According to Fodor, in the functionalist view the psychology of a system depends not on the stuff it is made of but on _____. A. what psychologists say about the stuff B. what kind of stuff it is C. how the stuff is put together D. how the stuff relates to modern physics

Answers

Answer 1

Explanation:

According to fodor in the functionalist view the psychology of a system dependents not on the stuff it is made of but on B

Answer 2

The correct answer is letter C

Functional psychologists define psychology as a biological science interested in studying psychic (mental) processes, operations and acts as forms of adaptive interaction. They start from the assumption of evolutionary biology, according to which living beings survive if they have the appropriate organic and behavioral characteristics to adapt to the environment.

They consider mental operations and processes (such as the ability to feel, think, decide, etc.) to be the true object of psychology, and the study of that object requires a variety of methods. They do not exclude self-observation, although they do not approve experimental introspection in the Titchenerian style, because it would be very artificial. They do not rely entirely on self-observation, given their scientific difficulties: it is impossible to check publicly whether a self-observation has been done well and, therefore, it is difficult to reach an agreement based on such observations.


Related Questions

Professor Thomas wrote a very positive letter of recommendation for a student, despite his doubts about her competence. After writing the letter, he began to develop a more favorable attitude toward the student's abilities. Which theory best explains why?

Answers

Answer:

Cognitive Dissonance Theory

Explanation:

cognitive dissonance theory suggests that we have an inner drive to hold all our attitudes and behavior in harmony and avoid disharmony.

Cognitive dissonance theory is important because it may prompt some people to change their behavior so that their actions align with their beliefs, In this way, it provides some people with an opportunity to examine their values and actions and achieve cognitive consistency such that Professor Thomas wrote a very positive letter of recommendation for a student, despite his doubts about her competence and later began to have a good attitude towards the student's abilities

how is the building from the renaissance similar to the building from ancient rome

Answers

Answer:

both made from red brick

Explanation:

By the ninth century, the empire had emerged in eastern Indochina. It developed around agriculture and used to store water. To the south, the Srivijaya empire emerged in . It relied on farming and trade.

Answers

Answer:

Explanation:

By the ninth century, the Khmer empire had emerged in eastern Indochina. It developed around agriculture and used reservoirs to store water. To the south, the Srivijaya empire emerged in Indonesia . It relied on farming and trade.

By the ninth century, the Khmer empire had emerged in eastern Indochina. It developed around agriculture and used reservoirs to store water. To the south, the Srivijaya empire emerged in Sumatra and Java. It relied on farming and trade.

1. The Khmer empire, centered in present-day Cambodia, was known for its sophisticated agricultural practices, including the construction of extensive irrigation systems such as reservoirs to support rice cultivation. These reservoirs played a crucial role in managing water resources for agricultural purposes.

2. The Srivijaya empire, located in the maritime region of Southeast Asia, particularly in Sumatra and Java, was a major center for trade and maritime activities. While agriculture was important in the region, the Srivijaya empire's economy was also heavily reliant on maritime trade networks, connecting it to other parts of Southeast Asia and beyond.

Complete Questions

By the ninth century, the ______ empire had emerged in eastern Indochina. It developed around agriculture and used ______ to store water. To the south, the Srivijaya empire emerged in _______. It relied on farming and trade.

2. What effect did the Zimmerman Telegram have on the USA?*
Your answer

Answers

Answer:

below

Explanation:

The Zimmerman Telegram influenced the decision of U.S politicians to enter World War One, this Telegram sent by Germany to Mexico promised Land that they previously owned after the U.S obtained them after Jan/ 13/ 1847.

What is one example of the way a rise in productivity during the 1950s improved the standard of living in the United States? A) it gave workers more time off. B) it led to a sharp increase in urbanization. C) it led to the end of discrimination in the U.S. D) it eliminated poverty Please help me!

Answers

Final answer:

The rise in productivity during the 1950s improved the standard of living by giving workers more leisure time as workweeks decreased, also leading to improved health, education, and a wider variety of products and services.

Explanation:

One significant way that the rise in productivity during the 1950s improved the standard of living in the United States was by giving workers more leisure time. Increased productivity and advances in technology meant that the typical workweek for a U.S. worker decreased from about 60 hours to less than 40 hours. This reduction in work hours represents one specific example addressing how productivity benefits individuals' lives outside of purely economic measures such as GDP.

The benefits extended beyond more leisure time. Due to productivity gains, life expectancy and health also improved, as did the variety of products and services available to consumers. These advancements contributed to a marked improvement in the standard of living beyond what purely economic indicators might show.

Moreover, the period marked significant urbanization with the rise of urban centers, reflecting economic growth and increased social mobility. This shift towards more urban living altered the fabric of American society, making it more diverse and increasing access to opportunities for many individuals.

The visual culture of the twentieth century was focused on

Answers

Answer:

film

Explanation:

The visual culture of the twentieth century was focused on  film.

Answer:

Film

Explanation:

Visual culture is a term that describes cultural expression in visual images, by twentieth century, it is considered as reformulations of issues of photography and film theory that had been raised in the early part of the century, most notably, from the 1920s and 1930s

Hence, during the period of twentieth century, the focus of visual art is film, through many authors like Béla Balázs, László Moholy-Nagy, Siegfried Kracauer and Walter Benjamin

Critical elections in the united states typically have occurred

Answers

Answer: When groups of voters have changed their traditional patterns of party loyalties

Explanation:

It should be noted that, in United States of America, critical elections typically have occured in a situation whereby groups of voters have changed their traditional patterns of party loyalties. In this situation, some group of voters have eventually decided to change their usual pattern of party loyalties known as traditional.

Answer:

They generally occur at the time when groups of voters begin to change their views on traditional patterns of party loyalty.

Explanation:

Critical elections is a term used in politics to show a feedback, a change in the party ideology of a group of people who are usually party leaders or politicians. This ideological change refers to the changes of opinions on some concepts defended by the party that a certain politician is part of, generating a disagreement with between the politician and those concepts.

This change of opinion results in an intense change in the political structure of a region.

In summary, we can say that critical elections occur when they usually occur at the time when groups of voters begin to change their views on traditional patterns of party loyalty.

"How can Quebec, with no economic base and no land base, ask to become sovereign? How can Quebec be a nation when they have no constitution?..."
- Mohawk tribesman, Akwasanse
From this passage, it can be concluded that

Answers

The tribes have no constitution so therefore they got no rights

Alicia leaves her office building only to find it is raining. She returns to her office and gets a trash bag out of the supply cabinet. Using a pair of scissors, she cuts the bag so that she can put her head and arms through the bag without getting wet. In using the trash bag as a makeshift rain jacket, Alicia has overcome
functional fixedness.

Answers

The correct answer is functional fixedness.

Functional fixation is a type of cognitive bias that gives us the tendency, as human beings, to only use products and services as they are conventionally used.

It explains why we do not use the items more efficiently and / or cheaply, having been initially studied (and received this name) because of the research carried out by the psychological Karl Duncker.

Why are people racist

Answers

Because we tend to hang out with people like us, we take the opinions of people around us, we are quick to judge, and we blame others for our problems.

Source: Human Rights Australia

Answer:

Because they have no love; but filled with hatred. If there is love in them, they will treat everyone as they would love to be treated.

Quincella is trying to reduce her level of prejudice. she decides to tell herself to not think in stereotypical terms. what does research suggest is the probable outcome of quincella's strategy?

Answers

Answer:

Quincella's strategy may actually increase her prejudice

Explanation:

Based on the scenario being described within the question it can be said that Cognitive research would indicate that Quincella's strategy may actually increase her prejudice. This is because by reminding herself of not to do this, she is subconsciously reinforcing her biases, and therefore actually increasing her level of prejudice.

Answer: Quincella's strategy may actually increase her prejudice.

Explanation: Prejudice may be described as bias in judgement introduced due to preconceived thought, feeling or notion haboured about a particular group. Stereotypical view may be regarded as individual's generalized view or perception inferred about persons belonging to a certain group. According to the context, if Quincella decides not to think or judge based on stereotypical terms to avoid prejudice, through such thought, her biases are being unconsciously enhanced and as such may raise her level of prejudice subconsciously.

Erin has been living with her boyfriend for a year. During that time, Erin has heard her boyfriend and his family make many negative comments about Asians. When her boyfriend's family is around, Erin also occasionally makes negative comments about Asians, even though she doesn't believe these comments are based in facts. This situation best represents the distinction between ________ and ________.

Answers

Answer:

Public conformity; private acceptance

Explanation:

Erin has been living with her boyfriend for a year. During that time, Erin has heard her boyfriend and his family make many negative comments about Asians. When her boyfriend's family is around, Erin also occasionally makes negative comments about Asians, even though she doesn't believe these comments are based in facts. This situation best represents the distinction between Public conformity and private acceptance.

The Queensland tropical rainforest ecosystem is located in

Answers

Answer:

Northeastern Australia

Explanation:

The Queensland tropical rain forests are a terrestrial ecoregion located in northeastern Australia and belonging to the Australasian realm. The forest contains the world's best living record of the major stages in the evolutionary history of the world's land plants.

Answer:

A. northeastern Australia

Explanation:

I took the test, and chose B and it was wrong. It says A is right on Edg

Your son brings home a bad grade on his report card. He is not allowed to play with his video game until the next test. If this successfully removes the bad grade, then preventing him from playing with his video game is an example of ________.

Answers

Answer:

Over-reactive Parenting

I wouldn't take away my son's video games over that. (If I had one)

which region did people migrate to find gold in 1849?

Answers

On January 24, 1848, James Wilson Marshall, a carpenter originally from New Jersey, found flakes of gold in the American River at the base of the Sierra Nevada Mountains near Coloma, California

Answer:

They migrated to what now is California but in 1849 it was an Unorganized territory.

Kathy enjoys a diet cherry vanilla Dr. Pepper after her workout each day. After about four weeks of this routine, she grows tired of the same soft drink and switches to Crystal Light lemonade. Kathy is displaying variety-seeking behavior.

A. True
B. False

Answers

The answer is true because Kathy is moving from one brand of soft drink to another brand

Answer: the answer true.

"In the far future, a starship becomes trapped inside the event horizon of a black hole. Although the crew discovers that their ship cannot out, they at least want to send a message to other ships in the area to stay away from the danger zone. If they send out a message in the form of a radio wave, what will be its fate?

Answers

Answer: The message will not emerge beyond the horizon

Explanation:

Although sound travel wide in an environment that's open and wide but they are occasions where sound is limited to move beyond a particular range, this is due to some obstacles that hinder the sound from travelling from the point of the sound to wherever it needs to go, as this obstacles limit them. The starship crew wants to send said a message to the other ships to avoid their area, the horizon they find themselves won't permit the sound to leave it shores.

The interconnected nature of social categorizations such as race, class, and gender as they apply to a given individual or group creates overlapping and interdependent systems of discrimination or disadvantage is known as what?

Answers

Answer:

Intersectionality.

Explanation:

The term intersectionality was coined by Kimberlé Crenshaw in 1989. Kimberlé Williams Crenshaw is a social activist and legal scholar.  

The term intersectionality tends to help one identify the prevailing overlapping oppressions based on sexism, racism, gender, poverty, etc. She defined the term intersectionality as stated in the question.  

This term can be better understood with the help of an example. For example, a black man who is poor will live a less privileged life and will have to face discrimination based on color.  

So, the correct answer is intersectionality.

You have noticed that when you are at the gym, your exercise routine is not affected by how many other people are there. However, it is affected when other people are watching you exercise. This pattern in your behavior is what social psychologists call Group of answer choices mere presence. social loafing. social facilitation. evaluation apprehension.

Answers

Answer:social facilation

Explanation:

What is the study of earth's plant, animals, and climates?

geology
physics
biology
geography

Answers

Answer:

biology

Explanation:

Biology is the natural science that studies life and living organisms, including their physical structure, chemical processes, molecular interactions, physiological mechanisms, development and evolution.

Biology
Hope this helped u

The successful trade in Japanese electronics has resulted in the diffusion of what popular recreational activity?
Racing automobiles
Playing video games
Sharing instant photos
Sending text messages

Answers

ANSWER:

A) Racing automoblies

Explanation:

Imagine that you are a salesperson in a major department store. Though you might not actually believe it, you follow the policy of "the customer is always right" in your daily work at the store. However, since you do not agree with that view, you often experience

Answers

Answer: COGNITIVE DISSONANCE.

Explanation: COGNITIVE DISSONANCE refers to a CONFLICT or ANXIETY resulting from inconsistencies between one's beliefs and one's actions or other beliefs. An example of cognitive dissonance is when an individual smoke knowing that smoking causes cancer, they are in a state of cognitive dissonance.

In this question, cognitive dissonance is the salesperson not agreeing with a fact "customers are always right" but acting in a capacity to enable the agenda that customers are right.

Answer:

cognitive dissonance.

Explanation:

Cognitive dissonance occurs when an individual displays conflicting ideas or notions about an action which results in psychological breakdown because of that. People with a different notion about an idea tend to become psychologically uncomfortable until the inconsistency is resolved. This arises when people have a belief that contradicts with an information that is widely accepted, they try to resolve the conflict to reduce the psychological trauma. Trying to cope with those seemingly opposite ideas could be mentally stressful as you are being compelled to accept things that are not in line with your beliefs.

Why do you think agricultural experts urged Georgia’s farmers to diversify their crops?

Answers

They depended on cotton and should have been growing more than one crop.

Final answer:

Agricultural experts recommend crop diversification in Georgia to mitigate risks like pests and fluctuating markets, utilize crop rotation to maintain soil fertility, and capitalize on specialty crop areas to maximize profit margins while improving resilience.

Explanation:

Reasons for Diversifying Crops in Georgia's Farming

Agricultural experts recommend Georgia's farmers to diversify their crops for several key reasons. One main advantage of crop diversification is the mitigation of risk. Farms relying on a single crop are highly vulnerable to pests, diseases, and fluctuating market demands, which can lead to financial instability. By growing a variety of crops, farmers can create a buffer against these uncertainties.

Crop rotation is another advantage of diversifying crops. When farmers rotate different types of crops, such as alternating between corn (a cereal crop) and soybeans (a legume), they help maintain soil fertility and reduce the need for chemical fertilizers. Legumes, for example, fix nitrogen in the soil, which benefits the following cereal crops and promotes sustainable farming practices.

Lastly, specialty crop areas allow farmers to capitalize on unique local conditions to grow specific crops that yield a higher profit margin due to lower supply and higher demands, fitting the model of supply and demand. However, even specialty crop growers can benefit from diversification within their niche, thereby improving resilience to adverse conditions and market changes.

What is the definition of a juvenile?

Answers

Answer:A juvenile delinquent is a young person, particularly a teenager under the age of eighteen, who breaks a state or federal law by committing a crime. Teens are still immatures and do not think like adults, therefore they are prone to making mistakes or committing crimes that are not fully in their control

Explanation:

Answer:of, for, or relating to young people

Sheeba, the dog, hates the vacuum cleaner. Starting the vacuum causes Sheeba to bark, to attempt to attack the vacuum and to go crazy. She even acts the same way when the mixer is turned on. What accounts for her barking at the mixer?

Answers

Answer:

stimulus generalization

Explanation:

Stimulus generalization is the process that occurs when our conditioned reaction to one stimulus is similar to the reaction that revokes other, sometimes identical, stimulus.

In this example, we see that Sheeba is reacting to the sound of the vacuum cleaner, and she started connecting the noise of the vacuum to the noise of the mixer. Therefore, they are generalized stimuli, put in the same category in her consciousness, and awaking the same barking and attacking reaction.

Madison wants to examine the effect of a defendant's appearance on judgment of guilt for a crime. She has participants read an identical account of a crime except for the defendant's appearance. A group of high school students receive a description of an attractive defendant while a group of senior citizens receive a description of an unattractive defendant. Both groups are then asked to rate the defendant's guilt on a 7-point scale. A major confound in Madison's experiment is
The age of the participants

Answers

Answer:

The age of the participants

Explanation:

Confound is described as one of the different methodologies that are responsible for creating confounding variables. Although, it can often threat the results of particular research because of its relationship with that of the independent variable as well as the dependent variable.

A confound is a variable that an experimenter intentionally doesn't control i.e, the extraneous variable and often influence the findings of the research.

In the question above, A major confound in Madison's experiment is the age of the participants.

The major confound in Madison's experiment is the age of the participants because different age groups could possess varying inherent biases or perceptions that can influence their judgment, thus affecting the reliability of the conclusion concerning the defendant's appearance and perceived guilt.

The issue in Madison's experiment is the potential confound related to the age of the participants. When assessing the effect of a defendant's appearance on judgments of guilt, it is essential that all other variables are held constant except for the one being tested, which in this case is the defendant's appearance. However, by having different age groups (high school students and senior citizens) rate attractiveness and guilt, other variables like generational attitudes towards crime and physical appearance might influence the outcome. This confounding variable makes it difficult to attribute differences in guilt ratings solely to the attractiveness of the defendant, as younger and older participants may have inherent biases or perceptions that influence their judgment differently. As a result, the reliability of the conclusion regarding the relationship between the defendant's appearance and perceived guilt is compromised.

"Barclay is getting ready for a date with someone new. Before he leaves his apartment, he decides to smoke some marijuana, which he believes helps him to be more charming and interesting. Which theoretical perspective best explains Barclay's actions"?

Answers

Answer:

Cognitive          

Explanation:

Cognitive perspective: In psychology, the term "cognitive perspective" is described as a perspective which is concerned with an individual's mental functions including attention, memory, perception, etc. It demonstrates that human beings are somewhat similar to computers as both of them process information i.e, input and output process. However, it possesses many different applications and involves eyewitness testimony and cognitive therapy.

In the question above, Barclay's actions are best explained by the cognitive perspective.

Answer:

Cognitive Perspective

Explanation:

The Cognitive Perspective is the perspective that is related to mental functions such as 'memory, perception, problem solving, and thinking.'

The cognitive perspective comes under the psychological study of cognition. The approach of cognitive psychology was first studied by William Wundt in 1879.  

In the given case, Barclay's perception can be best explained by Cognitive perspective theory. His perception about smoking marijuana which makes him think that he will appear more charming and interesting can be studied under cognitive perspective because this field of study helps in learning about memory, thinking, perception, etc.

So, the correct answer is cognitive perspective.

Why do some people consider the way the media cover candidates for public office bad for democracy?
A. People tend to vote for the candidates who they find most appealing, rather than the ones whose
beliefs are most like their own.
B. The media are for-profit businesses, unable to be fair or objective in the interest of the public.
C. Candidates already in office receive more media attention than those who are trying to take their
positions.
D. People always vote for the person the media determine is most qualified, rather than the candidate
who can bring about change.

Answers

Answer:

dont know

Explanation:

Rina is creating a public service announcement to persuade people to fix leaks in their homes. Which evidence should she include to support her claim that fixing leaks helps prevent wasting water? Even a minor leak in a sink can drip thousands of gallons of water in one year. Leaking faucets and toilets can raise a family's water bill. People often use too much water because they leave the sink on for too long. There are many ways to conserve water, including taking shorter showers.

Answers

Implementing water-saving measures at home, such as installing water-saving toilets and fixing leaky faucets and shower heads, can help prevent wasting water.

Fixing leaks can help prevent wasting water by implementing water-saving measures at home. For example, installing water-saving toilets that use less water per flush can save up to 20,000 gallons per year for a single household. Fixing leaky faucets and shower heads is crucial as even one drip per second can waste over 6,000 gallons of water in a year per faucet.

Which one of the following statements regarding the Microskills Hierarchy is NOT true?

a. The Ivey Taxonomy and the Microskills hierarchy represent a systematic breakdown of
the key skills required for intentional interviewing.
b. The Ivey Taxonomy and the Microskills hierarchy provide fairly consistent predictions of
client responses to accurate interviewer execution of a specific skill.
c. The Ivey Taxonomy and the Microskills hierarchy provide flexibility for the interviewer
when the unexpected occurs.
d. The Ivey Taxonomy and the Microskills hierarchy, with experience, become automatic
and allow you to always predict client responses to accurate interviewer use of the skills.

Answers

Answer:

Option d :The Ivey Taxonomy and the Microskills hierarchy, with experience, become automatic and allow you to always predict client responses to accurate interviewer use of the skills

Explanation: microskills refered to as verbal and behavioral responses set which quickens counseling and alliance formation processess eventhough there are skilled counselors and others in place.. skills in this medium has hierarchical orderthat are arranged systematically, has a good framework and are well organized.The Ivey Taxonomy is the background or basis for developing or growth of the Microskills in the Hierarchical order.

Final answer:

The statement that d. the Ivey Taxonomy and the Microskills hierarchy, with experience, become automatic and allow you to always predict client responses to accurate interviewer use of the skills is NOT true

Explanation:

The Ivey Taxonomy is a classification system used in education and business to categorize case studies and teaching materials. Developed by the Richard Ivey School of Business, it organizes cases into 16 categories based on industry, company size, and other criteria. It helps educators and researchers locate relevant cases for teaching and analysis.

While the Ivey Taxonomy and the Microskills hierarchy provide a systematic breakdown of key skills required for intentional interviewing and offer flexibility for the interviewer when unexpected situations arise, they do not guarantee the ability to always predict client responses. The effectiveness of the skills also depends on factors such as the individual client and the context of the interview.

Learn more about Microskills Hierarchy here:

https://brainly.com/question/32138808

#SPJ6

Other Questions
What was a characteristic of the rulers of the Zhou dynasty? A photo is printed on a 20-inch by 24-inch piece of paper. The photo covers 320 square inches and has a uniform border. What is the width of the border? At the local airport, you set off the alarm on the magnetometer. If you announce, "Never mind, I don't want to fly today," Can the security officials still detain you and search you for weapons? PLEASE HELP!! DUE TODAY! I GIVE BRAINLIEST Why can a theory never become a law Why do you think Dreiser wrote this piece? What is he attempting to say by writing about his brother? Solve for x. Write both solutions, separatedby a comma.5x2 + 2x - 7 = 0 What causes the trade winds? Read the following paragraph and answer the question below.1Wuthering Heights is in the midst of the desolate English moors. 2Outside the gates of this solitary dwelling, the landscape expands into dreary shades of brown and gray, with only the craggy cliffs on the distant horizon to break the monotony. 3Wildlife and foliage are scarce. 4The few trees that do live must eke out their existence: the north wind blows constantly. 5The house itself, built to withstand the tumults of wind and rain, is cold and forbidding. 6The stone walls and earthen floors offer no relief from the bone-chilling dampness of northern England. 7In sharp contrast to Wuthering Heights is Thrushcross Grange. 8Situated in a sheltered valley, Thrushcross Grange is calm and peaceful, and is surrounded by lush flower gardens. 9The refined elegance of Thrushcross Grange differs as much from Wuthering Heights as the rose differs from the thorn. 10The contrast between these two settings is symbolic of the ultimate conflicts in Emily Bronte's novel Wuthering Heights.Name the shape of the paragraph. __________ .A)regular triangle B)inverted triangle C) diamond D) rectangle Below is the double-stranded DNA sequence of part of a hypothetical yeast genome. Within this sequence is a small gene, PICO8, that codes for an 8 amino-acid peptide (assume traditional start codon). Transcription of PICO8 starts at the Transcription Start Site (TSS) after the promoter and proceeds in the direction of the arrow. Transcription stops at the end of the transcription terminator. 5' - CTATAAAGAGCCATGCATATCTAGATAGTAGGCTCTGAGAATTTATCTCACT - 3 3 - GATATTTCTCGGTACGTATAGATCTATCATCCGAGACTCTTAA ATAGAGTGA - 5 promoter terminator Which strand of DNA is the CODING strand? (TOP OF BOTTOM?) Select only ONE answer choice. A. Top B. Bottom C. Either can serve as the codong strand D. There isn't enough information to determine which is the coding strand The Confederacy held captured Union soldiers in a military prison located in As a result of mitosis, in a human body cell, the nucleus of each daughter cell contains _________ chromosomes. Ethan and Chloe shared 50 in the ratio 1:4 Which are evidence of seafloor spreading? Select three options. There are 14 books on a shelf. 6 of these books are new.(a) What is the ratio of used books to all books?(b) What is the ratio of new books to used books?? an elevator at a construction site has a maximum capacity of 2500 pounds. if the elevator operator weights 160 pounds and each cement bag weighs 60 pounds, how many bags of cement can be safely lifted on the elevator in one trip? What is the image point of (6,-1) after a translation left 4 units and down 5 units? What is the value of a? Word bank:borrarchrtercorreo basuraen lneaesnobestrsGUSTAVO Voy a leer el correo electrnico.REBECA Bah, yo slo recibo ____________. Lo nico que hago con la computadora es ________________ mensajes.GUSTAVO Mira, cario, hay un anuncio en Internet: un viaje barato a Punta del Este. Es un vuelo ___________________.REBECA ltimamente tengo tanto ____________________. Sera buena idea que furamos de vacaciones. Pero busca un hotel muy bueno.GUSTAVO Rebeca, no seas ___________________, lo importante es ir y disfrutar. Voy a comprar los boletos ahora mismo ______________________. IM giving 15 points please help!a 42 meter lighthouse is observed by a ships officer at a 65 degree anlge to a path of the ship. At the next sighting, the lighthouse is observed at a 42 degree angle. To the nearest meter what is the distance between the 2 sightings?