentd. stimulates protein synthesis? In a cross-border alliance, cultural differences can be overlooked when ________. How was President Franklin Roosevelt's personal life connected to the state of Georgia?A)He was born in Georgia.B)He traveled there because of his illness.C)He married someone who was originally from Georgia.D)He went there for security reasons during World War II. Use the Babylonian method to estimate 80 to the nearest hundredth. what were some of the arms control agreements reached during the cold war An open box with a square base should be constructed. the bottom, should be constructed from a heavy duty cardboard that cost $3 per square inches and the sides from a medium duty cardboard that cost $2 per square inches. if the volume of the box must be 120 cubic inches, what should be the dimensions of the box in order to minimize the cost for the material? Smooth muscle in the walls of the urine move urine along to the bladder by Hamlet interacts with Osric in act 5, scene 2. What function does this interaction have in the play? It resolves a problem. It provides comic relief. It heightens the tragedy. It is an example of dramatic irony. The purposes of sending an application or rsum follow-up message to an employer include jogging the memory of the hiring manager, showing your serious interest in the position, and setting a deadline for the employer to offer you the position. sending a personal note to the receptionist, who often helps make the final decision. emphasizing your qualifications or adding new information. sharing your photograph to match your qualifications to your face. If Mrs garcia maintains a constant speed, consistent with the results above, how many words can she type in 49 minutes Is this a valid statement?"The French Revolution was the manifestation of Enlightenment ideals." A fair coin is tossed three time sin succession. the set of equally likely outcomes is {hhh,hht,hth,thh,htt,tht,tth,ttt}. find the probabilty of getting exactly zero tails Which is true of European relationships in the 1500s? Alliances between Catholic and Protestant countries led to greater stability. Wars were common and alliances often shifted. Nations traded colonies amongst themselves. Stable economies led to strong alliances. An electron has kinetic energy 3.00 ev. find its wavelength. HURRY PLEASE TAKING QUIZ RN!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!Values are the organization of written or spoken symbols into a standardized system. T F One of the biggest differences between american movie-making and international filmmaking is the emphasis of hollywood on fictionalized entertainment. one of the first directors who was successful within the documentary genre was the american director _____________, who shot an epic story about eskimos entitled nanook of the north (1922). Find the unknown. = (764 2) + 12 Khalil is wrapping a cylindrical candle for a gift. The candle is 10 inches tall and has a diameter of 1.5 inches. How many square inches of wrapping paper will Khalil need to cover the candle? Use 3.14 for pi. When ordering a student desk priced at $69.00, the shipping charges are 6%. What is the total cost of the desk?